BE119243 Marker Search Result - Rat Genome Database

Advanced Search (OLGA)

General

Marker: BE119243

Symbol:

BE119243

Previously known as:

RGD ID:

5082357

Expected Size:

182 (bp)

Position

Rat Assembly	Chr	Position (strand)	Source	JBrowse
mRatBN7.2	5	103,893,165 - 103,893,330 (+)	MAPPER	mRatBN7.2
mRatBN7.2	10	59,686,265 - 59,686,447 (+)	MAPPER	mRatBN7.2
Rnor_6.0	10	61,671,922 - 61,672,103	NCBI	Rnor6.0
Rnor_6.0	5	107,731,219 - 107,731,383	NCBI	Rnor6.0
Rnor_5.0	10	61,393,658 - 61,393,839	UniSTS	Rnor5.0
Rnor_5.0	5	111,699,803 - 111,699,967	UniSTS	Rnor5.0
RGSC_v3.4	5	108,808,872 - 108,809,036	UniSTS	RGSC3.4
RGSC_v3.4	10	62,133,263 - 62,133,444	UniSTS	RGSC3.4
Celera	10	58,716,802 - 58,716,983	UniSTS
Celera	5	102,608,004 - 102,608,168	UniSTS
Cytogenetic Map	10	q24	UniSTS
Cytogenetic Map	5	q32	UniSTS

Is Marker For:

Genes: Mtap Mettl16 LOC100365303 LOC100362816

#	Reference Title	Reference Citation
1.	UniSTS Pipeline	RGD automated pipelines


Forward Primer	GCGTAGACTGACCTTACACCCA
Reverse Primer	AGCTTGCTTTGGAGGTAGAACC

The following Genes overlap with this region.

RGD ID	Symbol	Name	Chr	Start	Stop	Species
1310114	Mtap	methylthioadenosine phosphorylase	5	103874460	103920684	Rat
1593242	Mettl16	methyltransferase 16, RNA N6-adenosine	10	59640915	59697291	Rat


RefSeq Transcripts	XR_085570	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	CR937047	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
1357396	Bw44	Body weight QTL 44	4.19		body mass (VT:0001259)	body weight (CMO:0000012)	5	68984307	104251008	Rat
1331796	Thshl2	Thyroid stimulating hormone level QTL 2	2.3		blood thyroid-stimulating hormone amount (VT:0005119)	serum thyroid stimulating hormone level (CMO:0001248)	5	97059760	147465714	Rat
1549845	Scl44	Serum cholesterol level QTL 44	6		blood cholesterol amount (VT:0000180)	serum total cholesterol level (CMO:0000363)	5	40128307	148607290	Rat
61380	Edpm5	Estrogen-dependent pituitary mass QTL 5	4.5	0.92	pituitary gland mass (VT:0010496)	pituitary gland wet weight (CMO:0000853)	5	68984307	104251008	Rat
70212	Niddm25	Non-insulin dependent diabetes mellitus QTL 25	3.54		blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	5	1	131345958	Rat
1298070	Scl18	Serum cholesterol level QTL 18	3.7		blood LDL cholesterol amount (VT:0000181)	calculated plasma low density lipoprotein cholesterol level (CMO:0001245)	5	79584860	124584860	Rat
634305	Mamtr1	Mammary tumor resistance QTL 1		0.0001	mammary gland integrity trait (VT:0010552)	mammary tumor number (CMO:0000343)	5	12789751	113558310	Rat
61452	Ciaa5	CIA Autoantibody QTL 5	3.5		blood autoantibody amount (VT:0003725)	calculated serum anti-rat type 2 collagen autoantibody titer (CMO:0001281)	5	94858972	143070159	Rat
1331801	Rf33	Renal function QTL 33	4.149		kidney blood vessel physiology trait (VT:0100012)	absolute change in renal vascular resistance (CMO:0001900)	5	43726656	129132602	Rat
1357402	Bw46	Body weight QTL 46	4.47		body mass (VT:0001259)	body mass index (BMI) (CMO:0000105)	5	68984307	104251008	Rat
2302381	Bw84	Body weight QTL 84	4.47		body mass (VT:0001259)	body mass index (BMI) (CMO:0000105)	5	68984307	104251008	Rat
7411582	Foco3	Food consumption QTL 3	7.5	0.001	eating behavior trait (VT:0001431)	feed conversion ratio (CMO:0001312)	5	87468046	132468046	Rat
61393	Bp7	Blood pressure QTL 7	4.5	0.0001	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	5	60293434	161481680	Rat
1598859	Cm66	Cardiac mass QTL 66	2		heart mass (VT:0007028)	heart weight to body weight ratio (CMO:0000074)	5	79584860	124584860	Rat
1302790	Scl20	Serum cholesterol level QTL 20	6.4	0.0001	blood cholesterol amount (VT:0000180)	plasma total cholesterol level (CMO:0000585)	5	82394392	166664054	Rat
1578766	Tcas11	Tongue tumor susceptibility QTL 11	4.12		tongue integrity trait (VT:0010553)	number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)	5	46711509	161317411	Rat
2317753	Glom24	Glomerulus QTL 24	3.1		kidney glomerulus integrity trait (VT:0010546)	kidney sclerotic glomeruli count to total glomeruli count ratio (CMO:0001269)	5	97570330	136479578	Rat
1582212	Livw2	Liver weight QTL 2	3.5	0.0004	liver mass (VT:0003402)	liver weight to body weight ratio (CMO:0000633)	5	99016066	119085810	Rat
7411564	Bw135	Body weight QTL 135		0.001	body mass (VT:0001259)	body weight gain (CMO:0000420)	5	87468046	132468046	Rat
1576312	Emca8	Estrogen-induced mammary cancer QTL 8	4.1		mammary gland integrity trait (VT:0010552)	mammary tumor number (CMO:0000343)	5	50328551	141643988	Rat
7411601	Foco12	Food consumption QTL 12	19.7	0.001	eating behavior trait (VT:0001431)	feed conversion ratio (CMO:0001312)	5	87468046	132468046	Rat
1641912	Alcrsp18	Alcohol response QTL 18			response to alcohol trait (VT:0010489)	duration of loss of righting reflex (CMO:0002289)	5	35189153	141643988	Rat
1576314	Eutr1	Estrogen induced uterine response QTL 1			uterus integrity trait (VT:0010575)	pyometritis severity score (CMO:0002009)	5	2138965	166875058	Rat
7394708	Emca11	Estrogen-induced mammary cancer QTL 11			mammary gland integrity trait (VT:0010552)	mammary tumor number (CMO:0000343)	5	99753548	113061097	Rat
1576317	Eutr2	Estrogen induced uterine response QTL 2		0.01	uterus integrity trait (VT:0010575)	pyometritis severity score (CMO:0002009)	5	34730116	104251008	Rat
1598846	Bp293	Blood pressure QTL 293	3.9		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	5	79584860	124584860	Rat
1358909	Kidm25	Kidney mass QTL 25	1.87		kidney mass (VT:0002707)	both kidneys wet weight to body weight ratio (CMO:0000340)	5	90067849	128034027	Rat
1578673	Bmd13	Bone mineral density QTL 13	4.9		femur mineral mass (VT:0010011)	trabecular volumetric bone mineral density (CMO:0001729)	5	103689353	148689353	Rat
70189	Mcs5	Mammary carcinoma susceptibility QTL 5	10.51		mammary gland integrity trait (VT:0010552)	mammary tumor number (CMO:0000343)	5	55805606	132207589	Rat
631527	Tls1	T-lymphoma susceptibility QTL 1	0	0.001	thymus integrity trait (VT:0010555)	post-insult time to onset of T-cell lymphoma (CMO:0001907)	5	90450144	135450144	Rat
2290448	Scl54	Serum cholesterol level QTL 54	2.93		blood cholesterol amount (VT:0000180)	plasma total cholesterol level (CMO:0000585)	5	31663789	131345958	Rat
61426	Scl2	Serum cholesterol level QTL 2	7.3	0.001	blood cholesterol amount (VT:0000180)	serum total cholesterol level (CMO:0000363)	5	59793399	143070159	Rat
1354598	Srn6	Serum renin concentration QTL 6	3.8		blood renin amount (VT:0003349)	plasma renin activity level (CMO:0000116)	5	69540295	151018848	Rat
1298086	Bp156	Blood pressure QTL 156			arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	5	84132602	129132602	Rat
2290005	Mcs24	Mammary carcinoma susceptibility QTL 24			mammary gland integrity trait (VT:0010552)	mammary tumor number (CMO:0000343)	5	64719390	109719390	Rat
2306971	Anxrr21	Anxiety related response QTL 21	9.47		fear/anxiety-related behavior trait (VT:1000241)	number of entries into a discrete space in an experimental apparatus (CMO:0000960)	5	66174080	124160948	Rat
1358895	Bp254	Blood pressure QTL 254	3.6	0.0003	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	5	58829236	128034027	Rat
2316959	Gluco59	Glucose level QTL 59	4.7		blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	5	34944474	113558310	Rat
2312671	Scl64	Serum cholesterol level QTL 64		0.001	blood cholesterol amount (VT:0000180)	serum total cholesterol level (CMO:0000363)	5	68984307	104251008	Rat
6903316	Bw113	Body weight QTL 113	2	0.0103	body mass (VT:0001259)	body weight (CMO:0000012)	5	87765973	132765973	Rat
1358889	Bp261	Blood pressure QTL 261	2.86		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	5	90067849	128034027	Rat
2316957	Pur21	Proteinuria QTL 21	6.2		urine protein amount (VT:0005160)	urine protein level (CMO:0000591)	5	59793528	113558156	Rat
1358187	Emca1	Estrogen-induced mammary cancer QTL 1	4.4		mammary gland integrity trait (VT:0010552)	post-insult time to mammary tumor formation (CMO:0000345)	5	99216724	148607142	Rat
61441	Btemp1	Thermal response to stress QTL 1	4		body temperature trait (VT:0005535)	core body temperature (CMO:0001036)	10	35392457	63642539	Rat
1549846	Scl47	Serum cholesterol level QTL 47	3.6		blood cholesterol amount (VT:0000180)	serum total cholesterol level (CMO:0000363)	10	50574707	95574707	Rat
1549845	Scl44	Serum cholesterol level QTL 44	6		blood cholesterol amount (VT:0000180)	serum total cholesterol level (CMO:0000363)	5	40128307	148607290	Rat
1578779	Tcas10	Tongue tumor susceptibility QTL 10	3.12		tongue integrity trait (VT:0010553)	number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)	10	31297439	76297439	Rat
631564	Apr3	Acute phase response QTL 3	3.9		blood interleukin-6 amount (VT:0008595)	plasma interleukin-6 level (CMO:0001927)	10	15275955	60275955	Rat
631552	Vetf2	Vascular elastic tissue fragility QTL 2	4.5	0.0002	aorta elastic tissue integrity trait (VT:0010556)	artery internal elastic lamina non-tumorous lesion count (CMO:0001913)	10	41142633	86142633	Rat
631554	Bp133	Blood pressure QTL 133		0.005	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	10	743364	63851208	Rat
61452	Ciaa5	CIA Autoantibody QTL 5	3.5		blood autoantibody amount (VT:0003725)	calculated serum anti-rat type 2 collagen autoantibody titer (CMO:0001281)	5	94858972	143070159	Rat
631557	Bp136	Blood pressure QTL 136		0.003	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	10	30632053	75632053	Rat
7411582	Foco3	Food consumption QTL 3	7.5	0.001	eating behavior trait (VT:0001431)	feed conversion ratio (CMO:0001312)	5	87468046	132468046	Rat
1549831	Bss6	Bone structure and strength QTL 6	4		lumbar vertebra strength trait (VT:0010574)	vertebra ultimate force (CMO:0001678)	10	57576521	102576521	Rat
1302790	Scl20	Serum cholesterol level QTL 20	6.4	0.0001	blood cholesterol amount (VT:0000180)	plasma total cholesterol level (CMO:0000585)	5	82394392	166664054	Rat
70164	Bw21	Body weight QTL 21	4.36	0.00005	body mass (VT:0001259)	body weight (CMO:0000012)	10	53797494	98952626	Rat
1578766	Tcas11	Tongue tumor susceptibility QTL 11	4.12		tongue integrity trait (VT:0010553)	number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)	5	46711509	161317411	Rat
61463	Bp12	Blood pressure QTL 12	6.3	0.0001	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	10	41333258	86333258	Rat
8694173	Bw149	Body weight QTL 149	4.38	0.001	body mass (VT:0001259)	body weight gain (CMO:0000420)	10	44441699	89441699	Rat
2300218	Hpcl2	Hepatic cholesterol level QTL 2			liver cholesterol amount (VT:0010498)	liver cholesterol level (CMO:0001597)	10	45029650	95600334	Rat
70171	Cari1	Carrageenan-induced inflammation QTL 1	4.9	0.0005	hypodermis integrity trait (VT:0010550)	inflammatory exudate volume (CMO:0001429)	10	53797385	107211142	Rat
7411564	Bw135	Body weight QTL 135		0.001	body mass (VT:0001259)	body weight gain (CMO:0000420)	5	87468046	132468046	Rat
724527	Bp148	Blood pressure QTL 148		0.0001	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	10	28453136	73453136	Rat
1358897	Stresp6	Stress response QTL 6	4.17	0.022	blood norepinephrine amount (VT:0005663)	plasma norepinephrine level (CMO:0001010)	10	35392267	64155584	Rat
1331762	Rf40	Renal function QTL 40	3.873		kidney blood vessel physiology trait (VT:0100012)	absolute change in renal vascular resistance (CMO:0001900)	10	29299504	64155584	Rat
2300171	Bmd58	Bone mineral density QTL 58	4.9	0.0001	lumbar vertebra mineral mass (VT:0010511)	volumetric bone mineral density (CMO:0001553)	10	26944628	71944628	Rat
1358909	Kidm25	Kidney mass QTL 25	1.87		kidney mass (VT:0002707)	both kidneys wet weight to body weight ratio (CMO:0000340)	5	90067849	128034027	Rat
70189	Mcs5	Mammary carcinoma susceptibility QTL 5	10.51		mammary gland integrity trait (VT:0010552)	mammary tumor number (CMO:0000343)	5	55805606	132207589	Rat
2301967	Cm73	Cardiac mass QTL 73	4.55		heart left ventricle mass (VT:0007031)	heart left ventricle weight to body weight ratio (CMO:0000530)	10	14487011	89062041	Rat
70188	BpQTLcluster1	Blood pressure QTL cluster 1	4.864		arterial blood pressure trait (VT:2000000)	pulse pressure (CMO:0000292)	1	42323132	87323132	Rat
2290448	Scl54	Serum cholesterol level QTL 54	2.93		blood cholesterol amount (VT:0000180)	plasma total cholesterol level (CMO:0000585)	5	31663789	131345958	Rat
70198	BpQTLcluster9	Blood pressure QTL cluster 9	2.94		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	10	42323132	87323132	Rat
1358895	Bp254	Blood pressure QTL 254	3.6	0.0003	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	5	58829236	128034027	Rat
1358889	Bp261	Blood pressure QTL 261	2.86		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	5	90067849	128034027	Rat
1357396	Bw44	Body weight QTL 44	4.19		body mass (VT:0001259)	body weight (CMO:0000012)	5	68984307	104251008	Rat
1331796	Thshl2	Thyroid stimulating hormone level QTL 2	2.3		blood thyroid-stimulating hormone amount (VT:0005119)	serum thyroid stimulating hormone level (CMO:0001248)	5	97059760	147465714	Rat
6893352	Bw100	Body weight QTL 100	0.33	0.6	body mass (VT:0001259)	body weight (CMO:0000012)	1	15906665	60906665	Rat
70212	Niddm25	Non-insulin dependent diabetes mellitus QTL 25	3.54		blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	5	1	131345958	Rat
724556	Pur2	Proteinuria QTL 2	5.5		urine protein amount (VT:0005160)	urine protein level (CMO:0000591)	10	22427500	90627625	Rat
1331801	Rf33	Renal function QTL 33	4.149		kidney blood vessel physiology trait (VT:0100012)	absolute change in renal vascular resistance (CMO:0001900)	5	43726656	129132602	Rat
1357402	Bw46	Body weight QTL 46	4.47		body mass (VT:0001259)	body mass index (BMI) (CMO:0000105)	5	68984307	104251008	Rat
70223	Bp57	Blood pressure QTL 57	5		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	10	1	80676123	Rat
1354587	Kidm21	Kidney mass QTL 21	3.3		kidney mass (VT:0002707)	right kidney wet weight (CMO:0000082)	10	15028513	60430477	Rat
6893350	Bw99	Body weight QTL 99	0.87	0.16	body mass (VT:0001259)	body weight (CMO:0000012)	1	15906665	60906665	Rat
70224	Eae3	Experimental allergic encephalomyelitis QTL 3	4.1		nervous system integrity trait (VT:0010566)	experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046)	10	26521957	61345413	Rat
1331791	Cm31	Cardiac mass QTL 31	3.84606		heart mass (VT:0007028)	heart wet weight (CMO:0000069)	10	29299504	107211142	Rat
2313087	Bmd80	Bone mineral density QTL 80	3.2	0.0001	tibia mineral mass (VT:1000283)	total volumetric bone mineral density (CMO:0001728)	10	19606483	64606483	Rat
2298495	Eae23	Experimental allergic encephalomyelitis QTL 23	16.93		nervous system integrity trait (VT:0010566)	experimental autoimmune encephalomyelitis duration (CMO:0001424)	10	55273696	60677262	Rat
1576312	Emca8	Estrogen-induced mammary cancer QTL 8	4.1		mammary gland integrity trait (VT:0010552)	mammary tumor number (CMO:0000343)	5	50328551	141643988	Rat
1576314	Eutr1	Estrogen induced uterine response QTL 1			uterus integrity trait (VT:0010575)	pyometritis severity score (CMO:0002009)	5	2138965	166875058	Rat
1354608	Cm33	Cardiac mass QTL 33	2.8		heart left ventricle mass (VT:0007031)	heart left ventricle wet weight (CMO:0000071)	10	54809292	99809292	Rat
1576317	Eutr2	Estrogen induced uterine response QTL 2		0.01	uterus integrity trait (VT:0010575)	pyometritis severity score (CMO:0002009)	5	34730116	104251008	Rat
1598846	Bp293	Blood pressure QTL 293	3.9		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	5	79584860	124584860	Rat
1576319	Cia29	Collagen induced arthritis QTL 29			joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	10	33973921	78973921	Rat
1576308	Schws1	Schwannoma susceptibility QTL 1		0.0041	nervous system integrity trait (VT:0010566)	percentage of study population developing trigeminal nerve neurilemmomas during a period of time (CMO:0002017)	10	40035094	102359817	Rat
1576311	Pia26	Pristane induced arthritis QTL 26			joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	10	31224026	75632053	Rat
1354598	Srn6	Serum renin concentration QTL 6	3.8		blood renin amount (VT:0003349)	plasma renin activity level (CMO:0000116)	5	69540295	151018848	Rat
2290005	Mcs24	Mammary carcinoma susceptibility QTL 24			mammary gland integrity trait (VT:0010552)	mammary tumor number (CMO:0000343)	5	64719390	109719390	Rat
6893342	Cm78	Cardiac mass QTL 78	0.1	0.88	heart mass (VT:0007028)	heart weight to body weight ratio (CMO:0000074)	10	42876766	79813922	Rat
2313055	Bw96	Body weight QTL 96	3.6	0.0001	body mass (VT:0001259)	body weight (CMO:0000012)	10	19606483	64606483	Rat
6903316	Bw113	Body weight QTL 113	2	0.0103	body mass (VT:0001259)	body weight (CMO:0000012)	5	87765973	132765973	Rat
1358187	Emca1	Estrogen-induced mammary cancer QTL 1	4.4		mammary gland integrity trait (VT:0010552)	post-insult time to mammary tumor formation (CMO:0000345)	5	99216724	148607142	Rat
152025229	Scl83	Serum cholesterol level QTL 83	4.33		blood cholesterol amount (VT:0000180)		10	35710580	68663659	Rat
152025227	Bw195	Body weight QTL 195	5.73		body mass (VT:0001259)		10	46989699	68663659	Rat
1298070	Scl18	Serum cholesterol level QTL 18	3.7		blood LDL cholesterol amount (VT:0000181)	calculated plasma low density lipoprotein cholesterol level (CMO:0001245)	5	79584860	124584860	Rat
1298069	Bp168	Blood pressure QTL 168	5.5		blood pressure trait (VT:0000183)	systolic blood pressure (CMO:0000004)	10	26521957	98003205	Rat
2293669	Bmd33	Bone mineral density QTL 33	4.5	0.0001	femur strength trait (VT:0010010)	femoral neck polar moment of inertia (CMO:0001670)	10	49444551	81709989	Rat
152025224	Bw193	Body weight QTL 193	6.47		body mass (VT:0001259)		10	51663405	75085664	Rat
61325	Aia5	Adjuvant induced arthritis QTL 5		0.01	joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	10	23444813	104060283	Rat
1298078	Stresp5	Stress response QTL 5	2.99	0.00025	blood corticosterone amount (VT:0005345)	plasma corticosterone level (CMO:0001173)	10	42045676	104670812	Rat
2293679	Bmd30	Bone mineral density QTL 30	3.5	0.0001	femur mineral mass (VT:0010011)	total volumetric bone mineral density (CMO:0001728)	10	49444551	81709989	Rat
2302381	Bw84	Body weight QTL 84	4.47		body mass (VT:0001259)	body mass index (BMI) (CMO:0000105)	5	68984307	104251008	Rat
1598859	Cm66	Cardiac mass QTL 66	2		heart mass (VT:0007028)	heart weight to body weight ratio (CMO:0000074)	5	79584860	124584860	Rat
2298544	Neuinf9	Neuroinflammation QTL 9	4.6		nervous system integrity trait (VT:0010566)	spinal cord complement component 1, q subcomponent, B chain mRNA level (CMO:0002126)	10	5801990	62146030	Rat
2317753	Glom24	Glomerulus QTL 24	3.1		kidney glomerulus integrity trait (VT:0010546)	kidney sclerotic glomeruli count to total glomeruli count ratio (CMO:0001269)	5	97570330	136479578	Rat
1554317	Bmd4	Bone mineral density QTL 4	9.4	0.0001	lumbar vertebra mineral mass (VT:0010511)	volumetric bone mineral density (CMO:0001553)	10	19816042	99406971	Rat
1582212	Livw2	Liver weight QTL 2	3.5	0.0004	liver mass (VT:0003402)	liver weight to body weight ratio (CMO:0000633)	5	99016066	119085810	Rat
1598852	Anxrr19	Anxiety related response QTL 19	5.07		body movement coordination trait (VT:0005424)	number of rearing movements in an experimental apparatus (CMO:0001752)	10	18167841	63167841	Rat
1641912	Alcrsp18	Alcohol response QTL 18			response to alcohol trait (VT:0010489)	duration of loss of righting reflex (CMO:0002289)	5	35189153	141643988	Rat
1581497	Esta1	Estrogen-induced thymic atrophy QTL 1			thymus mass (VT:0004954)	thymus wet weight (CMO:0000855)	10	21329805	61345413	Rat
1578673	Bmd13	Bone mineral density QTL 13	4.9		femur mineral mass (VT:0010011)	trabecular volumetric bone mineral density (CMO:0001729)	5	103689353	148689353	Rat
61354	Pia10	Pristane induced arthritis QTL 10		0.01	joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	10	23444813	104060283	Rat
2303118	Mamtr7	Mammary tumor resistance QTL 7		0.003	mammary gland integrity trait (VT:0010552)	mammary tumor growth rate (CMO:0000344)	10	9658275	104670812	Rat
9589030	Epfw9	Epididymal fat weight QTL 9	19.24	0.001	epididymal fat pad mass (VT:0010421)	epididymal fat pad weight to body weight ratio (CMO:0000658)	10	44441699	89441699	Rat
1298086	Bp156	Blood pressure QTL 156			arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	5	84132602	129132602	Rat
10402859	Bp381	Blood pressure QTL 381		0.002	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	10	27606468	72606468	Rat
2316949	Gluco60	Glucose level QTL 60	3.7		blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	10	14487011	107057807	Rat
2293652	Bmd22	Bone mineral density QTL 22	4.9	0.0001	femur mineral mass (VT:0010011)	total volumetric bone mineral density (CMO:0001728)	10	49444551	81709989	Rat
2306971	Anxrr21	Anxiety related response QTL 21	9.47		fear/anxiety-related behavior trait (VT:1000241)	number of entries into a discrete space in an experimental apparatus (CMO:0000960)	5	66174080	124160948	Rat
2316959	Gluco59	Glucose level QTL 59	4.7		blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	5	34944474	113558310	Rat
1359017	Hrtrt21	Heart rate QTL 21	2.4		heart pumping trait (VT:2000009)	heart rate (CMO:0000002)	10	51772940	96772940	Rat
2316957	Pur21	Proteinuria QTL 21	6.2		urine protein amount (VT:0005160)	urine protein level (CMO:0000591)	5	59793528	113558156	Rat
2306787	Ean3	Experimental allergic neuritis QTL 3	3.1		nervous system integrity trait (VT:0010566)	body weight loss (CMO:0001399)	10	53797385	66979128	Rat
2312672	Insul15	Insulin level QTL 15		0.01	blood insulin amount (VT:0001560)	serum insulin level (CMO:0000358)	10	57134272	102134272	Rat
61380	Edpm5	Estrogen-dependent pituitary mass QTL 5	4.5	0.92	pituitary gland mass (VT:0010496)	pituitary gland wet weight (CMO:0000853)	5	68984307	104251008	Rat
634305	Mamtr1	Mammary tumor resistance QTL 1		0.0001	mammary gland integrity trait (VT:0010552)	mammary tumor number (CMO:0000343)	5	12789751	113558310	Rat
8662860	Vetf10	Vascular elastic tissue fragility QTL 10			artery integrity trait (VT:0010639)	number of ruptures of the internal elastic lamina of the abdominal aorta and iliac arteries (CMO:0002562)	10	6154182	73453136	Rat
61387	Bp1	Blood pressure QTL 1	5.1		arterial blood pressure trait (VT:2000000)	diastolic blood pressure (CMO:0000005)	10	51770177	107211142	Rat
2317043	Aia7	Adjuvant induced arthritis QTL 7	3.82		joint integrity trait (VT:0010548)	left rear ankle joint diameter (CMO:0002149)	10	37565079	82565079	Rat
61393	Bp7	Blood pressure QTL 7	4.5	0.0001	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	5	60293434	161481680	Rat
2317042	Aia20	Adjuvant induced arthritis QTL 20	3.38		joint integrity trait (VT:0010548)	right rear ankle joint diameter (CMO:0002150)	10	37565079	82565079	Rat
70364	Bp72	Blood pressure QTL 72			arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	10	51121100	96121100	Rat
7411601	Foco12	Food consumption QTL 12	19.7	0.001	eating behavior trait (VT:0001431)	feed conversion ratio (CMO:0001312)	5	87468046	132468046	Rat
2293698	Bss43	Bone structure and strength QTL 43	5.33	0.0001	lumbar vertebra size trait (VT:0010518)	lumbar vertebra cross-sectional area (CMO:0001689)	10	59209888	104209888	Rat
631530	Tls3	T-lymphoma susceptibility QTL 3	0	0.0001	thymus integrity trait (VT:0010555)	percentage of study population developing T-cell lymphomas during a period of time (CMO:0001911)	10	51774612	95600334	Rat
7394708	Emca11	Estrogen-induced mammary cancer QTL 11			mammary gland integrity trait (VT:0010552)	mammary tumor number (CMO:0000343)	5	99753548	113061097	Rat
631535	Cm51	Cardiac mass QTL 51	3		heart mass (VT:0007028)	calculated heart weight (CMO:0000073)	10	51786282	91669536	Rat
8552805	Bw145	Body weight QTL 145	2.2		body mass (VT:0001259)	change in body weight to body weight ratio (CMO:0002216)	10	41944526	78307017	Rat
631267	Cia20	Collagen induced arthritis QTL 20	3.2		joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	10	23444813	104060283	Rat
2293705	Bmd25	Bone mineral density QTL 25	7.1	0.0001	femur mineral mass (VT:0010011)	compact volumetric bone mineral density (CMO:0001730)	10	49444551	81709989	Rat
631269	Cia22	Collagen induced arthritis QTL 22	8.9		joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	10	40035094	104060283	Rat
631268	Cia21	Collagen induced arthritis QTL 21	3.1		joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	10	14487011	104060283	Rat
631527	Tls1	T-lymphoma susceptibility QTL 1	0	0.001	thymus integrity trait (VT:0010555)	post-insult time to onset of T-cell lymphoma (CMO:0001907)	5	90450144	135450144	Rat
7207811	Bmd90	Bone mineral density QTL 90	5.2		femur size trait (VT:1000369)	femoral neck cross-sectional area (CMO:0001697)	10	49444551	81709989	Rat
631270	Cia23	Collagen induced arthritis QTL 23	3.9		joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	10	40035094	104060283	Rat
7411614	Foco18	Food consumption QTL 18		0.001	eating behavior trait (VT:0001431)	feed conversion ratio (CMO:0001312)	10	44441699	89441699	Rat
61426	Scl2	Serum cholesterol level QTL 2	7.3	0.001	blood cholesterol amount (VT:0000180)	serum total cholesterol level (CMO:0000363)	5	59793399	143070159	Rat
631547	Bp87	Blood pressure QTL 87	4.5		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	10	47369470	92369470	Rat
61427	Cia16	Collagen induced arthritis QTL 16	3.2		joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	10	6357896	96121100	Rat
2312662	Slep8	Serum leptin concentration QTL 8		0.05	blood leptin amount (VT:0005667)	serum leptin level (CMO:0000780)	10	57134272	102134272	Rat
2292441	Bp308	Blood pressure QTL 308			arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	10	27606468	72606468	Rat
2312671	Scl64	Serum cholesterol level QTL 64		0.001	blood cholesterol amount (VT:0000180)	serum total cholesterol level (CMO:0000363)	5	68984307	104251008	Rat
631542	Bp82	Blood pressure QTL 82	6.8		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	10	26521957	98952741	Rat
2312668	Scl65	Serum cholesterol level QTL 65		0.001	blood cholesterol amount (VT:0000180)	serum total cholesterol level (CMO:0000363)	10	57134272	102134272	Rat

Database	Acc Id	Source(s)
NCBI Gene	100362816	UniSTS
	100365303	UniSTS
	298227	UniSTS
	360568	UniSTS

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailable


InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailable


Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
		Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable

Create Name:

Description:

Send us a Message

Marker: BE119243