Symbol:
Tph2
Name:
tryptophan hydroxylase 2
RGD ID:
631332
Description:
Predicted to enable tryptophan 5-monooxygenase activity. Involved in several processes, including cellular response to lithium ion; response to activity; and response to estrogen. Predicted to be active in neuron projection. Used to study sleep apnea. Biomarker of depressive disorder; panic disorder; and subacute delirium. Human ortholog(s) of this gene implicated in several diseases, including alcohol dependence; alcohol use disorder; anxiety disorder (multiple); autistic disorder; and drug dependence (multiple). Orthologous to human TPH2 (tryptophan hydroxylase 2); PARTICIPATES IN tryptophan metabolic pathway; INTERACTS WITH 17beta-estradiol; 2,3,7,8-tetrachlorodibenzodioxine; 2,3-bis(4-hydroxyphenyl)propionitrile.
Type:
protein-coding
RefSeq Status:
PROVISIONAL
Previously known as:
neuronal tryptophan hydroxylase; Ntph; tryptophan 5-hydroxylase 2; tryptophan 5-monooxygenase 2
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Species
Gene symbol and name
Data Source
Assertion derived from
less info ...
Orthologs 1
Homo sapiens (human):
TPH2 (tryptophan hydroxylase 2) HGNC
EggNOG, Ensembl, HomoloGene, Inparanoid, NCBI, OMA, OrthoDB, Panther, PhylomeDB, Treefam
Mus musculus (house mouse):
Tph2 (tryptophan hydroxylase 2) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chinchilla lanigera (long-tailed chinchilla):
Tph2 (tryptophan hydroxylase 2) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Pan paniscus (bonobo/pygmy chimpanzee):
TPH2 (tryptophan hydroxylase 2) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Canis lupus familiaris (dog):
TPH2 (tryptophan hydroxylase 2) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Ictidomys tridecemlineatus (thirteen-lined ground squirrel):
Tph2 (tryptophan hydroxylase 2) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Sus scrofa (pig):
TPH2 (tryptophan hydroxylase 2) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chlorocebus sabaeus (green monkey):
TPH2 (tryptophan hydroxylase 2) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Heterocephalus glaber (naked mole-rat):
Tph2 (tryptophan hydroxylase 2) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Alliance orthologs 3
Homo sapiens (human):
TPH2 (tryptophan hydroxylase 2)
Alliance
DIOPT (Ensembl Compara|HGNC|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Mus musculus (house mouse):
Tph2 (tryptophan hydroxylase 2)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Danio rerio (zebrafish):
tph2 (tryptophan hydroxylase 2 (tryptophan 5-monooxygenase))
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Caenorhabditis elegans (roundworm):
tph-1
Alliance
DIOPT (Ensembl Compara|Hieranoid|OMA|OrthoFinder|PANTHER|PhylomeDB)
Drosophila melanogaster (fruit fly):
Trhn
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Xenopus tropicalis (tropical clawed frog):
tph2
Alliance
DIOPT (Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Allele / Splice:
Tph2em2Mcwi
Tph2em3Mcwi
Genetic Models:
DA-Tph2em2Mcwi
DA-Tph2em3Mcwi
DA-Tph2em3Mcwi+/+
DA-Tph2em2Mcwi-/-
DA-Tph2em3Mcwi-/-
DA-Tph2em2Mcwi+/-
DA-Tph2em3Mcwi+/-
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 7 52,571,909 - 52,676,305 (-) NCBI GRCr8 mRatBN7.2 7 50,685,694 - 50,789,424 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 7 50,685,694 - 50,789,424 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 7 52,592,588 - 52,696,312 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 7 54,795,694 - 54,899,410 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 7 54,573,629 - 54,677,371 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 7 58,042,279 - 58,149,220 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 7 58,042,281 - 58,149,061 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 7 58,053,268 - 58,157,949 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 7 54,321,033 - 54,430,706 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 7 54,341,665 - 54,451,339 (-) NCBI Celera 7 47,478,282 - 47,582,240 (-) NCBI Celera Cytogenetic Map 7 q22 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Tph2 Rat (S)-nicotine multiple interactions ISO Tph2 (Mus musculus) 6480464 [Nicotine co-treated with 1-Methyl-4-phenyl-1 more ... CTD PMID:20230807 Tph2 Rat 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine multiple interactions ISO Tph2 (Mus musculus) 6480464 [Caffeine co-treated with 1-Methyl-4-phenyl-1 more ... CTD PMID:20230807 Tph2 Rat 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine increases expression ISO Tph2 (Mus musculus) 6480464 1-Methyl-4-phenyl-1 more ... CTD PMID:20230807 Tph2 Rat 17beta-estradiol multiple interactions EXP 6480464 [Estradiol co-treated with Fluoxetine] results in increased expression of TPH2 mRNA more ... CTD PMID:21382399 and PMID:30565903 Tph2 Rat 17beta-estradiol increases expression EXP 6480464 Estradiol results in increased expression of TPH2 mRNA CTD PMID:21382399 Tph2 Rat 2,3',4,4',5-Pentachlorobiphenyl increases expression ISO Tph2 (Mus musculus) 6480464 2 more ... CTD PMID:31388691 Tph2 Rat 2,3,7,8-tetrachlorodibenzodioxine decreases expression EXP 6480464 Tetrachlorodibenzodioxin results in decreased expression of TPH2 mRNA CTD PMID:32109520 Tph2 Rat 2,3-bis(4-hydroxyphenyl)propionitrile multiple interactions EXP 6480464 2 and 3-bis(4-hydroxyphenyl)-propionitrile inhibits the reaction [Estrogens deficiency results in decreased expression of TPH2 mRNA] CTD PMID:30565903 Tph2 Rat 4,4'-sulfonyldiphenol increases expression EXP 6480464 bisphenol S results in increased expression of TPH2 mRNA CTD PMID:26186136 Tph2 Rat 4,4'-sulfonyldiphenol increases expression ISO Tph2 (Mus musculus) 6480464 bisphenol S results in increased expression of TPH2 mRNA CTD PMID:30951980 Tph2 Rat 6-propyl-2-thiouracil decreases expression EXP 6480464 Propylthiouracil results in decreased expression of TPH2 mRNA CTD PMID:24780913 and PMID:25825206 Tph2 Rat 8-Br-cAMP increases expression ISO TPH2 (Homo sapiens) 6480464 8-Bromo Cyclic Adenosine Monophosphate results in increased expression of TPH2 mRNA CTD PMID:22079614 Tph2 Rat aflatoxin B1 decreases methylation ISO TPH2 (Homo sapiens) 6480464 Aflatoxin B1 results in decreased methylation of TPH2 gene CTD PMID:27153756 Tph2 Rat aldehydo-D-glucose multiple interactions ISO Tph2 (Mus musculus) 6480464 [lard co-treated with Cholesterol and Dietary co-treated with Dietary Sucrose co-treated with Fructose co-treated with Glucose] results in increased expression of TPH2 mRNA CTD PMID:37567420 Tph2 Rat amitrole decreases expression EXP 6480464 Amitrole results in decreased expression of TPH2 mRNA CTD PMID:38685447 Tph2 Rat ammonium chloride affects expression EXP 6480464 Ammonium Chloride affects the expression of TPH2 mRNA CTD PMID:16483693 Tph2 Rat astragaloside IV multiple interactions EXP 6480464 astragaloside A affects the reaction [bisphenol A affects the expression of TPH2 mRNA] CTD PMID:33666843 Tph2 Rat atrazine affects methylation EXP 6480464 Atrazine affects the methylation of TPH2 gene CTD PMID:35440735 Tph2 Rat benzo[a]pyrene decreases methylation ISO TPH2 (Homo sapiens) 6480464 Benzo(a)pyrene results in decreased methylation of TPH2 3' UTR CTD PMID:27901495 Tph2 Rat benzo[a]pyrene decreases expression ISO TPH2 (Homo sapiens) 6480464 Benzo(a)pyrene results in decreased expression of TPH2 mRNA CTD PMID:32234424 Tph2 Rat benzo[a]pyrene affects methylation ISO TPH2 (Homo sapiens) 6480464 Benzo(a)pyrene affects the methylation of TPH2 intron and Benzo(a)pyrene affects the methylation of TPH2 promoter CTD PMID:27901495 and PMID:30157460 Tph2 Rat benzo[e]pyrene increases methylation ISO TPH2 (Homo sapiens) 6480464 benzo(e)pyrene results in increased methylation of TPH2 intron CTD PMID:30157460 Tph2 Rat bis(2-ethylhexyl) phthalate decreases expression ISO Tph2 (Mus musculus) 6480464 Diethylhexyl Phthalate results in decreased expression of TPH2 mRNA CTD PMID:32303808 Tph2 Rat bis(2-ethylhexyl) phthalate multiple interactions ISO Tph2 (Mus musculus) 6480464 Diethylhexyl Phthalate promotes the reaction [[Streptozocin co-treated with Dietary Fats co-treated with Dietary Sugars] results in decreased expression of TPH2 mRNA] CTD PMID:32303808 Tph2 Rat bisphenol A increases expression EXP 6480464 bisphenol A results in increased expression of TPH2 mRNA and bisphenol A results in increased expression of TPH2 protein CTD PMID:24066056 Tph2 Rat bisphenol A decreases expression ISO Tph2 (Mus musculus) 6480464 bisphenol A results in decreased expression of TPH2 mRNA CTD PMID:34082316 Tph2 Rat bisphenol A affects expression EXP 6480464 bisphenol A affects the expression of TPH2 mRNA CTD PMID:33666843 Tph2 Rat bisphenol A multiple interactions EXP 6480464 astragaloside A affects the reaction [bisphenol A affects the expression of TPH2 mRNA] and Saponins affects the reaction [bisphenol A affects the expression of TPH2 mRNA] CTD PMID:33666843 Tph2 Rat bisphenol A increases expression ISO Tph2 (Mus musculus) 6480464 bisphenol A results in increased expression of TPH2 mRNA CTD PMID:23567477 and PMID:30951980 Tph2 Rat bisphenol A decreases expression EXP 6480464 bisphenol A results in decreased expression of TPH2 mRNA CTD PMID:25181051 more ... Tph2 Rat bisphenol F increases expression ISO Tph2 (Mus musculus) 6480464 bisphenol F results in increased expression of TPH2 mRNA CTD PMID:30951980 Tph2 Rat bisphenol F decreases expression ISO Tph2 (Mus musculus) 6480464 bisphenol F results in decreased expression of TPH2 protein CTD PMID:38266696 Tph2 Rat caffeine multiple interactions ISO Tph2 (Mus musculus) 6480464 [Caffeine co-treated with 1-Methyl-4-phenyl-1 more ... CTD PMID:20230807 Tph2 Rat CGP 52608 multiple interactions ISO TPH2 (Homo sapiens) 6480464 CGP 52608 promotes the reaction [RORA protein binds to TPH2 gene] CTD PMID:28238834 Tph2 Rat cyhalothrin decreases expression EXP 6480464 cyhalothrin results in decreased expression of TPH2 mRNA CTD PMID:36126889 Tph2 Rat D-glucose multiple interactions ISO Tph2 (Mus musculus) 6480464 [lard co-treated with Cholesterol and Dietary co-treated with Dietary Sucrose co-treated with Fructose co-treated with Glucose] results in increased expression of TPH2 mRNA CTD PMID:37567420 Tph2 Rat ethanol multiple interactions ISO Tph2 (Mus musculus) 6480464 Ethanol promotes the reaction [mephedrone results in decreased expression of TPH2 protein] CTD PMID:26747301 Tph2 Rat ethanol decreases expression ISO Tph2 (Mus musculus) 6480464 Ethanol results in decreased expression of TPH2 protein CTD PMID:26747301 Tph2 Rat fluoxetine increases expression EXP 6480464 Fluoxetine results in increased expression of TPH2 mRNA CTD PMID:11901216 Tph2 Rat fluoxetine decreases expression EXP 6480464 Fluoxetine results in decreased expression of TPH2 mRNA CTD PMID:16982082 and PMID:21740920 Tph2 Rat fluoxetine increases response to substance EXP 6480464 TPH2 results in increased susceptibility to Fluoxetine CTD PMID:17950541 Tph2 Rat fluoxetine affects expression ISO Tph2 (Mus musculus) 6480464 Fluoxetine affects the expression of TPH2 mRNA CTD PMID:17321503 Tph2 Rat fluoxetine affects expression EXP 6480464 Fluoxetine affects the expression of TPH2 mRNA CTD PMID:17950541 Tph2 Rat fluoxetine increases expression ISO Tph2 (Mus musculus) 6480464 Fluoxetine results in increased expression of TPH2 mRNA CTD PMID:20374287 Tph2 Rat fluoxetine affects response to substance ISO TPH2 (Homo sapiens) 6480464 TPH2 protein affects the susceptibility to Fluoxetine CTD PMID:16982082 Tph2 Rat fluoxetine multiple interactions EXP 6480464 [Estradiol co-treated with Fluoxetine] results in increased expression of TPH2 mRNA CTD PMID:21382399 Tph2 Rat folic acid increases expression ISO Tph2 (Mus musculus) 6480464 Folic Acid results in increased expression of TPH2 mRNA CTD PMID:25006883 Tph2 Rat fructose multiple interactions ISO Tph2 (Mus musculus) 6480464 [lard co-treated with Cholesterol and Dietary co-treated with Dietary Sucrose co-treated with Fructose co-treated with Glucose] results in increased expression of TPH2 mRNA CTD PMID:37567420 Tph2 Rat glucose multiple interactions ISO Tph2 (Mus musculus) 6480464 [lard co-treated with Cholesterol and Dietary co-treated with Dietary Sucrose co-treated with Fructose co-treated with Glucose] results in increased expression of TPH2 mRNA CTD PMID:37567420 Tph2 Rat lithium chloride decreases expression EXP 6480464 Lithium Chloride results in decreased expression of TPH2 mRNA and Lithium Chloride results in decreased expression of TPH2 protein CTD PMID:19840776 Tph2 Rat mephedrone multiple interactions ISO Tph2 (Mus musculus) 6480464 Ethanol promotes the reaction [mephedrone results in decreased expression of TPH2 protein] CTD PMID:26747301 Tph2 Rat mephedrone decreases expression EXP 6480464 mephedrone results in decreased expression of TPH2 protein CTD PMID:25817894 Tph2 Rat mephedrone decreases expression ISO Tph2 (Mus musculus) 6480464 mephedrone results in decreased expression of TPH2 protein CTD PMID:26747301 Tph2 Rat methamphetamine affects response to substance ISO Tph2 (Mus musculus) 6480464 TPH2 protein affects the susceptibility to Methamphetamine CTD PMID:20722968 Tph2 Rat methapyrilene increases methylation ISO TPH2 (Homo sapiens) 6480464 Methapyrilene results in increased methylation of TPH2 intron CTD PMID:30157460 Tph2 Rat methoxychlor affects methylation EXP 6480464 Methoxychlor affects the methylation of TPH2 gene CTD PMID:35440735 Tph2 Rat N,N-diethyl-m-toluamide multiple interactions EXP 6480464 [Permethrin co-treated with DEET] results in decreased methylation of TPH2 gene CTD PMID:33148267 Tph2 Rat N-[2-(4-bromocinnamylamino)ethyl]isoquinoline-5-sulfonamide multiple interactions EXP 6480464 N-(2-(4-bromocinnamylamino)ethyl)-5-isoquinolinesulfonamide inhibits the reaction [Sertraline results in increased expression of TPH2 mRNA] CTD PMID:11901216 Tph2 Rat N-Nitrosopyrrolidine decreases expression ISO TPH2 (Homo sapiens) 6480464 N-Nitrosopyrrolidine results in decreased expression of TPH2 mRNA CTD PMID:32234424 Tph2 Rat nicotine multiple interactions ISO Tph2 (Mus musculus) 6480464 [Nicotine co-treated with 1-Methyl-4-phenyl-1 more ... CTD PMID:20230807 Tph2 Rat O-methyleugenol decreases expression ISO TPH2 (Homo sapiens) 6480464 methyleugenol results in decreased expression of TPH2 mRNA CTD PMID:32234424 Tph2 Rat ochratoxin A increases expression EXP 6480464 ochratoxin A results in increased expression of TPH2 mRNA CTD PMID:27346841 Tph2 Rat perfluorohexanesulfonic acid multiple interactions ISO TPH2 (Homo sapiens) 6480464 [perfluorooctanoic acid co-treated with perfluorooctane sulfonic acid co-treated with perfluorohexanesulfonic acid] results in decreased expression of TPH2 mRNA CTD PMID:38603627 Tph2 Rat perfluorooctane-1-sulfonic acid multiple interactions ISO TPH2 (Homo sapiens) 6480464 [perfluorooctanoic acid co-treated with perfluorooctane sulfonic acid co-treated with perfluorohexanesulfonic acid] results in decreased expression of TPH2 mRNA CTD PMID:38603627 Tph2 Rat perfluorooctanoic acid multiple interactions ISO TPH2 (Homo sapiens) 6480464 [perfluorooctanoic acid co-treated with perfluorooctane sulfonic acid co-treated with perfluorohexanesulfonic acid] results in decreased expression of TPH2 mRNA CTD PMID:38603627 Tph2 Rat permethrin multiple interactions EXP 6480464 [Permethrin co-treated with DEET] results in decreased methylation of TPH2 gene CTD PMID:33148267 Tph2 Rat PhIP decreases expression EXP 6480464 2-amino-1-methyl-6-phenylimidazo(4 and 5-b)pyridine results in decreased expression of TPH2 mRNA CTD PMID:33945839 Tph2 Rat propamocarb decreases expression ISO Tph2 (Mus musculus) 6480464 propamocarb results in decreased expression of TPH2 mRNA CTD PMID:30251769 Tph2 Rat serotonin affects abundance ISO Tph2 (Mus musculus) 6480464 TPH2 protein affects the abundance of Serotonin CTD PMID:20722968 Tph2 Rat sertraline multiple interactions EXP 6480464 N-(2-(4-bromocinnamylamino)ethyl)-5-isoquinolinesulfonamide inhibits the reaction [Sertraline results in increased expression of TPH2 mRNA] CTD PMID:11901216 Tph2 Rat sertraline increases expression EXP 6480464 Sertraline results in increased expression of TPH2 mRNA and Sertraline results in increased expression of TPH2 protein CTD PMID:11901216 Tph2 Rat sertraline increases activity EXP 6480464 Sertraline results in increased activity of TPH2 protein CTD PMID:11901216 Tph2 Rat sodium arsenite decreases expression ISO Tph2 (Mus musculus) 6480464 sodium arsenite results in decreased expression of TPH2 mRNA CTD PMID:36209798 Tph2 Rat streptozocin multiple interactions ISO Tph2 (Mus musculus) 6480464 [Streptozocin co-treated with Dietary Fats co-treated with Dietary Sugars] results in decreased expression of TPH2 mRNA and Diethylhexyl Phthalate promotes the reaction [[Streptozocin co-treated with Dietary Fats co-treated with Dietary Sugars] results in decreased expression of TPH2 mRNA] CTD PMID:32303808 Tph2 Rat trichloroethene decreases expression EXP 6480464 Trichloroethylene results in decreased expression of TPH2 mRNA CTD PMID:33387578 Tph2 Rat triptonide increases expression ISO Tph2 (Mus musculus) 6480464 triptonide results in increased expression of TPH2 mRNA CTD PMID:33045310 Tph2 Rat valproic acid affects expression ISO TPH2 (Homo sapiens) 6480464 Valproic Acid affects the expression of TPH2 mRNA CTD PMID:34742744
Imported Annotations - KEGG (archival)
(S)-nicotine (ISO) 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (ISO) 17beta-estradiol (EXP) 2,3',4,4',5-Pentachlorobiphenyl (ISO) 2,3,7,8-tetrachlorodibenzodioxine (EXP) 2,3-bis(4-hydroxyphenyl)propionitrile (EXP) 4,4'-sulfonyldiphenol (EXP,ISO) 6-propyl-2-thiouracil (EXP) 8-Br-cAMP (ISO) aflatoxin B1 (ISO) aldehydo-D-glucose (ISO) amitrole (EXP) ammonium chloride (EXP) astragaloside IV (EXP) atrazine (EXP) benzo[a]pyrene (ISO) benzo[e]pyrene (ISO) bis(2-ethylhexyl) phthalate (ISO) bisphenol A (EXP,ISO) bisphenol F (ISO) caffeine (ISO) CGP 52608 (ISO) cyhalothrin (EXP) D-glucose (ISO) ethanol (ISO) fluoxetine (EXP,ISO) folic acid (ISO) fructose (ISO) glucose (ISO) lithium chloride (EXP) mephedrone (EXP,ISO) methamphetamine (ISO) methapyrilene (ISO) methoxychlor (EXP) N,N-diethyl-m-toluamide (EXP) N-[2-(4-bromocinnamylamino)ethyl]isoquinoline-5-sulfonamide (EXP) N-Nitrosopyrrolidine (ISO) nicotine (ISO) O-methyleugenol (ISO) ochratoxin A (EXP) perfluorohexanesulfonic acid (ISO) perfluorooctane-1-sulfonic acid (ISO) perfluorooctanoic acid (ISO) permethrin (EXP) PhIP (EXP) propamocarb (ISO) serotonin (ISO) sertraline (EXP) sodium arsenite (ISO) streptozocin (ISO) trichloroethene (EXP) triptonide (ISO) valproic acid (ISO)
1.
Ultrastructural characterization of tryptophan hydroxylase 2-specific cortical serotonergic fibers and dorsal raphe neuronal cell bodies after MDMA treatment in rat.
Adori C, etal., Psychopharmacology (Berl). 2011 Feb;213(2-3):377-91. doi: 10.1007/s00213-010-2041-2. Epub 2010 Oct 30.
2.
Alcoholics have more tryptophan hydroxylase 2 mRNA and protein in the dorsal and median raphe nuclei.
Bach H, etal., Alcohol Clin Exp Res. 2014 Jul;38(7):1894-901. doi: 10.1111/acer.12414. Epub 2014 Jun 18.
3.
Tryptophan hydroxylase 2 (TPH2) gene polymorphisms and psychiatric comorbidities in temporal lobe epilepsy.
Bragatti JA, etal., Epilepsy Behav. 2014 Mar;32:59-63. doi: 10.1016/j.yebeh.2014.01.007. Epub 2014 Feb 1.
4.
TPH2 Deficiency Influences Neuroplastic Mechanisms and Alters the Response to an Acute Stress in a Sex Specific Manner.
Brivio P, etal., Front Mol Neurosci. 2018 Oct 30;11:389. doi: 10.3389/fnmol.2018.00389. eCollection 2018.
5.
Precision therapeutic opioid dosing implications from genetic biomarkers and craving score.
Chang HW, etal., Medicine (Baltimore). 2020 May 29;99(22):e20429. doi: 10.1097/MD.0000000000020429.
6.
The effects of glucocorticoids on depressive and anxiety-like behaviors, mineralocorticoid receptor-dependent cell proliferation regulates anxiety-like behaviors.
Chen J, etal., Behav Brain Res. 2019 Apr 19;362:288-298. doi: 10.1016/j.bbr.2019.01.026. Epub 2019 Jan 14.
7.
Rifaximin ameliorates depression-like behaviour in chronic unpredictable mild stress rats by regulating intestinal microbiota and hippocampal tryptophan metabolism.
Cheng S, etal., J Affect Disord. 2023 May 15;329:30-41. doi: 10.1016/j.jad.2023.02.086. Epub 2023 Feb 24.
8.
The combination of ethanol with mephedrone increases the signs of neurotoxicity and impairs neurogenesis and learning in adolescent CD-1 mice.
Ciudad-Roberts A, etal., Toxicol Appl Pharmacol. 2016 Feb 15;293:10-20. doi: 10.1016/j.taap.2015.12.019. Epub 2015 Dec 30.
9.
Possible association between autism and variants in the brain-expressed tryptophan hydroxylase gene (TPH2).
Coon H, etal., Am J Med Genet B Neuropsychiatr Genet. 2005 May 5;135B(1):42-6.
10.
H3K9 Acetylation of Tph2 Involved in Depression-like Behavior in Male, but not Female, Juvenile Offspring Rat Induced by Prenatal Stress.
Dang S, etal., Neuroscience. 2018 Jun 15;381:138-148. doi: 10.1016/j.neuroscience.2018.03.043. Epub 2018 Apr 4.
11.
Increased central cholinergic drive contributes to the apneas of serotonin-deficient rat pups during active sleep.
Davis MR, etal., J Appl Physiol (1985). 2019 May 1;126(5):1175-1183. doi: 10.1152/japplphysiol.00909.2018. Epub 2019 Feb 14.
12.
Tryptophan hydroxylase 2 gene expression and promoter polymorphisms in bipolar disorder and schizophrenia.
De Luca V, etal., Psychopharmacology (Berl). 2005 Dec;183(3):378-82. Epub 2005 Oct 21.
13.
Elevated tph2 mRNA expression in a rat model of chronic anxiety.
Donner NC, etal., Depress Anxiety. 2012 Apr;29(4):307-19. doi: 10.1002/da.21925.
14.
Clinical and genetic risk factors for suicide under the influence of alcohol in a Polish sample.
Fudalej S, etal., Alcohol Alcohol. 2009 Sep-Oct;44(5):437-42. doi: 10.1093/alcalc/agp045.
15.
Tryptophan hydroxylase 2 gene and alcohol use among college students.
Gacek P, etal., Addict Biol. 2008 Sep;13(3-4):440-8. doi: 10.1111/j.1369-1600.2008.00118.x.
16.
Phylogenetic-based propagation of functional annotations within the Gene Ontology consortium.
Gaudet P, etal., Brief Bioinform. 2011 Sep;12(5):449-62. doi: 10.1093/bib/bbr042. Epub 2011 Aug 27.
17.
Lentiviral vector-driven inhibition of 5-HT synthesis in B3 bulbo-spinal serotonergic projections - Consequences on nociception, inflammatory and neuropathic pain in rats.
Gautier A, etal., Exp Neurol. 2017 Feb;288:11-24. doi: 10.1016/j.expneurol.2016.10.016. Epub 2016 Oct 29.
18.
Serotonin Transporter and Tryptophan Hydroxylase Gene Variations Mediate Working Memory Deficits of Cocaine Users.
Havranek MM, etal., Neuropsychopharmacology. 2015 Dec;40(13):2929-37. doi: 10.1038/npp.2015.146. Epub 2015 May 27.
19.
Estrogen selectively increases tryptophan hydroxylase-2 mRNA expression in distinct subregions of rat midbrain raphe nucleus: association between gene expression and anxiety behavior in the open field.
Hiroi R, etal., Biol Psychiatry. 2006 Aug 1;60(3):288-95. Epub 2006 Feb 3.
20.
Overexpression or knockdown of rat tryptophan hyroxylase-2 has opposing effects on anxiety behavior in an estrogen-dependent manner.
Hiroi R, etal., Neuroscience. 2011 Mar 10;176:120-31. doi: 10.1016/j.neuroscience.2010.12.019. Epub 2010 Dec 20.
21.
Endogenous Deficiency of Brain-Derived Neurotrophic Factor Induces the Downregulation of Tryptophan Hydroxylase-2 Expression in Raphe Nuclei of Rapid Ejaculator Rats.
Huang Y, etal., J Sex Med. 2021 Sep;18(9):1491-1499. doi: 10.1016/j.jsxm.2021.07.009. Epub 2021 Aug 9.
22.
Tryptophan hydroxylase 1 knockout and tryptophan hydroxylase 2 polymorphism: effects on hypoxic pulmonary hypertension in mice.
Izikki M, etal., Am J Physiol Lung Cell Mol Physiol. 2007 Oct;293(4):L1045-52. Epub 2007 Aug 3.
23.
Neurotransmitter Systems in a Mild Blast Traumatic Brain Injury Model: Catecholamines and Serotonin.
Kawa L, etal., J Neurotrauma. 2015 Aug 15;32(16):1190-9. doi: 10.1089/neu.2014.3669. Epub 2015 Apr 1.
24.
Respiratory dysfunction in two rodent models of chronic epilepsy and acute seizures and its link with the brainstem serotonin system.
Kouchi H, etal., Sci Rep. 2022 Jun 17;12(1):10248. doi: 10.1038/s41598-022-14153-6.
25.
Nice guys: Homozygocity for the TPH2 -703G/T (rs4570625) minor allele promotes low aggressiveness and low anxiety.
Laas K, etal., J Affect Disord. 2017 Jun;215:230-236. doi: 10.1016/j.jad.2017.03.045. Epub 2017 Mar 19.
26.
Glycyrrhizin treatment ameliorates post-traumatic stress disorder-like behaviours and restores circadian oscillation of intracranial serotonin.
Lai S, etal., Clin Exp Pharmacol Physiol. 2020 Jan;47(1):95-101. doi: 10.1111/1440-1681.13173. Epub 2019 Oct 7.
27.
Cell-type specific induction of tryptophan hydroxylase-2 transcription by calcium mobilization.
Lenicov FR, etal., J Neurochem. 2007 Dec;103(5):2047-57. Epub 2007 Sep 14.
28.
Diurnal rhythms of tryptophan hydroxylase 1 and 2 mRNA expression in the rat retina.
Liang J, etal., Neuroreport. 2004 Jun 28;15(9):1497-500.
29.
Opiate exposure and withdrawal dynamically regulate mRNA expression in the serotonergic dorsal raphe nucleus.
Lunden JW and Kirby LG, Neuroscience. 2013 Dec 19;254:160-72. doi: 10.1016/j.neuroscience.2013.08.071. Epub 2013 Sep 20.
30.
Sex- and age-based differences in the effect of central serotonin on arterial blood pressure regulation.
Magnusson JL, etal., J Appl Physiol (1985). 2020 Dec 1;129(6):1310-1323. doi: 10.1152/japplphysiol.00414.2020. Epub 2020 Sep 10.
31.
Photoperiod regulates the daily profiles of tryptophan hydroxylase-2 gene expression the raphe nuclei of rats.
Malek ZS and Labban LM, Int J Neurosci. 2021 Dec;131(12):1155-1161. doi: 10.1080/00207454.2020.1782903. Epub 2020 Jun 25.
32.
Daily rhythm of tryptophan hydroxylase-2 messenger ribonucleic acid within raphe neurons is induced by corticoid daily surge and modulated by enhanced locomotor activity.
Malek ZS, etal., Endocrinology. 2007 Nov;148(11):5165-72. Epub 2007 Jun 26.
33.
Association study of tryptophan hydroxylase 2 gene polymorphisms in panic disorder.
Maron E, etal., Neurosci Lett. 2007 Jan 16;411(3):180-4. Epub 2006 Nov 22.
34.
Omega-3 fatty acid deficiency during perinatal development increases serotonin turnover in the prefrontal cortex and decreases midbrain tryptophan hydroxylase-2 expression in adult female rats: dissociation from estrogenic effects.
McNamara RK, etal., J Psychiatr Res. 2009 Mar;43(6):656-63. Epub 2008 Nov 4.
35.
Rat ISS GO annotations from MGI mouse gene data--August 2006
MGD data from the GO Consortium
36.
Alcohol dependence and polymorphisms of serotonin-related genes: association studies.
Mokrović G, etal., Coll Antropol. 2008 Jan;32 Suppl 1:127-31.
37.
Macrophage migration inhibitory factor mediates the antidepressant actions of voluntary exercise.
Moon HY, etal., Proc Natl Acad Sci U S A. 2012 Aug 7;109(32):13094-9. doi: 10.1073/pnas.1205535109. Epub 2012 Jul 23.
38.
Mortality and ventilatory effects of central serotonin deficiency during postnatal development depend on age but not sex.
Mouradian GC, etal., Physiol Rep. 2021 Jul;9(13):e14946. doi: 10.14814/phy2.14946.
39.
TPH2 and TPH1: association of variants and interactions with heroin addiction.
Nielsen DA, etal., Behav Genet. 2008 Mar;38(2):133-50. doi: 10.1007/s10519-007-9187-7. Epub 2008 Jan 8.
40.
Modifying the role of serotonergic 5-HTTLPR and TPH2 variants on disulfiram treatment of cocaine addiction: a preliminary study.
Nielsen DA, etal., Genes Brain Behav. 2012 Nov;11(8):1001-8. doi: 10.1111/j.1601-183X.2012.00839.x. Epub 2012 Sep 27.
41.
OMIM Disease Annotation Pipeline
OMIM Disease Annotation Pipeline
42.
Enhanced aggressive phenotype of Tph2 knockout rats is associated with diminished 5-HT1A receptor sensitivity.
Peeters DGA, etal., Neuropharmacology. 2019 Jul 15;153:134-141. doi: 10.1016/j.neuropharm.2019.05.004. Epub 2019 May 9.
43.
KEGG Annotation Import Pipeline
Pipeline to import KEGG annotations from KEGG into RGD
44.
Genetic variability in tryptophan hydroxylase 2 gene in alcohol dependence and alcohol-related psychopathological symptoms.
Plemenitaš A, etal., Neurosci Lett. 2015 Sep 14;604:86-90. doi: 10.1016/j.neulet.2015.07.037. Epub 2015 Jul 29.
45.
On the interaction between BDNF and serotonin systems: The effects of long-term ethanol consumption in mice.
Popova NK, etal., Alcohol. 2020 Sep;87:1-15. doi: 10.1016/j.alcohol.2020.04.002. Epub 2020 Apr 21.
46.
Serotonergic Plasticity in the Dorsal Raphe Nucleus Characterizes Susceptibility and Resilience to Anhedonia.
Prakash N, etal., J Neurosci. 2020 Jan 15;40(3):569-584. doi: 10.1523/JNEUROSCI.1802-19.2019. Epub 2019 Dec 2.
47.
Family-based association study of TPH1 and TPH2 polymorphisms in autism.
Ramoz N, etal., Am J Med Genet B Neuropsychiatr Genet. 2006 Dec 5;141B(8):861-7.
48.
GOA pipeline
RGD automated data pipeline
49.
ClinVar Automated Import and Annotation Pipeline
RGD automated import pipeline for ClinVar variants, variant-to-disease annotations and gene-to-disease annotations
50.
Data Import for Chemical-Gene Interactions
RGD automated import pipeline for gene-chemical interactions
51.
Comprehensive gene review and curation
RGD comprehensive gene curation
52.
Lithium modulates tryptophan hydroxylase 2 gene expression and serotonin release in primary cultures of serotonergic raphe neurons.
Scheuch K, etal., Brain Res. 2010 Jan 11;1307:14-21. Epub 2009 Oct 17.
53.
TPH2 gene variants and anxiety during alcohol detoxification outcome.
Serretti A, etal., Psychiatry Res. 2009 May 15;167(1-2):106-14. doi: 10.1016/j.psychres.2007.12.006. Epub 2009 Apr 9.
54.
Serotonergic changes produced by repeated exposure to forced swimming: correlation with behavior.
Shishkina GT, etal., Ann N Y Acad Sci. 2008 Dec;1148:148-53.
55.
Genetic, Psychological, and Personal Network Factors Associated With Changes in Binge Drinking Over 2 Years Among Mexican Heritage Adolescents in the USA.
Song S, etal., Ann Behav Med. 2019 Feb 1;53(2):126-137. doi: 10.1093/abm/kay019.
56.
A serotonin-deficient rat model of neurogenic hypertension: influence of sex and sympathetic vascular tone.
Spinieli RL, etal., J Neurophysiol. 2022 Nov 1;128(5):1199-1206. doi: 10.1152/jn.00358.2022. Epub 2022 Sep 28.
57.
Identification and characterization of rostral ventromedial medulla neurons synaptically connected to the urinary bladder afferents in female rats with or without neonatal cystitis.
Talluri B, etal., J Comp Neurol. 2022 Jun;530(8):1129-1147. doi: 10.1002/cne.25260. Epub 2021 Nov 8.
58.
Adolescent intermittent ethanol reduces serotonin expression in the adult raphe nucleus and upregulates innate immune expression that is prevented by exercise.
Vetreno RP, etal., Brain Behav Immun. 2017 Feb;60:333-345. doi: 10.1016/j.bbi.2016.09.018. Epub 2016 Sep 16.
59.
Prenatal Hypoxia-Induced Adverse Reaction to Mild Stress is Associated with Depressive-Like Changes in the Glucocorticoid System of Rats.
Vetrovoy O, etal., Neurochem Res. 2023 May;48(5):1455-1467. doi: 10.1007/s11064-022-03837-0. Epub 2022 Dec 10.
60.
Synthesis of serotonin by a second tryptophan hydroxylase isoform.
Walther DJ, etal., Science 2003 Jan 3;299(5603):76.
61.
Effects of Paeonia lactiflora Extract on Estrogen Receptor β, TPH2, and SERT in Rats with PMS Anxiety.
Wang J, etal., Biomed Res Int. 2020 Mar 7;2020:4690504. doi: 10.1155/2020/4690504. eCollection 2020.
62.
Impacts of GRIN3A, GRM6 and TPH2 genetic polymorphisms on quality of life in methadone maintenance therapy population.
Wang RY, etal., PLoS One. 2018 Jul 30;13(7):e0201408. doi: 10.1371/journal.pone.0201408. eCollection 2018.
63.
Zuojin pill improves chronic unpredictable stress-induced depression-like behavior and gastrointestinal dysfunction in mice via the theTPH2/5-HT pathway.
Wang Y, etal., Phytomedicine. 2023 Nov;120:155067. doi: 10.1016/j.phymed.2023.155067. Epub 2023 Sep 3.
64.
Active sleep unmasks apnea and delayed arousal in infant rat pups lacking central serotonin.
Young JO, etal., J Appl Physiol (1985). 2017 Oct 1;123(4):825-834. doi: 10.1152/japplphysiol.00439.2017. Epub 2017 Aug 3.
65.
Investigating the molecular mechanisms of delirium-like neuropsychiatric disorder induced by electromagnetic pulse based on bioinformatics analysis.
Zhang XJ, etal., Mol Brain. 2023 Feb 7;16(1):21. doi: 10.1186/s13041-023-00998-z.
66.
The role of galanin system in modulating depression, anxiety, and addiction-like behaviors after chronic restraint stress.
Zhao X, etal., Neuroscience. 2013 Aug 29;246:82-93. doi: 10.1016/j.neuroscience.2013.04.046. Epub 2013 Apr 30.
67.
The upregulation of tryptophan hydroxylase-2 expression is important for premature ejaculation treatment with the selective serotonin reuptake inhibitor.
Zhu T, etal., Andrology. 2022 Mar;10(3):595-603. doi: 10.1111/andr.13135. Epub 2021 Dec 17.
68.
SNP- and haplotype analysis of the tryptophan hydroxylase 2 gene in alcohol-dependent patients and alcohol-related suicide.
Zill P, etal., Neuropsychopharmacology. 2007 Aug;32(8):1687-94. doi: 10.1038/sj.npp.1301318. Epub 2007 Jan 24.
69.
TPH2 polymorphisms and alcohol-related suicide.
Zupanc T, etal., Neurosci Lett. 2011 Feb 18;490(1):78-81. doi: 10.1016/j.neulet.2010.12.030. Epub 2010 Dec 21.
Tph2 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 7 52,571,909 - 52,676,305 (-) NCBI GRCr8 mRatBN7.2 7 50,685,694 - 50,789,424 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 7 50,685,694 - 50,789,424 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 7 52,592,588 - 52,696,312 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 7 54,795,694 - 54,899,410 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 7 54,573,629 - 54,677,371 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 7 58,042,279 - 58,149,220 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 7 58,042,281 - 58,149,061 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 7 58,053,268 - 58,157,949 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 7 54,321,033 - 54,430,706 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 7 54,341,665 - 54,451,339 (-) NCBI Celera 7 47,478,282 - 47,582,240 (-) NCBI Celera Cytogenetic Map 7 q22 NCBI
TPH2 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 12 71,938,845 - 72,032,440 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 12 71,938,845 - 72,186,618 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 12 72,332,625 - 72,426,220 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 12 70,618,893 - 70,712,488 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 12 70,618,892 - 70,712,488 NCBI Celera 12 71,995,911 - 72,089,543 (+) NCBI Celera Cytogenetic Map 12 q21.1 NCBI HuRef 12 69,382,235 - 69,474,238 (+) NCBI HuRef CHM1_1 12 72,299,779 - 72,391,813 (+) NCBI CHM1_1 T2T-CHM13v2.0 12 71,916,323 - 72,008,338 (+) NCBI T2T-CHM13v2.0
Tph2 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 10 114,914,546 - 115,020,927 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 10 114,914,546 - 115,020,927 (-) Ensembl GRCm39 Ensembl GRCm38 10 115,078,641 - 115,185,022 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 10 115,078,641 - 115,185,022 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 10 114,515,697 - 114,622,078 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 10 114,482,751 - 114,589,132 (-) NCBI MGSCv36 mm8 Celera 10 117,006,698 - 117,113,837 (-) NCBI Celera Cytogenetic Map 10 D2 NCBI cM Map 10 63.51 NCBI
Tph2 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955405 11,886,206 - 11,982,550 (+) Ensembl ChiLan1.0 ChiLan1.0 NW_004955405 11,877,474 - 11,981,035 (+) NCBI ChiLan1.0 ChiLan1.0
TPH2 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 10 79,966,411 - 80,062,791 (+) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 12 79,962,807 - 80,059,170 (+) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 12 69,460,883 - 69,557,329 (+) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 12 72,318,908 - 72,412,557 (+) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 12 72,318,908 - 72,412,557 (+) Ensembl panpan1.1 panPan2
TPH2 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 10 13,442,611 - 13,526,537 (+) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 10 13,442,611 - 13,527,243 (+) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 10 13,381,425 - 13,464,836 (+) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 10 13,578,664 - 13,662,404 (+) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 10 13,578,143 - 13,663,110 (+) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 10 13,440,095 - 13,523,686 (+) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 10 13,688,920 - 13,772,483 (+) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 10 13,812,858 - 13,896,308 (+) NCBI UU_Cfam_GSD_1.0
Tph2 Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024404945 44,662,510 - 44,753,680 (-) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936568 974,767 - 1,065,804 (+) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936568 974,575 - 1,065,800 (+) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
TPH2 Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 5 35,918,370 - 36,017,509 (+) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 5 35,917,159 - 36,016,981 (+) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 5 38,620,459 - 38,716,640 (+) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
TPH2
Tph2
.
Predicted Target Of
Count of predictions: 308 Count of miRNA genes: 199 Interacting mature miRNAs: 236 Transcripts: ENSRNOT00000005157 Prediction methods: Microtar, Miranda, Targetscan Result types: miRGate_prediction
7411569 Bw137 Body weight QTL 137 0.001 body mass (VT:0001259) body weight gain (CMO:0000420) 7 21921195 66921195 Rat 1300179 Kidm5 Kidney mass QTL 5 3.51 kidney mass (VT:0002707) left kidney wet weight (CMO:0000083) 7 43747012 135012528 Rat 2293667 Bss42 Bone structure and strength QTL 42 7.25 0.0001 lumbar vertebra size trait (VT:0010518) lumbar vertebra cross-sectional area (CMO:0001689) 7 47651439 92651439 Rat 10053722 Scort27 Serum corticosterone level QTL 27 2.41 0.0083 blood corticosterone amount (VT:0005345) plasma corticosterone level (CMO:0001173) 7 43228750 88228750 Rat 1578652 Bmd15 Bone mineral density QTL 15 5.2 femur mineral mass (VT:0010011) trabecular volumetric bone mineral density (CMO:0001729) 7 9866467 60460686 Rat 1641885 Alcrsp9 Alcohol response QTL 9 alcohol metabolism trait (VT:0015089) blood ethanol level (CMO:0000535) 7 24099606 69099606 Rat 1549840 Bss5 Bone structure and strength QTL 5 9.8 femur strength trait (VT:0010010) femur midshaft polar moment of inertia (CMO:0001669) 7 24751841 69751841 Rat 1300127 Srn1 Serum renin concentration QTL 1 3.87 blood renin amount (VT:0003349) plasma renin activity level (CMO:0000116) 7 29409683 84928080 Rat 10059605 Kidm47 Kidney mass QTL 47 2.91 0.05 kidney mass (VT:0002707) both kidneys wet weight to body weight ratio (CMO:0000340) 7 47251783 65728867 Rat 2293678 Bss24 Bone structure and strength QTL 24 6.71 0.0001 femur morphology trait (VT:0000559) femur cross-sectional area (CMO:0001661) 7 47651439 92651439 Rat 1358361 Sradr5 Stress Responsive Adrenal Weight QTL 5 5.55 adrenal gland mass (VT:0010420) both adrenal glands wet weight (CMO:0000164) 7 43747012 108555253 Rat 2298547 Neuinf5 Neuroinflammation QTL 5 3.7 nervous system integrity trait (VT:0010566) spinal cord Cd74 protein level (CMO:0002131) 7 9462246 58265113 Rat 631513 Scl7 Serum cholesterol level QTL 7 4.1 blood cholesterol amount (VT:0000180) serum total cholesterol level (CMO:0000363) 7 37960569 82960569 Rat 10059592 Kidm45 Kidney mass QTL 45 3.95 0.025 kidney mass (VT:0002707) both kidneys wet weight to body weight ratio (CMO:0000340) 7 7573985 52573985 Rat 10755440 Coatc10 Coat color QTL 10 0 coat/hair pigmentation trait (VT:0010463) pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812) 7 7496499 52496499 Rat 2293685 Bmd21 Bone mineral density QTL 21 4.2 0.0003 femur mineral mass (VT:0010011) total volumetric bone mineral density (CMO:0001728) 7 47651439 92651439 Rat 10755453 Coatc12 Coat color QTL 12 0 coat/hair pigmentation trait (VT:0010463) pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812) 7 31112832 76112832 Rat 631504 Cm27 Cardiac mass QTL 27 3.45 heart left ventricle mass (VT:0007031) heart left ventricle wet weight (CMO:0000071) 7 44421311 118198041 Rat 1354639 Spl5 Serum phospholipid level QTL 5 3.9 blood LDL phospholipid amount (VT:0010505) blood low density lipoprotein phospholipid level (CMO:0001568) 7 19654317 52888450 Rat 10755451 Coatc11 Coat color QTL 11 0 coat/hair pigmentation trait (VT:0010463) pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812) 7 17944357 62944357 Rat 634326 Hc3 Hypercalciuria QTL 3 2.1 urine calcium amount (VT:0002985) urine calcium excretion rate (CMO:0000763) 7 42787314 87787314 Rat 2317059 Aia15 Adjuvant induced arthritis QTL 15 2.46 joint integrity trait (VT:0010548) right rear ankle joint diameter (CMO:0002150) 7 17004598 62004598 Rat 2293696 Bmd32 Bone mineral density QTL 32 5.1 0.0001 femur strength trait (VT:0010010) femoral neck polar moment of inertia (CMO:0001670) 7 47651439 92651439 Rat 7411605 Foco14 Food consumption QTL 14 24.1 0.001 eating behavior trait (VT:0001431) feed conversion ratio (CMO:0001312) 7 34293282 79293282 Rat 1643004 Pain2 Pain QTL 2 1 mechanical nociception trait (VT:0002734) self mutilation severity score (CMO:0002145) 7 9462246 98011544 Rat 738030 Anxrr8 Anxiety related response QTL 8 4.1 exploratory behavior trait (VT:0010471) number of entries into a discrete space in an experimental apparatus (CMO:0000960) 7 46590070 91590070 Rat 1300149 Cm6 Cardiac mass QTL 6 4.09 heart mass (VT:0007028) heart left ventricle weight to body weight ratio (CMO:0000530) 7 43747099 102228765 Rat 631534 Lnnr1 Liver neoplastic nodule remodeling QTL 1 3.85 0.001 liver integrity trait (VT:0010547) liver remodeling tumorous lesion number to liver total tumorous lesion number ratio (CMO:0001705) 7 34293282 79293282 Rat 634336 Anxrr17 Anxiety related response QTL 17 3.66 locomotor behavior trait (VT:0001392) number of entries into a discrete space in an experimental apparatus (CMO:0000960) 7 924703 115097879 Rat 2293707 Bss32 Bone structure and strength QTL 32 7.64 0.0001 femur strength trait (VT:0010010) femur midshaft polar moment of inertia (CMO:0001669) 7 47651439 92651439 Rat 61357 Bp38 Blood pressure QTL 38 1.6 0.052 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 7 41333674 119109060 Rat 2303629 Vencon3 Ventilatory control QTL 3 7.25 respiration trait (VT:0001943) respiration rate (CMO:0000289) 7 41109692 56793354 Rat 2293644 Bmd29 Bone mineral density QTL 29 5.4 0.0001 femur size trait (VT:1000369) femoral neck cross-sectional area (CMO:0001697) 7 47651439 92651439 Rat 70190 Mcs6 Mammary carcinoma susceptibility QTL 6 2.29 mammary gland integrity trait (VT:0010552) mammary tumor number (CMO:0000343) 7 26737401 63902784 Rat 2300178 Bmd54 Bone mineral density QTL 54 5.3 0.0001 femur mineral mass (VT:0010011) volumetric bone mineral density (CMO:0001553) 7 47651439 92651439 Rat 61428 Scl3 Serum cholesterol level QTL 3 3.2 blood cholesterol amount (VT:0000180) serum total cholesterol level (CMO:0000363) 7 44867533 89867533 Rat 1300132 Bp182 Blood pressure QTL 182 3.49 arterial blood pressure trait (VT:2000000) blood pressure time series experimental set point of the baroreceptor response (CMO:0002593) 7 19654317 84928080 Rat 1300138 Hrtrt9 Heart rate QTL 9 4.72 heart pumping trait (VT:2000009) heart rate (CMO:0000002) 7 29409683 53612950 Rat 10402855 Bp379 Blood pressure QTL 379 0.21 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 7 29409683 74409683 Rat 738033 Anxrr6 Anxiety related response QTL 6 4.1 exploratory behavior trait (VT:0010471) percentage of entries into a discrete space in an experimental apparatus (CMO:0000961) 7 15573889 60573889 Rat
RH132298
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 7 50,685,695 - 50,685,852 (+) MAPPER mRatBN7.2 Rnor_6.0 7 58,042,283 - 58,042,439 NCBI Rnor6.0 Rnor_5.0 7 58,053,272 - 58,053,428 UniSTS Rnor5.0 RGSC_v3.4 7 54,321,035 - 54,321,191 UniSTS RGSC3.4 Celera 7 47,478,284 - 47,478,440 UniSTS RH 3.4 Map 7 442.0 UniSTS Cytogenetic Map 7 q22 UniSTS
BI279052
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 7 50,686,685 - 50,686,866 (+) MAPPER mRatBN7.2 Rnor_6.0 7 58,043,273 - 58,043,453 NCBI Rnor6.0 Rnor_5.0 7 58,054,262 - 58,054,442 UniSTS Rnor5.0 RGSC_v3.4 7 54,322,025 - 54,322,205 UniSTS RGSC3.4 Celera 7 47,479,274 - 47,479,454 UniSTS RH 3.4 Map 7 442.6 UniSTS Cytogenetic Map 7 q22 UniSTS
This gene Tph2 is modified in the following models/strains:
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
1
4
103
30
15
6
8
6
2
79
26
87
37
55
9
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000005157 ⟹ ENSRNOP00000005157
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 7 50,685,694 - 50,789,424 (-) Ensembl Rnor_6.0 Ensembl 7 58,042,281 - 58,149,061 (-) Ensembl
RefSeq Acc Id:
NM_173839 ⟹ NP_776211
RefSeq Status:
PROVISIONAL
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 7 52,571,911 - 52,675,639 (-) NCBI mRatBN7.2 7 50,685,694 - 50,789,424 (-) NCBI Rnor_6.0 7 58,042,281 - 58,149,061 (-) NCBI Rnor_5.0 7 58,053,268 - 58,157,949 (-) NCBI RGSC_v3.4 7 54,321,033 - 54,430,706 (-) RGD Celera 7 47,478,282 - 47,582,240 (-) RGD
Sequence:
CAGGGTTCTGGACAGCGCCTCGAGCAGCCAGCTGCCGCTCACCTTCCTCCTACATCTCTGCCAAGGCTGCCCCTCTGATCCCCCCTGCTGCTGAGAAAGAAAATTACATCGGGATCCATGCAGCCCGC
hide sequence
RefSeq Acc Id:
XM_063263689 ⟹ XP_063119759
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 7 52,571,909 - 52,676,305 (-) NCBI
RefSeq Acc Id:
NP_776211 ⟸ NM_173839
- UniProtKB:
Q8CGU9 (UniProtKB/Swiss-Prot), A6IGK2 (UniProtKB/TrEMBL)
- Sequence:
MQPAMMMFSSKYWARRGLSLDSAVPEEHQILGGLTQNKATASKSEDKRSGKDTSESSKTAVVFSLKNEVGGLVRALRLFQEKHVNMLHIESRRSRRRSSEVEIFVDCECGKTEFNELIQLLKFQTTIV
hide sequence
Ensembl Acc Id:
ENSRNOP00000005157 ⟸ ENSRNOT00000005157
RefSeq Acc Id:
XP_063119759 ⟸ XM_063263689
- Peptide Label:
isoform X1
- UniProtKB:
A0A8L2Q1S6 (UniProtKB/TrEMBL)
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2004-02-11
Tph2
tryptophan hydroxylase 2
Ntph
neuronal tryptophan hydroxylase
Symbol and Name updated to reflect Human and Mouse nomenclature
625702 APPROVED
Note Type
Note
Reference
gene_expression
expressed in brain
633509
