D1Mit6 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models   new Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources

Marker: D1Mit6

Symbol: D1Mit6
Previously known as: oxsts9015; R31; 
RGD ID: 33571
Expected Size: 110 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Cytogenetic Map1 RGD
Is Marker For: Strains:   BBDP/Rhw   BBDR/Rhw   BN/SsNHsd   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MNRA/N   WN/N   WTC/Kyo   MNR/N   MR/Pit   ODU/N   WF/Pit   P5C   PVG/Pit   SHR/OlaHsd   WAG/RijKyo   GK/KyoSwe   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   GH/Omr   SS/Jr   COP/OlaHsd  
QTLs:   Rf1   Thym1   Thym3  
Genes:   Rf1  


Annotation


References - curated
# Reference Title Reference Citation
1. Renal disease susceptibility and hypertension are under independent genetic control in the fawn-hooded rat. Brown DM, etal., Nat Genet 1996 Jan;12(1):44-51
2. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
3. A genetic linkage map of the laboratory rat, Rattus norvegicus. Jacob HJ, etal., Nat Genet 1995 Jan;9(1):63-9
4. UniSTS Pipeline RGD automated pipelines
5. Electronic Submission of SSLP Data Sets Wilder R. Oct.2000. National Institute of Arthritis and Musculoskeletal and Skin Diseases, ARB Rat Genetic Database

Strains and Sequence

Sequence
 
Forward Primer AGAGCAACTTCCAAACATATAGG
Reverse Primer TGTCAATTGACCCACAGGAA
 

Region

Nucleotide Sequences


Additional Information

RGD Curation Notes
Note Type Note Reference
Database Acc Id Source(s)
NCBI Gene 326364 UniSTS
  387465 UniSTS
  474366 UniSTS
UniSTS 239268 UniSTS