Symbol:
Dctn4
Name:
dynactin subunit 4
RGD ID:
71023
Description:
Located in cytoskeleton; focal adhesion; and kinetochore. Part of cytoplasmic dynein complex. Orthologous to human DCTN4 (dynactin subunit 4); PARTICIPATES IN mitochondria transport pathway; Huntington's disease pathway; vasopressin signaling pathway via receptor type 2; INTERACTS WITH 2,4-dinitrotoluene; 3,4-methylenedioxymethamphetamine; 6-propyl-2-thiouracil.
Type:
protein-coding
RefSeq Status:
VALIDATED
Previously known as:
dynactin 4; dynactin 4 (p62); dynactin subunit p62; MGC114292
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Species
Gene symbol and name
Data Source
Assertion derived from
less info ...
Orthologs 1
Homo sapiens (human):
DCTN4 (dynactin subunit 4) HGNC
EggNOG, Ensembl, HomoloGene, Inparanoid, NCBI, OMA, OrthoDB, OrthoMCL, Panther, PhylomeDB, Treefam
Mus musculus (house mouse):
Dctn4 (dynactin 4) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chinchilla lanigera (long-tailed chinchilla):
Dctn4 (dynactin subunit 4) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Pan paniscus (bonobo/pygmy chimpanzee):
DCTN4 (dynactin subunit 4) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Canis lupus familiaris (dog):
DCTN4 (dynactin subunit 4) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Ictidomys tridecemlineatus (thirteen-lined ground squirrel):
Dctn4 (dynactin subunit 4) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Sus scrofa (pig):
DCTN4 (dynactin subunit 4) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chlorocebus sabaeus (green monkey):
DCTN4 (dynactin subunit 4) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Heterocephalus glaber (naked mole-rat):
Dctn4 (dynactin subunit 4) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Alliance orthologs 3
Mus musculus (house mouse):
Dctn4 (dynactin 4)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Homo sapiens (human):
DCTN4 (dynactin subunit 4)
Alliance
DIOPT (Ensembl Compara|HGNC|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Danio rerio (zebrafish):
dctn4 (dynactin 4)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Drosophila melanogaster (fruit fly):
DCTN4-p62
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Caenorhabditis elegans (roundworm):
dnc-4
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Xenopus tropicalis (tropical clawed frog):
dctn4
Alliance
DIOPT (Ensembl Compara|OMA|OrthoFinder|PANTHER)
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 18 56,251,187 - 56,279,844 (+) NCBI GRCr8 mRatBN7.2 18 53,982,355 - 54,009,409 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 18 53,982,358 - 54,009,399 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 18 56,070,601 - 56,095,730 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 18 56,785,203 - 56,810,332 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 18 54,606,356 - 54,630,946 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 18 55,797,188 - 55,824,195 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 18 55,797,198 - 55,822,036 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 18 55,030,617 - 55,057,675 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 18 56,478,185 - 56,502,775 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 18 56,550,362 - 56,576,103 (+) NCBI Celera 18 52,136,101 - 52,160,691 (+) NCBI Celera Cytogenetic Map 18 q12.1 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Dctn4 Rat 1,2-dimethylhydrazine decreases expression ISO Dctn4 (Mus musculus) 6480464 1 and 2-Dimethylhydrazine results in decreased expression of DCTN4 mRNA CTD PMID:22206623 Dctn4 Rat 1,2-dimethylhydrazine multiple interactions ISO Dctn4 (Mus musculus) 6480464 Folic Acid inhibits the reaction [1 and 2-Dimethylhydrazine results in decreased expression of DCTN4 mRNA] CTD PMID:22206623 Dctn4 Rat 17alpha-ethynylestradiol multiple interactions ISO Dctn4 (Mus musculus) 6480464 [Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of DCTN4 mRNA CTD PMID:17942748 Dctn4 Rat 17beta-estradiol decreases expression ISO Dctn4 (Mus musculus) 6480464 Estradiol results in decreased expression of DCTN4 mRNA CTD PMID:39298647 Dctn4 Rat 2,3',4,4',5-Pentachlorobiphenyl increases expression ISO Dctn4 (Mus musculus) 6480464 2 more ... CTD PMID:31388691 Dctn4 Rat 2,3,7,8-tetrachlorodibenzodioxine multiple interactions ISO Dctn4 (Mus musculus) 6480464 [Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of DCTN4 mRNA and DCTN4 promotes the reaction [Tetrachlorodibenzodioxin results in increased activity of CYP1A1 protein] CTD PMID:17942748 and PMID:23997114 Dctn4 Rat 2,3,7,8-tetrachlorodibenzodioxine affects expression ISO Dctn4 (Mus musculus) 6480464 Tetrachlorodibenzodioxin affects the expression of DCTN4 mRNA CTD PMID:21570461 Dctn4 Rat 2,4-dinitrotoluene affects expression EXP 6480464 2 and 4-dinitrotoluene affects the expression of DCTN4 mRNA CTD PMID:21346803 Dctn4 Rat 3,4-methylenedioxymethamphetamine increases expression EXP 6480464 N-Methyl-3 and 4-methylenedioxyamphetamine results in increased expression of DCTN4 mRNA CTD PMID:30071829 Dctn4 Rat 4-hydroxyphenyl retinamide decreases expression ISO Dctn4 (Mus musculus) 6480464 Fenretinide results in decreased expression of DCTN4 mRNA CTD PMID:28973697 Dctn4 Rat 6-propyl-2-thiouracil decreases expression EXP 6480464 Propylthiouracil results in decreased expression of DCTN4 mRNA CTD PMID:30047161 Dctn4 Rat aflatoxin B1 decreases methylation ISO DCTN4 (Homo sapiens) 6480464 Aflatoxin B1 results in decreased methylation of DCTN4 intron CTD PMID:30157460 Dctn4 Rat ammonium chloride affects expression EXP 6480464 Ammonium Chloride affects the expression of DCTN4 mRNA CTD PMID:16483693 Dctn4 Rat aristolochic acid A increases expression ISO DCTN4 (Homo sapiens) 6480464 aristolochic acid I results in increased expression of DCTN4 protein CTD PMID:33212167 Dctn4 Rat benzo[a]pyrene affects methylation ISO DCTN4 (Homo sapiens) 6480464 Benzo(a)pyrene affects the methylation of DCTN4 intron CTD PMID:30157460 Dctn4 Rat benzo[e]pyrene decreases methylation ISO DCTN4 (Homo sapiens) 6480464 benzo(e)pyrene results in decreased methylation of DCTN4 intron CTD PMID:30157460 Dctn4 Rat bisphenol A decreases expression EXP 6480464 bisphenol A results in decreased expression of DCTN4 mRNA CTD PMID:25181051 Dctn4 Rat bisphenol A increases expression ISO DCTN4 (Homo sapiens) 6480464 bisphenol A results in increased expression of DCTN4 mRNA and bisphenol A results in increased expression of DCTN4 protein CTD PMID:33670352 and PMID:34186270 Dctn4 Rat bisphenol A increases expression EXP 6480464 bisphenol A results in increased expression of DCTN4 mRNA CTD PMID:34947998 Dctn4 Rat bisphenol A decreases expression ISO DCTN4 (Homo sapiens) 6480464 bisphenol A results in decreased expression of DCTN4 protein CTD PMID:33376534 Dctn4 Rat bisphenol A multiple interactions EXP 6480464 [bisphenol A co-treated with Genistein] results in decreased methylation of DCTN4 gene CTD PMID:28505145 Dctn4 Rat bisphenol AF increases expression ISO DCTN4 (Homo sapiens) 6480464 bisphenol AF results in increased expression of DCTN4 protein CTD PMID:34186270 Dctn4 Rat Bisphenol B increases expression ISO DCTN4 (Homo sapiens) 6480464 bisphenol B results in increased expression of DCTN4 protein CTD PMID:34186270 Dctn4 Rat bisphenol F increases expression ISO Dctn4 (Mus musculus) 6480464 bisphenol F results in increased expression of DCTN4 mRNA CTD PMID:38685157 Dctn4 Rat bisphenol F increases expression ISO DCTN4 (Homo sapiens) 6480464 bisphenol F results in increased expression of DCTN4 protein CTD PMID:34186270 Dctn4 Rat caffeine decreases phosphorylation ISO DCTN4 (Homo sapiens) 6480464 Caffeine results in decreased phosphorylation of DCTN4 protein CTD PMID:35688186 Dctn4 Rat calcidiol decreases expression EXP 6480464 Calcifediol deficiency results in decreased expression of DCTN4 mRNA CTD PMID:17293106 Dctn4 Rat CGP 52608 multiple interactions ISO DCTN4 (Homo sapiens) 6480464 CGP 52608 promotes the reaction [RORA protein binds to DCTN4 gene] CTD PMID:28238834 Dctn4 Rat cobalt dichloride increases expression ISO DCTN4 (Homo sapiens) 6480464 cobaltous chloride results in increased expression of DCTN4 mRNA CTD PMID:19320972 and PMID:19376846 Dctn4 Rat copper(II) sulfate increases expression ISO DCTN4 (Homo sapiens) 6480464 Copper Sulfate results in increased expression of DCTN4 mRNA CTD PMID:19549813 Dctn4 Rat cyclosporin A increases expression ISO DCTN4 (Homo sapiens) 6480464 Cyclosporine results in increased expression of DCTN4 mRNA CTD PMID:25562108 Dctn4 Rat decabromodiphenyl ether increases expression ISO DCTN4 (Homo sapiens) 6480464 decabromobiphenyl ether results in increased expression of DCTN4 protein CTD PMID:31675489 Dctn4 Rat Dibutyl phosphate affects expression ISO DCTN4 (Homo sapiens) 6480464 di-n-butylphosphoric acid affects the expression of DCTN4 mRNA CTD PMID:37042841 Dctn4 Rat doxorubicin decreases expression ISO DCTN4 (Homo sapiens) 6480464 Doxorubicin results in decreased expression of DCTN4 mRNA CTD PMID:29803840 Dctn4 Rat enzyme inhibitor multiple interactions ISO DCTN4 (Homo sapiens) 6480464 [Enzyme Inhibitors results in decreased activity of OGA protein] which results in increased O-linked glycosylation of DCTN4 protein CTD PMID:23301498 Dctn4 Rat ethanol affects splicing ISO Dctn4 (Mus musculus) 6480464 Ethanol affects the splicing of DCTN4 mRNA CTD PMID:30319688 Dctn4 Rat flutamide increases expression EXP 6480464 Flutamide results in increased expression of DCTN4 mRNA CTD PMID:24793618 Dctn4 Rat folic acid multiple interactions ISO Dctn4 (Mus musculus) 6480464 Folic Acid inhibits the reaction [1 and 2-Dimethylhydrazine results in decreased expression of DCTN4 mRNA] CTD PMID:22206623 Dctn4 Rat genistein multiple interactions EXP 6480464 [bisphenol A co-treated with Genistein] results in decreased methylation of DCTN4 gene CTD PMID:28505145 Dctn4 Rat genistein increases expression ISO Dctn4 (Mus musculus) 6480464 Genistein results in increased expression of DCTN4 mRNA CTD PMID:32186404 Dctn4 Rat ivermectin decreases expression ISO DCTN4 (Homo sapiens) 6480464 Ivermectin results in decreased expression of DCTN4 protein CTD PMID:32959892 Dctn4 Rat methapyrilene decreases methylation ISO DCTN4 (Homo sapiens) 6480464 Methapyrilene results in decreased methylation of DCTN4 intron CTD PMID:30157460 Dctn4 Rat methimazole decreases expression EXP 6480464 Methimazole results in decreased expression of DCTN4 mRNA CTD PMID:30047161 Dctn4 Rat methyl methanesulfonate increases expression ISO DCTN4 (Homo sapiens) 6480464 Methyl Methanesulfonate results in increased expression of DCTN4 mRNA CTD PMID:23649840 Dctn4 Rat nitrates multiple interactions ISO Dctn4 (Mus musculus) 6480464 [Particulate Matter results in increased abundance of Nitrates] which results in increased expression of DCTN4 mRNA CTD PMID:35964746 Dctn4 Rat pentachlorophenol decreases expression ISO Dctn4 (Mus musculus) 6480464 Pentachlorophenol results in decreased expression of DCTN4 mRNA CTD PMID:23892564 Dctn4 Rat perfluorooctane-1-sulfonic acid multiple interactions ISO Dctn4 (Mus musculus) 6480464 [perfluorooctane sulfonic acid co-treated with Pectins] results in increased expression of DCTN4 mRNA CTD PMID:36331819 Dctn4 Rat pirinixic acid increases expression ISO Dctn4 (Mus musculus) 6480464 pirinixic acid results in increased expression of DCTN4 mRNA CTD PMID:18301758 Dctn4 Rat resveratrol multiple interactions ISO DCTN4 (Homo sapiens) 6480464 [Plant Extracts co-treated with Resveratrol] results in increased expression of DCTN4 mRNA CTD PMID:23557933 Dctn4 Rat SB 431542 multiple interactions ISO DCTN4 (Homo sapiens) 6480464 [LDN 193189 co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide co-treated with FGF2 protein] results in increased expression of DCTN4 protein CTD PMID:37664457 Dctn4 Rat sodium arsenate increases expression ISO Dctn4 (Mus musculus) 6480464 sodium arsenate results in increased expression of DCTN4 mRNA CTD PMID:21795629 Dctn4 Rat sodium arsenite decreases expression ISO DCTN4 (Homo sapiens) 6480464 sodium arsenite results in decreased expression of DCTN4 mRNA CTD PMID:28595984 Dctn4 Rat sodium arsenite increases expression ISO DCTN4 (Homo sapiens) 6480464 sodium arsenite results in increased expression of DCTN4 mRNA CTD PMID:38568856 Dctn4 Rat Soman increases expression EXP 6480464 Soman results in increased expression of DCTN4 mRNA CTD PMID:19281266 Dctn4 Rat sulfadimethoxine decreases expression EXP 6480464 Sulfadimethoxine results in decreased expression of DCTN4 mRNA CTD PMID:30047161 Dctn4 Rat thioacetamide increases expression EXP 6480464 Thioacetamide results in increased expression of DCTN4 mRNA CTD PMID:34492290 Dctn4 Rat thiram increases expression ISO DCTN4 (Homo sapiens) 6480464 Thiram results in increased expression of DCTN4 mRNA CTD PMID:38568856 Dctn4 Rat titanium dioxide decreases methylation ISO Dctn4 (Mus musculus) 6480464 titanium dioxide results in decreased methylation of DCTN4 gene CTD PMID:35295148 Dctn4 Rat valproic acid decreases expression ISO DCTN4 (Homo sapiens) 6480464 Valproic Acid results in decreased expression of DCTN4 mRNA CTD PMID:23179753 Dctn4 Rat valproic acid affects expression ISO DCTN4 (Homo sapiens) 6480464 Valproic Acid affects the expression of DCTN4 mRNA CTD PMID:25979313
Imported Annotations - KEGG (archival)
1,2-dimethylhydrazine (ISO) 17alpha-ethynylestradiol (ISO) 17beta-estradiol (ISO) 2,3',4,4',5-Pentachlorobiphenyl (ISO) 2,3,7,8-tetrachlorodibenzodioxine (ISO) 2,4-dinitrotoluene (EXP) 3,4-methylenedioxymethamphetamine (EXP) 4-hydroxyphenyl retinamide (ISO) 6-propyl-2-thiouracil (EXP) aflatoxin B1 (ISO) ammonium chloride (EXP) aristolochic acid A (ISO) benzo[a]pyrene (ISO) benzo[e]pyrene (ISO) bisphenol A (EXP,ISO) bisphenol AF (ISO) Bisphenol B (ISO) bisphenol F (ISO) caffeine (ISO) calcidiol (EXP) CGP 52608 (ISO) cobalt dichloride (ISO) copper(II) sulfate (ISO) cyclosporin A (ISO) decabromodiphenyl ether (ISO) Dibutyl phosphate (ISO) doxorubicin (ISO) enzyme inhibitor (ISO) ethanol (ISO) flutamide (EXP) folic acid (ISO) genistein (EXP,ISO) ivermectin (ISO) methapyrilene (ISO) methimazole (EXP) methyl methanesulfonate (ISO) nitrates (ISO) pentachlorophenol (ISO) perfluorooctane-1-sulfonic acid (ISO) pirinixic acid (ISO) resveratrol (ISO) SB 431542 (ISO) sodium arsenate (ISO) sodium arsenite (ISO) Soman (EXP) sulfadimethoxine (EXP) thioacetamide (EXP) thiram (ISO) titanium dioxide (ISO) valproic acid (ISO)
1.
Analysis of dynactin subcomplexes reveals a novel actin-related protein associated with the arp1 minifilament pointed end.
Eckley DM, etal., J Cell Biol 1999 Oct 18;147(2):307-20.
2.
Interaction of the p62 subunit of dynactin with Arp1 and the cortical actin cytoskeleton.
Garces JA, etal., Curr Biol 1999 Dec 16-30;9(24):1497-500.
3.
Phylogenetic-based propagation of functional annotations within the Gene Ontology consortium.
Gaudet P, etal., Brief Bioinform. 2011 Sep;12(5):449-62. doi: 10.1093/bib/bbr042. Epub 2011 Aug 27.
4.
Gene Data Set
MGD Curation, June 12, 2002
5.
Electronic Transfer of LocusLink and RefSeq Data
NCBI rat LocusLink and RefSeq merged data July 26, 2002
6.
KEGG Annotation Import Pipeline
Pipeline to import KEGG annotations from KEGG into RGD
7.
Data Import for Chemical-Gene Interactions
RGD automated import pipeline for gene-chemical interactions
8.
Comprehensive gene review and curation
RGD comprehensive gene curation
9.
Dynactin.
Schroer TA, Annu Rev Cell Dev Biol. 2004;20:759-79.
Dctn4 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 18 56,251,187 - 56,279,844 (+) NCBI GRCr8 mRatBN7.2 18 53,982,355 - 54,009,409 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 18 53,982,358 - 54,009,399 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 18 56,070,601 - 56,095,730 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 18 56,785,203 - 56,810,332 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 18 54,606,356 - 54,630,946 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 18 55,797,188 - 55,824,195 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 18 55,797,198 - 55,822,036 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 18 55,030,617 - 55,057,675 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 18 56,478,185 - 56,502,775 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 18 56,550,362 - 56,576,103 (+) NCBI Celera 18 52,136,101 - 52,160,691 (+) NCBI Celera Cytogenetic Map 18 q12.1 NCBI
DCTN4 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 5 150,708,440 - 150,759,017 (-) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 5 150,706,840 - 150,759,095 (-) Ensembl GRCh38 hg38 GRCh38 GRCh37 5 150,088,002 - 150,138,579 (-) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 5 150,068,502 - 150,118,769 (-) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 5 150,068,502 - 150,118,769 NCBI Celera 5 146,169,659 - 146,220,011 (-) NCBI Celera Cytogenetic Map 5 q33.1 NCBI HuRef 5 145,234,095 - 145,284,314 (-) NCBI HuRef CHM1_1 5 149,521,113 - 149,571,477 (-) NCBI CHM1_1 T2T-CHM13v2.0 5 151,244,948 - 151,295,528 (-) NCBI T2T-CHM13v2.0
Dctn4 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 18 60,659,226 - 60,691,838 (+) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 18 60,659,257 - 60,691,838 (+) Ensembl GRCm39 Ensembl GRCm38 18 60,526,154 - 60,558,766 (+) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 18 60,526,185 - 60,558,766 (+) Ensembl GRCm38 mm10 GRCm38 MGSCv37 18 60,685,875 - 60,718,416 (+) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 18 60,651,590 - 60,684,131 (+) NCBI MGSCv36 mm8 Celera 18 61,811,724 - 61,843,194 (+) NCBI Celera Cytogenetic Map 18 D3 NCBI cM Map 18 34.36 NCBI
Dctn4 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955415 3,850,086 - 3,886,953 (+) Ensembl ChiLan1.0 ChiLan1.0 NW_004955415 3,850,475 - 3,886,953 (+) NCBI ChiLan1.0 ChiLan1.0
DCTN4 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 4 145,938,960 - 145,992,459 (-) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 5 144,078,506 - 144,128,568 (-) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 5 146,134,587 - 146,184,639 (-) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 5 152,138,052 - 152,187,140 (-) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 5 152,138,052 - 152,187,140 (-) Ensembl panpan1.1 panPan2
DCTN4 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 4 58,423,591 - 58,453,055 (+) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 4 58,423,635 - 58,450,874 (+) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 4 58,188,803 - 58,218,047 (+) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 4 58,903,399 - 58,932,644 (+) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 4 58,903,411 - 58,932,644 (+) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 4 58,691,730 - 58,720,975 (+) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 4 58,806,123 - 58,835,620 (+) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 4 59,337,230 - 59,366,747 (+) NCBI UU_Cfam_GSD_1.0
Dctn4 Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024407213 142,678,462 - 142,711,176 (+) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936504 4,252,431 - 4,285,151 (+) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936504 4,252,442 - 4,285,151 (+) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
DCTN4
DCTN4
Dctn4
.
Predicted Target Of
Count of predictions: 748 Count of miRNA genes: 215 Interacting mature miRNAs: 262 Transcripts: ENSRNOT00000026334, ENSRNOT00000026394 Prediction methods: Microtar, Miranda, Rnahybrid, Targetscan Result types: miRGate_prediction
1331733 Bp233 Blood pressure QTL 233 3.97196 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 18 24796977 79788953 Rat 1358358 Sradr6 Stress Responsive Adrenal Weight QTL 6 2.49 adrenal gland mass (VT:0010420) both adrenal glands wet weight (CMO:0000164) 18 11944299 59330563 Rat 1331730 Scl27 Serum cholesterol level QTL 27 3.826 blood HDL cholesterol amount (VT:0000184) serum high density lipoprotein cholesterol level (CMO:0000361) 18 52292875 59796643 Rat 1331741 Bp232 Blood pressure QTL 232 3.59112 arterial blood pressure trait (VT:2000000) diastolic blood pressure (CMO:0000005) 18 21372893 83213037 Rat 1331742 Bp228 Blood pressure QTL 228 3.88752 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 18 31359408 59796643 Rat 1331736 Bp227 Blood pressure QTL 227 2.791 arterial blood pressure trait (VT:2000000) diastolic blood pressure (CMO:0000005) 18 46718763 59796643 Rat 1300125 Rf26 Renal function QTL 26 3.2 urine potassium amount (VT:0010539) urine potassium excretion rate (CMO:0000761) 18 52539863 65844950 Rat 6893683 Bw110 Body weight QTL 110 2.7 0.002 body mass (VT:0001259) body weight (CMO:0000012) 18 43345022 83828827 Rat 1331727 Bp237 Blood pressure QTL 237 3.053 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 18 31359408 61698465 Rat 9589041 Epfw12 Epididymal fat weight QTL 12 17.08 0.001 epididymal fat pad mass (VT:0010421) epididymal fat pad weight to body weight ratio (CMO:0000658) 18 46640675 83828827 Rat 8694432 Bw165 Body weight QTL 165 3.81 0.001 body lean mass (VT:0010483) lean tissue morphological measurement (CMO:0002184) 18 46640675 83828827 Rat 9589816 Gluco68 Glucose level QTL 68 7.25 0.001 blood glucose amount (VT:0000188) plasma glucose level (CMO:0000042) 18 29792965 74792965 Rat 1331774 Bp226 Blood pressure QTL 226 4.41065 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 18 31359408 59796643 Rat 61360 Eaey Experimental allergic encephalomyelitis QTL y 3 nervous system integrity trait (VT:0010566) experimental autoimmune encephalomyelitis duration (CMO:0001424) 18 46988939 60377753 Rat 2300177 Bmd65 Bone mineral density QTL 65 19.7 0.0001 femur mineral mass (VT:0010011) volumetric bone mineral density (CMO:0001553) 18 28964853 73964853 Rat 1578667 Bss21 Bone structure and strength QTL 21 3.5 femur morphology trait (VT:0000559) femoral neck cortical cross-sectional area (CMO:0001702) 18 11791518 83218561 Rat 2303120 Mamtr8 Mammary tumor resistance QTL 8 0.001 mammary gland integrity trait (VT:0010552) mammary tumor growth rate (CMO:0000344) 18 31359408 83218561 Rat 12880368 Bw187 Body weight QTL 187 0.045 body mass (VT:0001259) body weight (CMO:0000012) 18 52539763 76104388 Rat 61367 Iddm4 Insulin dependent diabetes mellitus QTL 4 2.33 0.0074 blood glucose amount (VT:0000188) plasma glucose level (CMO:0000042) 18 38192455 83192455 Rat 2293658 Bmd23 Bone mineral density QTL 23 7.3 0.0001 femur mineral mass (VT:0010011) total volumetric bone mineral density (CMO:0001728) 18 51464733 63636873 Rat 1359020 Ppulsi2 Prepulse inhibition QTL 2 2.71 prepulse inhibition trait (VT:0003088) acoustic startle response measurement (CMO:0001519) 18 52292875 73997283 Rat 2299160 Iddm35 Insulin dependent diabetes mellitus QTL 35 2.79 blood glucose amount (VT:0000188) age at onset/diagnosis of type 1 diabetes mellitus (CMO:0001140) 18 4207941 60377792 Rat 9590318 Scort22 Serum corticosterone level QTL 22 7.64 0.001 blood corticosterone amount (VT:0005345) plasma corticosterone level (CMO:0001173) 18 29792965 74792965 Rat 1331752 Bw27 Body weight QTL 27 2.963 body mass (VT:0001259) body weight (CMO:0000012) 18 52292875 65845095 Rat 1578661 Bss20 Bone structure and strength QTL 20 3.7 femur morphology trait (VT:0000559) femoral neck cross-sectional area (CMO:0001697) 18 11791518 83218561 Rat 1331754 Bp230 Blood pressure QTL 230 4.61609 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 18 29792965 74792965 Rat 12904069 Cm123 Cardiac mass QTL 123 0.001 heart left ventricle mass (VT:0007031) heart left ventricle weight to body weight ratio (CMO:0000530) 18 52539763 76104388 Rat 1331798 Bp224 Blood pressure QTL 224 3.53873 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 18 31359408 59796643 Rat 12904070 Cm124 Cardiac mass QTL 124 0.01 heart right ventricle mass (VT:0007033) heart right ventricle weight to body weight ratio (CMO:0000914) 18 52539763 76104388 Rat 2303584 Gluco55 Glucose level QTL 55 2 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 18 48520044 83828827 Rat 12904071 Am18 Aortic mass QTL 18 0.001 aorta mass (VT:0002845) aorta weight to aorta length to body weight ratio (CMO:0002722) 18 52539763 76104388 Rat 61383 Bp47 Blood pressure QTL 47 17.3 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 18 31271681 60377755 Rat 12904067 Cm122 Cardiac mass QTL 122 0.001 heart mass (VT:0007028) heart wet weight to body weight ratio (CMO:0002408) 18 52539763 76104388 Rat 1331806 Bp229 Blood pressure QTL 229 4.36484 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 18 46718763 57867167 Rat 2301417 Bp319 Blood pressure QTL 319 0.002 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 18 52539763 76104388 Rat 12904073 Kidm71 Kidney mass QTL 71 0.001 kidney mass (VT:0002707) both kidneys wet weight to body weight ratio (CMO:0000340) 18 52539763 76104388 Rat 1331780 Bp238 Blood pressure QTL 238 3.269 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 18 46718763 59796643 Rat 738008 Hcar14 Hepatocarcinoma resistance QTL 14 4.3 liver integrity trait (VT:0010547) liver nonremodeling tumorous lesion number (CMO:0001462) 18 51464733 83218561 Rat 1331776 Bp225 Blood pressure QTL 225 2.829 arterial blood pressure trait (VT:2000000) diastolic blood pressure (CMO:0000005) 18 31359408 59796643 Rat 6903359 Bp355 Blood pressure QTL 355 3.6 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 18 11944544 59796478 Rat 631518 Bw11 Body weight QTL 11 2.8 body mass (VT:0001259) body weight (CMO:0000012) 18 35870723 80870723 Rat 6903345 Bp349 Blood pressure QTL 349 3.9 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 18 46718935 59796478 Rat 2313082 Bss85 Bone structure and strength QTL 85 0.8 0.0001 long bone metaphysis morphology trait (VT:0000133) tibia midshaft total cross-sectional area (CMO:0001715) 18 14951337 59951337 Rat 6903347 Bp350 Blood pressure QTL 350 4.4 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 18 31359530 59796478 Rat 8694366 Abfw8 Abdominal fat weight QTL 8 6.38 0.001 visceral adipose mass (VT:0010063) abdominal fat pad weight to body weight ratio (CMO:0000095) 18 46640675 83828827 Rat 6903349 Bp351 Blood pressure QTL 351 3.5 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 18 46718935 59796478 Rat 631509 Sald2 Serum aldosterone level QTL 2 2.9 blood aldosterone amount (VT:0005346) serum aldosterone level (CMO:0000487) 18 52539763 69140759 Rat 2300157 Bmd66 Bone mineral density QTL 66 13.1 0.0001 lumbar vertebra mineral mass (VT:0010511) volumetric bone mineral density (CMO:0001553) 18 28964853 73964853 Rat 738005 Anxrr11 Anxiety related response QTL 11 3.4 exploratory behavior trait (VT:0010471) number of entries into a discrete space in an experimental apparatus (CMO:0000960) 18 30039813 75039813 Rat 6903351 Bp352 Blood pressure QTL 352 3.3 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 18 46718935 59796478 Rat 631274 Sprol1 Serum protein level QTL 1 5.3 blood total protein amount (VT:0005567) serum total protein level (CMO:0000661) 18 31393320 77209694 Rat 1358193 Emca2 Estrogen-induced mammary cancer QTL 2 1.6 mammary gland integrity trait (VT:0010552) post-insult time to mammary tumor formation (CMO:0000345) 18 18007599 63571040 Rat 2293704 Bss35 Bone structure and strength QTL 35 4.59 0.0002 femur strength trait (VT:0010010) femur midshaft polar moment of inertia (CMO:0001669) 18 28964853 73964853 Rat 2325839 Bp348 Blood pressure QTL 348 0.001 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 18 25570985 70570985 Rat 1600373 Mamtr6 Mammary tumor resistance QTL 6 mammary gland integrity trait (VT:0010552) mammary tumor number (CMO:0000343) 18 19278901 83218561 Rat 2293708 Bss46 Bone structure and strength QTL 46 8.8 0.0001 lumbar vertebra morphology trait (VT:0010494) lumbar vertebra cortical cross-sectional area (CMO:0001690) 18 11791518 63636873 Rat 8694378 Bw157 Body weight QTL 157 3.59 0.001 body lean mass (VT:0010483) lean tissue morphological measurement (CMO:0002184) 18 29792965 74792965 Rat 1600375 Mcs22 Mammary carcinoma susceptibility QTL 22 3.3 mammary gland integrity trait (VT:0010552) mammary tumor growth rate (CMO:0000344) 18 52539763 63933058 Rat 2303571 Bw92 Body weight QTL 92 3 body mass (VT:0001259) body weight (CMO:0000012) 18 48520044 83828827 Rat 1598826 Anxrr20 Anxiety related response QTL 20 3.04 body movement coordination trait (VT:0005424) number of rearing movements in an experimental apparatus (CMO:0001752) 18 41432971 83828827 Rat 61429 Cia17 Collagen induced arthritis QTL 17 4.6 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 18 31359408 70263868 Rat 7411719 Strs5 Sensitivity to stroke QTL 5 9.4 cerebrum integrity trait (VT:0010549) percentage of study population developing cerebrovascular lesions during a period of time (CMO:0000932) 18 49999958 65845095 Rat
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
11
49
113
91
90
59
25
59
6
218
97
93
45
60
31
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000026334 ⟹ ENSRNOP00000026334
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 18 53,982,396 - 54,009,399 (+) Ensembl Rnor_6.0 Ensembl 18 55,797,198 - 55,822,036 (+) Ensembl
Ensembl Acc Id:
ENSRNOT00000026394 ⟹ ENSRNOP00000026394
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 18 53,982,358 - 54,008,103 (+) Ensembl Rnor_6.0 Ensembl 18 55,797,203 - 55,821,793 (+) Ensembl
Ensembl Acc Id:
ENSRNOT00000097384 ⟹ ENSRNOP00000086389
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 18 53,982,396 - 54,009,394 (+) Ensembl
RefSeq Acc Id:
NM_053404 ⟹ NP_445856
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 18 56,252,852 - 56,277,442 (+) NCBI mRatBN7.2 18 53,982,414 - 54,007,007 (+) NCBI Rnor_6.0 18 55,797,203 - 55,821,793 (+) NCBI Rnor_5.0 18 55,030,617 - 55,057,675 (+) NCBI RGSC_v3.4 18 56,478,185 - 56,502,775 (+) RGD Celera 18 52,136,101 - 52,160,691 (+) RGD
Sequence:
ATGGCGTCCTTGCTGCAGTCGGAGCGGGTTCTCTATCTCGTCCAAGGAGAAAAGAAGGTTCGGGCCCCGCTCTCACAGCTCTACTTCTGCCGCTACTGCAGTGAGCTTCGATCGCTGGAATGTGTGTC
hide sequence
RefSeq Acc Id:
XM_006254783 ⟹ XP_006254845
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 18 56,251,187 - 56,279,844 (+) NCBI mRatBN7.2 18 53,982,355 - 54,009,409 (+) NCBI Rnor_6.0 18 55,797,188 - 55,824,195 (+) NCBI Rnor_5.0 18 55,030,617 - 55,057,675 (+) NCBI
Sequence:
TCCTCCCTCACCAAGATGGCGTCCTTGCTGCAGTCGGAGCGGGTTCTCTATCTCGTCCAAGGAGAAAAGAAGGTTCGGGCCCCGCTCTCACAGCTCTACTTCTGCCGCTACTGCAGTGAGCTTCGATC
hide sequence
RefSeq Acc Id:
NP_445856 ⟸ NM_053404
- UniProtKB:
Q9QXP8 (UniProtKB/Swiss-Prot), Q9QUR2 (UniProtKB/Swiss-Prot), A6IXB2 (UniProtKB/TrEMBL), A0A8I6A638 (UniProtKB/TrEMBL)
- Sequence:
MASLLQSERVLYLVQGEKKVRAPLSQLYFCRYCSELRSLECVSHEVDSHYCPSCLENMPSAEAKLKKNRCANCFDCPGCMHTLSTRATSISTQLPDDPAKTTMKKAYYLACGFCRWTSRDVGMADKSV
hide sequence
RefSeq Acc Id:
XP_006254845 ⟸ XM_006254783
- Peptide Label:
isoform X1
- Sequence:
MASLLQSERVLYLVQGEKKVRAPLSQLYFCRYCSELRSLECVSHEVDSHYCPSCLENMPSAEAKLKKNRCANCFDCPGCMHTLSTRATSISTQLPDDPAKTTMKKAYYLACGFCRWTSRDVGMADKSV
hide sequence
Ensembl Acc Id:
ENSRNOP00000026394 ⟸ ENSRNOT00000026394
Ensembl Acc Id:
ENSRNOP00000026334 ⟸ ENSRNOT00000026334
Ensembl Acc Id:
ENSRNOP00000086389 ⟸ ENSRNOT00000097384
RGD ID: 13700810 Promoter ID: EPDNEW_R11326 Type: multiple initiation site Name: Dctn4_1 Description: dynactin subunit 4 SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Rat Assembly Chr Position (strand) Source Rnor_6.0 18 55,797,190 - 55,797,250 EPDNEW
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2015-12-02
Dctn4
dynactin subunit 4
Dctn4
dynactin 4 (p62)
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2012-01-10
Dctn4
dynactin 4 (p62)
Dctn4
dynactin 4
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2002-07-09
Dctn4
dynactin 4
Symbol and Name updated to reflect Human and Mouse nomenclature
70877 APPROVED
Note Type
Note
Reference
gene_process
involved in Arp1 pointed-end binding
70710
gene_process
plays a role in linking dynein and dynactin to the cortical cytoskeleton
70710
