D10Mgh6 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: D10Mgh6

Symbol: D10Mgh6
Previously known as: oxsts5419; R5720; 
RGD ID: 34445
Expected Size: 137 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
GRCr81061,843,496 - 61,843,633 (+)Marker Load Pipeline
mRatBN7.21061,345,276 - 61,345,413 (+)MAPPERmRatBN7.2
Rnor_6.01064,648,175 - 64,648,311NCBIRnor6.0
Rnor_5.01063,366,082 - 63,366,218UniSTSRnor5.0
RGSC_v3.41067,677,924 - 67,678,060UniSTSRGSC3.4
Celera1060,360,352 - 60,360,488UniSTS
RH 2.0 Map10641.2RGD
SHRSP x BN Map1045.5399RGD
Cytogenetic Map10q26UniSTS
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   SR/Jr   MNS/Gib   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   GK/KyoSwe   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd   SS.MNS-(Aldoc-D10Mco1)/Jr   LEW.SS-(D10Mgh6-D10Mgh1)/Ayd   LEW.SS-(D7Rat27-D7Mgh1)(D17Rat15-D17Rat51)(D10Mgh6-D10Mgh1)/Ayd  
QTLs:   Niddm3   Eae3   Bp71   Bp76   Tls3   Cm44   Esta1   Anxrr22   Cm75   Cm78  
Genes:   Abr  


Annotation


#
Reference Title
Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. Genetic analysis of non-insulin dependent diabetes mellitus in the GK rat Galli J, etal., Nat Genet 1996 Jan;12(1):31-7
3. Rat Genetic Map Data Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
4. Electronic Transfer of SSLP Data Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
5. UniSTS Pipeline RGD automated pipelines
6. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
7. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8
8. Electronic Submission of SSLP Data Sets Wilder R. Oct.2000. National Institute of Arthritis and Musculoskeletal and Skin Diseases, ARB Rat Genetic Database


 
Forward Primer CCTGCCTAAGTAATACAGTGGTC
Reverse Primer CCAGACCTTGTATGCTGGGT
 
Strain, Expected Size(s)

ACI/N 145 AVN/Orl 145 BBDP/Rhw 155
BBDR/Rhw 155 BC/CpbU 153 BDIX/Han 155
BDVII/Cub 145 BN-Lx/Cub 137 BN/SsNHsd 137
BP/Cub 145 BUF/Pit 145 COP/OlaHsd 155
DA/PitN 145 DON/Melb 145 F344/Pit 145
FHH/Eur 145 GH/Omr 145 GK/KyoSwe 155
IS/Kyo 157 LE/Mol 145 LEW/Pit 145
LH/Mav 145 LN/Mav 145 LOU/CHan 145
M520/N 145 MHS/Gib 145 MNR/N 147
MNRA/N 145 MNS/Gib 145 MR/Pit 147
NEDH/K 137 NP9 145 ODU/N 139
OKA/Wsl 145 OM/Ztm 155 P5C 145
PVG/Pit 145 SD/Rij 137 SHR/OlaHsd 145
SHRSP/Riv 145 SR/Jr 133 SS/Jr 133
WAG/RijKyo 145 WF/Pit 145 WKY/OlaHsd 139
WTC/Kyo 139


GenBank Nucleotide CH473948 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000240 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles



Note Type Note Reference
1 to 11 of 11 rows
Database
Acc Id
Source(s)
NCBI Gene 100303092 UniSTS
  100303131 UniSTS
  100303203 UniSTS
  101027067 UniSTS
  101027070 UniSTS
  287537 UniSTS
  326411 UniSTS
  326550 UniSTS
  326555 UniSTS
  369095 UniSTS
  369099 UniSTS
1 to 11 of 11 rows