D1Mit6 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D1Mit6

Symbol: D1Mit6
Also known as: R31; oxsts9015; 
RGD ID: 33571
Expected Size: 110 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Cytogenetic Map1 RGD
Is Marker For: Strains:   BBDP/Rhw   BBDR/Rhw   BN/SsNHsd   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MNRA/N   WN/N   WTC/Kyo   MNR/N   MR/Pit   ODU/N   WF/Pit   P5C   PVG/Pit   SHR/OlaHsd   WAG/RijKyo   GK/KyoSwe   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   GH/Omr   SS/Jr   COP/OlaHsd  
QTLs:   Rf1   Thym1   Thym3  
Genes:   Rf1  


Annotation



Strains and Sequence

Sequence
 
Forward Primer AGAGCAACTTCCAAACATATAGG
Reverse Primer TGTCAATTGACCCACAGGAA
 

Region

Nucleotide Sequences


Additional Information

RGD Curation Notes
Note Type Note Reference
Database Acc Id Source(s)
NCBI Gene 326364 UniSTS
  387465 UniSTS
  474366 UniSTS
UniSTS 239268 UniSTS