D7Mit1 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: D7Mit1

Symbol: D7Mit1
Previously known as: oxsts5233; R545; MIT545; 
RGD ID: 33780
Expected Size: 177 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
GRCr87135,371,291 - 135,371,468 (+)Marker Load Pipeline
mRatBN7.27133,492,707 - 133,492,884 (+)MAPPERmRatBN7.2
Rnor_6.07143,965,415 - 143,965,591NCBIRnor6.0
Rnor_5.07141,760,721 - 141,760,897UniSTSRnor5.0
RGSC_v3.47141,116,327 - 141,116,504RGDRGSC3.4
RGSC_v3.47141,116,328 - 141,116,504UniSTSRGSC3.4
RGSC_v3.17141,192,765 - 141,192,941RGD
Celera7129,925,775 - 129,925,951UniSTS
RH 3.4 Map71065.7UniSTS
RH 3.4 Map71065.7RGD
RH 2.0 Map7799.2RGD
Cytogenetic Map7q36UniSTS
Is Marker For: Strains:   BBDP/Rhw   BBDR/Rhw   BN/SsNHsd   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MNRA/N   WN/N   WTC/Kyo   MNR/N   MR/Pit   ODU/N   WF/Pit   P5C   PVG/Pit   SHR/OlaHsd   WAG/RijKyo   GK/KyoSwe   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   GH/Omr   SS/Jr   COP/OlaHsd  
QTLs:   Bp216   Bp215   Stl14  
Genes:   Sp7  


Annotation


#
Reference Title
Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. UniSTS Pipeline RGD automated pipelines
4. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
5. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8
6. Electronic Submission of SSLP Data Sets Wilder R. Oct.2000. National Institute of Arthritis and Musculoskeletal and Skin Diseases, ARB Rat Genetic Database


 
Forward Primer ACCTCAGGTCCCAGGAGTG
Reverse Primer AGGTAAGCCAGTGGATGCTT
 
Strain, Expected Size(s)

ACI/N 216 BBDP/Rhw 226 BBDR/Rhw 226
BN-Lx/Cub 214 BN/SsNHsd 214 BUF/Pit 228
COP/OlaHsd 216 DA/PitN 216 DON/Melb 216
F344/Pit 216 FHH/Eur 210 GH/Omr 216
GK/KyoSwe 224 IS/Kyo 216 LE/Mol 216
LEW/Pit 226 LH/Mav 216 LN/Mav 216
M520/N 216 MNR/N 226 MNRA/N 226
MR/Pit 226 ODU/N 226 P5C 228
PVG/Pit 216 SHR/OlaHsd 226 SS/Jr 216
WAG/RijKyo 224 WF/Pit 224 WN/N 216
WTC/Kyo 224


The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD ID
Symbol
Name
Chr
Start
Stop
Species
631377Sp7Sp7 transcription factor7133484609133494788Rat
GenBank Nucleotide CH474035 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000237 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


1 to 10 of 15 rows
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD ID
Symbol
Name
LOD
P Value
Trait
Sub Trait
Chr
Start
Stop
Species
1300179Kidm5Kidney mass QTL 53.51kidney mass (VT:0002707)left kidney wet weight (CMO:0000083)743747012135012528Rat
1354582Stl11Serum triglyceride level QTL 113.42blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)7119513385135012528Rat
731176Glom5Glomerulus QTL 52.50.0035kidney glomerulus morphology trait (VT:0005325)count of superficial glomeruli not directly contacting the kidney surface (CMO:0001002)796670164135012528Rat
1300112Bp183Blood pressure QTL 1833.51arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)7111182207135012528Rat
2306821Bp335Blood pressure QTL 3350.001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)7106571501135012528Rat
631663Bw6Body weight QTL 63.4body mass (VT:0001259)body weight (CMO:0000012)7111075573134976056Rat
1331731Bp216Blood pressure QTL 2162.851arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)7102297359133492884Rat
731174Uae23Urinary albumin excretion QTL 232.40.0042urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)7104603555135012528Rat
1357339Stl14Serum triglyceride level QTL 143.450.0001blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)7112729683133492707Rat
1331748Bp215Blood pressure QTL 2154.043arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)7112308254133492884Rat

1 to 10 of 15 rows


Note Type Note Reference
Database
Acc Id
Source(s)
NCBI Gene 300260 UniSTS
  544351 UniSTS
  544368 UniSTS
  544608 UniSTS