D19Rat2 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: D19Rat2

Symbol: D19Rat2
Previously known as: oxsts6497; R011-C04; R0011-C04; 
RGD ID: 35028
Expected Size: 151 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21953,225,615 - 53,225,766 (+)MAPPERmRatBN7.2
Rnor_6.01958,071,993 - 58,072,143NCBIRnor6.0
Rnor_5.01968,774,888 - 68,775,038UniSTSRnor5.0
RGSC_v3.41955,455,212 - 55,455,363RGDRGSC3.4
RGSC_v3.41955,455,213 - 55,455,363UniSTSRGSC3.4
RGSC_v3.11955,460,094 - 55,460,244RGD
Celera1952,586,052 - 52,586,202UniSTS
RH 3.4 Map19576.0UniSTS
RH 3.4 Map19576.0RGD
RH 2.0 Map19607.0RGD
SHRSP x BN Map1943.8598RGD
Cytogenetic Map19 RGD
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   GK/KyoSwe   M520/N   BN-Lx/Cub   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd  
QTLs:   Anxrr26  


Annotation


#
Reference Title
Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. Rat Genetic Map Data Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
4. Electronic Transfer of SSLP Data Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
5. UniSTS Pipeline RGD automated pipelines
6. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
7. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8
8. Electronic Submission of SSLP Data Sets Wilder R. Oct.2000. National Institute of Arthritis and Musculoskeletal and Skin Diseases, ARB Rat Genetic Database


 
Forward Primer GCAGGAAACGTTTTCTCGAG
Reverse Primer AAGTGCACACTTTGGCCG
 
Template 
GCTGCAGGTCGATCTAGAGGATCCCCACCATCTATTAACGTATGACAACCGTGGAGCAGTTGAA
AATCACAGCCACTAATTAGGTCTCTGACTGGTCTCAAGATCCTCTGAGCTCCATTCGTCACTCT
GATATGCTGGCAAAAGAATGAGTCTCTCTCCCCTCGGTCATGATGAGGTCCCTCTCTCCTGAAG
GCAGGAAACGTTTTCTCGAGTTACCGAAAGGCTCCCCAAAGCAGGAGAAACACTGACAGAGACT
CAGTAAACGCTTTGCTTACACACACACACACACACACACACACACACACACACACACACACACA
CACACACAGTGGGGAGCCGGCCAAAGTGTGCACTTGGGTGGGTACCGAGCTCGAATTCGTAATC
ATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCCGCTTATAATTCCNCACNACATNNGAGC
CGGAAGCATATAGTNTAAAGTCTGTGGTGCCTAATGAGTGAGCTAACTCACATGTAATTGCGTT
GCGCTCACTGCCGCTTTCCAGTCGGGAAACTGTCGT
Strain, Expected Size(s)

AVN/Orl 156 BBDP/Rhw 166 BBDR/Rhw 160
BC/CpbU 166 BDIX/Han 154 BDVII/Cub 166
BN-Lx/Cub 154 BN/SsNHsd 154 BP/Cub 166
BUF/Pit 156 COP/OlaHsd 156 DA/PitN 156
DON/Melb 166 F344/Pit 166 FHH/Eur 156
GH/Omr 166 GK/KyoSwe 154 IS/Kyo 158
LE/Mol 166 LEW/Pit 156 LH/Mav 166
LOU/CHan 156 M520/N 166 MHS/Gib 166
MNR/N 156 MNRA/N 156 MNS/Gib 166
MR/Pit 156 NEDH/K 166 NP9 156
ODU/N 158 OKA/Wsl 166 OM/Ztm 156
P5C 156 PVG/Pit 166 SD/Rij 166
SHR/OlaHsd 158 SHRSP/Riv 164 SR/Jr 166
SS/Jr 166 WAG/RijKyo 156 WF/Pit 166
WIST/Nhg 156 WKY/OlaHsd 164 WN/N 156
WTC/Kyo 164


GenBank Nucleotide CH474054 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000249 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


1 to 10 of 10 rows
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD ID
Symbol
Name
LOD
P Value
Trait
Sub Trait
Chr
Start
Stop
Species
2313395Anxrr26Anxiety related response QTL 26aggression-related behavior trait (VT:0015014)tameness/aggressiveness composite score (CMO:0002136)194997648153225766Rat
1578764Stresp19Stress response QTL 193.60.001blood renin amount (VT:0003349)plasma renin activity level (CMO:0000116)191563020157337602Rat
61350Bp32Blood pressure QTL 320.012arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)192048357557337602Rat
5135224Leukc1Leukocyte quantity QTL 1eosinophil quantity (VT:0002602)blood eosinophil count (CMO:0000033)194434021455283277Rat
724546Kidm3Kidney mass QTL 33.1kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)192932249057337602Rat
7411549Bw130Body weight QTL 13050.001body mass (VT:0001259)body weight gain (CMO:0000420)191545586057337602Rat
1358200Insglur2Insulin/glucose ratio QTL 24.1blood glucose amount (VT:0000188)serum glucose level (CMO:0000543)193383821455283146Rat
724566Uae12Urinary albumin excretion QTL 125urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)19218792756457239Rat
1331737Uae29Urinary albumin excretion QTL 295.5urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)19409615555283277Rat
2298478Eau8Experimental allergic uveoretinitis QTL 80.0163uvea integrity trait (VT:0010551)experimental autoimmune uveitis score (CMO:0001504)191715443357337602Rat

1 to 10 of 10 rows


Note Type Note Reference
Database
Acc Id
Source(s)
NCBI Gene 100307062 UniSTS