D18Mgh10 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D18Mgh10

Symbol: D18Mgh10
Previously known as: oxsts8938; CDXIA; 
RGD ID: 34561
Expected Size: 136 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
GRCr81856,744,223 - 56,744,359 (+)Marker Load Pipeline
RH 3.4 Map18522.8RGD
RH 3.4 Map18522.8UniSTS
RH 2.0 Map18374.1RGD
Cytogenetic Map18q12.1UniSTS
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   GK/KyoSwe   M520/N   ACI/N   BN-Lx/Cub   GH/Omr   NEDH/K   SS/Jr  
Genes:   Cdx1  


Annotation


#
Reference Title
Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. UniSTS Pipeline RGD automated pipelines
4. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
5. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8
6. Electronic Submission of SSLP Data Sets Wilder R. Oct.2000. National Institute of Arthritis and Musculoskeletal and Skin Diseases, ARB Rat Genetic Database


 
Forward Primer AACAGACATATGTATGTGTGCGC
Reverse Primer CCCCATGTTCCTGTGACTG
 
Strain, Expected Size(s)

ACI/N 138 AVN/Orl 146 BBDP/Rhw 138
BBDR/Rhw 138 BC/CpbU 138 BDIX/Han 138
BDVII/Cub 142 BN-Lx/Cub 138 BN/SsNHsd 138
BP/Cub 146 BUF/Pit 142 DA/PitN 138
DON/Melb 144 F344/Pit 142 GH/Omr 144
GK/KyoSwe 148 IS/Kyo 142 LE/Mol 138
LEW/Pit 138 LH/Mav 138 LOU/CHan 148
M520/N 138 MHS/Gib 138 MNR/N 148
MNRA/N 146 MR/Pit 148 NEDH/K 138
NP9 138 ODU/N 138 OKA/Wsl 146
OM/Ztm 138 P5C 138 PVG/Pit 152
SD/Rij 146 SHR/OlaHsd 146 SHRSP/Riv 146
SR/Jr 138 SS/Jr 138 WAG/RijKyo 138
WF/Pit 138 WIST/Nhg 148 WN/N 138
WTC/Kyo 144


GenBank Nucleotide M91450 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles



Database
Acc Id
Source(s)
NCBI Gene 364883 UniSTS