D3Mit13 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: D3Mit13

Symbol: D3Mit13
Previously known as: oxsts4956; MIT244; R244; 
RGD ID: 33668
Expected Size: 81 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
GRCr83136,091,483 - 136,091,564 (+)Marker Load Pipeline
mRatBN7.23115,638,231 - 115,638,314 (+)MAPPERmRatBN7.2
Rnor_6.03120,917,851 - 120,917,931NCBIRnor6.0
Rnor_5.03129,091,156 - 129,091,236UniSTSRnor5.0
RGSC_v3.43115,996,144 - 115,996,224UniSTSRGSC3.4
RGSC_v3.13115,901,518 - 115,901,851RGD
Celera3114,468,498 - 114,468,578UniSTS
RH 3.4 Map3986.9RGD
SHRSP x BN Map354.0299RGD
SHRSP x BN Map354.0299UniSTS
Cytogenetic Map3 RGD
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MNR/N   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   GK/KyoSwe   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd  
QTLs:   Tsu1  
Genes:   LOC100910286  


Annotation


#
Reference Title
Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. Rat Genetic Map Data Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
4. Electronic Transfer of SSLP Data Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
5. UniSTS Pipeline RGD automated pipelines
6. Electronic Submission of SSLP Data Sets Wilder R. Oct.2000. National Institute of Arthritis and Musculoskeletal and Skin Diseases, ARB Rat Genetic Database


 
Forward Primer TCCTCTTAGTAAAATTGCACGC
Reverse Primer TCAGCCCTTCTCCTGTCTA
 
Strain, Expected Size(s)

ACI/N 105 AVN/Orl 105 BBDP/Rhw 99
BBDR/Rhw 99 BC/CpbU 95 BDIX/Han 103
BDVII/Cub 105 BN-Lx/Cub 83 BN/SsNHsd 83
BP/Cub 105 BUF/Pit 99 COP/OlaHsd 105
DA/PitN 105 DON/Melb 105 F344/Pit 105
FHH/Eur 103 GH/Omr 105 GK/KyoSwe 83
IS/Kyo 99 LE/Mol 103 LEW/Pit 99
LH/Mav 103 LN/Mav 103 LOU/CHan 101
M520/N 107 MHS/Gib 99 MNR/N 105
MNRA/N 105 MNS/Gib 93 NEDH/K 83
NP9 105 ODU/N 105 OKA/Wsl 99
OM/Ztm 103 P5C 99 PVG/Pit 105
SD/Rij 83 SHR/OlaHsd 99 SHRSP/Riv 99
SR/Jr 113 SS/Jr 101 WAG/RijKyo 105
WF/Pit 97 WIST/Nhg 104 WKY/OlaHsd 105
WN/N 105 WTC/Kyo 105


GenBank Nucleotide CH473949 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000233 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


1 to 10 of 41 rows
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD ID
Symbol
Name
LOD
P Value
Trait
Sub Trait
Chr
Start
Stop
Species
2312673Scl63Serum cholesterol level QTL 630.001blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)398535255168026850Rat
2301414Kidm37Kidney mass QTL 370.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)370653097121056321Rat
1582238Bw68Body weight QTL 683.20.0064body mass (VT:0001259)body weight (CMO:0000012)353184593115665732Rat
2302373Gluco39Glucose level QTL 395.01blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)398535386161695835Rat
1582239Epfw1Epididymal fat weight QTL 14.50.0006epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)353184593115665732Rat
70216Cm14Cardiac mass QTL 142.1heart mass (VT:0007028)heart wet weight (CMO:0000069)331172320163586636Rat
2292591Esta4Estrogen-induced thymic atrophy QTL 4thymus mass (VT:0004954)thymus wet weight (CMO:0000855)347233211147415807Rat
1358362Srcrt2Stress Responsive Cort QTL 22.78blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)338192233133483320Rat
1582216Bw65Body weight QTL 656.3body mass (VT:0001259)body weight (CMO:0000012)3102200529115665732Rat
737818Hcar12Hepatocarcinoma resistance QTL 122.6liver integrity trait (VT:0010547)volume of individual liver tumorous lesion (CMO:0001078)329463235118376539Rat

1 to 10 of 41 rows


Note Type Note Reference
Database
Acc Id
Source(s)
NCBI Gene 100910286 UniSTS
  387438 UniSTS