Symbol:
Hip1
Name:
huntingtin interacting protein 1
RGD ID:
620305
Description:
Enables clathrin binding activity. Involved in clathrin coat assembly. Located in clathrin-coated vesicle and presynaptic membrane. Is active in glutamatergic synapse; postsynaptic membrane; and presynapse. Orthologous to human HIP1 (huntingtin interacting protein 1); PARTICIPATES IN Huntington's disease pathway; INTERACTS WITH 17beta-estradiol; 17beta-estradiol 3-benzoate; 2,3,7,8-tetrachlorodibenzodioxine.
Type:
protein-coding
RefSeq Status:
VALIDATED
Previously known as:
huntingtin-interacting protein 1
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Species
Gene symbol and name
Data Source
Assertion derived from
less info ...
Orthologs 1
Homo sapiens (human):
HIP1 (huntingtin interacting protein 1) HGNC
Ensembl, HomoloGene, Inparanoid, NCBI, OMA, OrthoDB, Panther, Treefam
Mus musculus (house mouse):
Hip1 (huntingtin interacting protein 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chinchilla lanigera (long-tailed chinchilla):
Hip1 (huntingtin interacting protein 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Pan paniscus (bonobo/pygmy chimpanzee):
HIP1 (huntingtin interacting protein 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Canis lupus familiaris (dog):
HIP1 (huntingtin interacting protein 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Ictidomys tridecemlineatus (thirteen-lined ground squirrel):
Hip1 (huntingtin interacting protein 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Sus scrofa (pig):
HIP1 (huntingtin interacting protein 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chlorocebus sabaeus (green monkey):
HIP1 (huntingtin interacting protein 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Heterocephalus glaber (naked mole-rat):
Hip1 (huntingtin interacting protein 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Alliance orthologs 3
Homo sapiens (human):
HIP1 (huntingtin interacting protein 1)
Alliance
DIOPT (HGNC|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Mus musculus (house mouse):
Hip1 (huntingtin interacting protein 1)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Danio rerio (zebrafish):
hip1 (huntingtin interacting protein 1)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Drosophila melanogaster (fruit fly):
Hip1
Alliance
DIOPT (Ensembl Compara|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|SonicParanoid)
Saccharomyces cerevisiae (baker's yeast):
SLA2
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|SonicParanoid)
Caenorhabditis elegans (roundworm):
hipr-1
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Caenorhabditis elegans (roundworm):
tag-138
Alliance
DIOPT (Ensembl Compara|OrthoFinder|PhylomeDB)
Xenopus tropicalis (tropical clawed frog):
hip1
Alliance
DIOPT (Ensembl Compara|OMA|OrthoFinder|PANTHER|PhylomeDB)
Related Pseudogenes:
Hypk-ps1
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 12 26,769,868 - 26,904,367 (+) NCBI GRCr8 mRatBN7.2 12 21,133,364 - 21,267,796 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 12 21,133,406 - 21,267,725 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 12 22,275,219 - 22,409,598 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 12 22,887,561 - 23,021,930 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 12 21,954,027 - 22,088,410 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 12 24,180,795 - 24,315,373 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 12 24,180,937 - 24,315,373 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 12 26,178,145 - 26,312,676 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 12 22,287,861 - 22,422,163 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 12 22,396,520 - 22,408,493 (+) NCBI Celera 12 22,895,802 - 23,030,274 (+) NCBI Celera Cytogenetic Map 12 q12 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Hip1 Rat (-)-epigallocatechin 3-gallate multiple interactions ISO HIP1 (Homo sapiens) 6480464 [potassium chromate(VI) co-treated with epigallocatechin gallate] results in decreased expression of HIP1 mRNA CTD PMID:22079256 Hip1 Rat 1,2-dimethylhydrazine affects expression ISO Hip1 (Mus musculus) 6480464 1 and 2-Dimethylhydrazine affects the expression of HIP1 mRNA CTD PMID:22206623 Hip1 Rat 1,2-dimethylhydrazine increases expression ISO Hip1 (Mus musculus) 6480464 1 and 2-Dimethylhydrazine results in increased expression of HIP1 mRNA CTD PMID:22206623 Hip1 Rat 17alpha-ethynylestradiol decreases expression ISO Hip1 (Mus musculus) 6480464 Ethinyl Estradiol results in decreased expression of HIP1 mRNA CTD PMID:17555576 Hip1 Rat 17alpha-ethynylestradiol multiple interactions ISO Hip1 (Mus musculus) 6480464 [Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of HIP1 mRNA CTD PMID:17942748 Hip1 Rat 17beta-estradiol decreases expression ISO Hip1 (Mus musculus) 6480464 Estradiol results in decreased expression of HIP1 mRNA CTD PMID:25210133 Hip1 Rat 17beta-estradiol multiple interactions EXP 6480464 [estradiol 3-benzoate co-treated with [Testosterone co-treated with Estradiol]] results in increased expression of HIP1 mRNA CTD PMID:32741896 Hip1 Rat 17beta-estradiol 3-benzoate multiple interactions EXP 6480464 [estradiol 3-benzoate co-treated with [Testosterone co-treated with Estradiol]] results in increased expression of HIP1 mRNA CTD PMID:32741896 Hip1 Rat 2,3,7,8-tetrachlorodibenzodioxine decreases expression ISO HIP1 (Homo sapiens) 6480464 Tetrachlorodibenzodioxin results in decreased expression of HIP1 mRNA CTD PMID:20106945 Hip1 Rat 2,3,7,8-tetrachlorodibenzodioxine decreases expression EXP 6480464 Tetrachlorodibenzodioxin results in decreased expression of HIP1 mRNA CTD PMID:33387578 Hip1 Rat 2,3,7,8-tetrachlorodibenzodioxine increases expression EXP 6480464 Tetrachlorodibenzodioxin results in increased expression of HIP1 mRNA CTD PMID:34747641 Hip1 Rat 2,3,7,8-tetrachlorodibenzodioxine increases expression ISO Hip1 (Mus musculus) 6480464 Tetrachlorodibenzodioxin results in increased expression of HIP1 mRNA CTD PMID:15328365 more ... Hip1 Rat 2,3,7,8-tetrachlorodibenzodioxine multiple interactions ISO Hip1 (Mus musculus) 6480464 [Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of HIP1 mRNA and Tetrachlorodibenzodioxin promotes the reaction [AHR protein binds to HIP1 gene] CTD PMID:17942748 and PMID:20819909 Hip1 Rat 4,4'-sulfonyldiphenol decreases expression ISO Hip1 (Mus musculus) 6480464 bisphenol S results in decreased expression of HIP1 mRNA CTD PMID:39298647 Hip1 Rat 4,4'-sulfonyldiphenol multiple interactions EXP 6480464 [bisphenol A co-treated with bisphenol F co-treated with bisphenol S] results in increased expression of HIP1 mRNA CTD PMID:36041667 Hip1 Rat 4,4'-sulfonyldiphenol affects methylation ISO Hip1 (Mus musculus) 6480464 bisphenol S affects the methylation of HIP1 gene CTD PMID:31683443 Hip1 Rat 4-hydroxyphenyl retinamide decreases expression ISO Hip1 (Mus musculus) 6480464 Fenretinide results in decreased expression of HIP1 mRNA CTD PMID:28973697 Hip1 Rat 6-propyl-2-thiouracil increases expression EXP 6480464 Propylthiouracil results in increased expression of HIP1 mRNA CTD PMID:30047161 Hip1 Rat acetamide increases expression EXP 6480464 acetamide results in increased expression of HIP1 mRNA CTD PMID:31881176 Hip1 Rat aflatoxin B1 affects methylation ISO HIP1 (Homo sapiens) 6480464 Aflatoxin B1 affects the methylation of HIP1 intron CTD PMID:30157460 Hip1 Rat Aflatoxin B2 alpha decreases methylation ISO HIP1 (Homo sapiens) 6480464 aflatoxin B2 results in decreased methylation of HIP1 intron CTD PMID:30157460 Hip1 Rat all-trans-retinoic acid decreases expression ISO HIP1 (Homo sapiens) 6480464 Tretinoin results in decreased expression of HIP1 mRNA CTD PMID:21934132 and PMID:23724009 Hip1 Rat amitrole increases expression EXP 6480464 Amitrole results in increased expression of HIP1 mRNA CTD PMID:30047161 Hip1 Rat ammonium chloride affects expression EXP 6480464 Ammonium Chloride affects the expression of HIP1 mRNA CTD PMID:16483693 Hip1 Rat antirheumatic drug decreases expression ISO HIP1 (Homo sapiens) 6480464 Antirheumatic Agents results in decreased expression of HIP1 mRNA CTD PMID:24449571 Hip1 Rat arsane affects methylation ISO HIP1 (Homo sapiens) 6480464 Arsenic affects the methylation of HIP1 gene CTD PMID:25304211 Hip1 Rat arsane multiple interactions ISO HIP1 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in decreased expression of HIP1 mRNA CTD PMID:39836092 Hip1 Rat arsenic atom affects methylation ISO HIP1 (Homo sapiens) 6480464 Arsenic affects the methylation of HIP1 gene CTD PMID:25304211 Hip1 Rat arsenic atom multiple interactions ISO HIP1 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in decreased expression of HIP1 mRNA CTD PMID:39836092 Hip1 Rat arsenite(3-) multiple interactions ISO HIP1 (Homo sapiens) 6480464 arsenite inhibits the reaction [G3BP1 protein binds to HIP1 mRNA] CTD PMID:32406909 Hip1 Rat atrazine increases expression ISO HIP1 (Homo sapiens) 6480464 Atrazine results in increased expression of HIP1 mRNA CTD PMID:22378314 Hip1 Rat benzo[a]pyrene decreases expression ISO HIP1 (Homo sapiens) 6480464 Benzo(a)pyrene results in decreased expression of HIP1 mRNA CTD PMID:20106945 and PMID:26238291 Hip1 Rat benzo[e]pyrene increases methylation ISO HIP1 (Homo sapiens) 6480464 benzo(e)pyrene results in increased methylation of HIP1 intron CTD PMID:30157460 Hip1 Rat bis(2-chloroethyl) sulfide affects expression EXP 6480464 Mustard Gas affects the expression of HIP1 mRNA CTD PMID:15651846 Hip1 Rat bisphenol A affects expression EXP 6480464 bisphenol A affects the expression of HIP1 mRNA CTD PMID:25181051 Hip1 Rat bisphenol A multiple interactions EXP 6480464 [bisphenol A co-treated with bisphenol F co-treated with bisphenol S] results in increased expression of HIP1 mRNA CTD PMID:36041667 Hip1 Rat bisphenol A decreases expression ISO HIP1 (Homo sapiens) 6480464 bisphenol A results in decreased expression of HIP1 protein CTD PMID:31675489 Hip1 Rat bisphenol A decreases methylation ISO HIP1 (Homo sapiens) 6480464 bisphenol A results in decreased methylation of HIP1 gene CTD PMID:31601247 Hip1 Rat bisphenol A multiple interactions ISO HIP1 (Homo sapiens) 6480464 [bisphenol A co-treated with Fulvestrant] results in increased methylation of HIP1 gene CTD PMID:31601247 Hip1 Rat bisphenol A decreases expression EXP 6480464 bisphenol A results in decreased expression of HIP1 mRNA CTD PMID:30816183 more ... Hip1 Rat bisphenol F multiple interactions EXP 6480464 [bisphenol A co-treated with bisphenol F co-treated with bisphenol S] results in increased expression of HIP1 mRNA CTD PMID:36041667 Hip1 Rat cadmium atom multiple interactions ISO Hip1 (Mus musculus) 6480464 [Cadmium Chloride results in increased abundance of Cadmium] which results in decreased expression of HIP1 mRNA CTD PMID:37325564 Hip1 Rat cadmium dichloride multiple interactions ISO Hip1 (Mus musculus) 6480464 [Cadmium Chloride results in increased abundance of Cadmium] which results in decreased expression of HIP1 mRNA CTD PMID:37325564 Hip1 Rat caffeine decreases phosphorylation ISO HIP1 (Homo sapiens) 6480464 Caffeine results in decreased phosphorylation of HIP1 protein CTD PMID:35688186 Hip1 Rat cannabidiol increases expression ISO HIP1 (Homo sapiens) 6480464 Cannabidiol results in increased expression of HIP1 protein CTD PMID:34122009 Hip1 Rat CGP 52608 multiple interactions ISO HIP1 (Homo sapiens) 6480464 CGP 52608 promotes the reaction [RORA protein binds to HIP1 gene] CTD PMID:28238834 Hip1 Rat chlorpyrifos decreases expression ISO Hip1 (Mus musculus) 6480464 Chlorpyrifos results in decreased expression of HIP1 mRNA CTD PMID:37019170 Hip1 Rat clotrimazole increases expression EXP 6480464 Clotrimazole results in increased expression of HIP1 mRNA CTD PMID:30047161 Hip1 Rat cobalt dichloride decreases expression EXP 6480464 cobaltous chloride results in decreased expression of HIP1 mRNA CTD PMID:24386269 Hip1 Rat copper(II) sulfate increases expression ISO HIP1 (Homo sapiens) 6480464 Copper Sulfate results in increased expression of HIP1 mRNA CTD PMID:19549813 Hip1 Rat decabromodiphenyl ether increases expression EXP 6480464 decabromobiphenyl ether results in increased expression of HIP1 mRNA CTD PMID:23640034 Hip1 Rat Dibutyl phosphate affects expression ISO HIP1 (Homo sapiens) 6480464 di-n-butylphosphoric acid affects the expression of HIP1 mRNA CTD PMID:37042841 Hip1 Rat dibutyl phthalate increases expression ISO Hip1 (Mus musculus) 6480464 Dibutyl Phthalate results in increased expression of HIP1 mRNA CTD PMID:21266533 Hip1 Rat dicrotophos increases expression ISO HIP1 (Homo sapiens) 6480464 dicrotophos results in increased expression of HIP1 mRNA CTD PMID:28302478 Hip1 Rat dorsomorphin multiple interactions ISO HIP1 (Homo sapiens) 6480464 [NOG protein co-treated with trichostatin A co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of HIP1 mRNA CTD PMID:27188386 Hip1 Rat ethanol increases expression ISO HIP1 (Homo sapiens) 6480464 Ethanol results in increased expression of HIP1 mRNA CTD PMID:28986285 Hip1 Rat ethanol increases expression ISO Hip1 (Mus musculus) 6480464 Ethanol results in increased expression of HIP1 mRNA CTD PMID:30319688 Hip1 Rat ethanol affects splicing ISO Hip1 (Mus musculus) 6480464 Ethanol affects the splicing of HIP1 mRNA CTD PMID:30319688 Hip1 Rat folic acid decreases expression ISO Hip1 (Mus musculus) 6480464 Folic Acid results in decreased expression of HIP1 mRNA CTD PMID:25629700 Hip1 Rat FR900359 increases phosphorylation ISO HIP1 (Homo sapiens) 6480464 FR900359 results in increased phosphorylation of HIP1 protein CTD PMID:37730182 Hip1 Rat fulvestrant multiple interactions ISO HIP1 (Homo sapiens) 6480464 [bisphenol A co-treated with Fulvestrant] results in increased methylation of HIP1 gene CTD PMID:31601247 Hip1 Rat gentamycin decreases expression EXP 6480464 Gentamicins results in decreased expression of HIP1 mRNA CTD PMID:33387578 Hip1 Rat glycine betaine decreases expression EXP 6480464 Betaine results in decreased expression of HIP1 mRNA CTD PMID:26391144 Hip1 Rat isotretinoin increases expression ISO HIP1 (Homo sapiens) 6480464 Isotretinoin results in increased expression of HIP1 mRNA CTD PMID:20436886 Hip1 Rat ivermectin decreases expression ISO HIP1 (Homo sapiens) 6480464 Ivermectin results in decreased expression of HIP1 protein CTD PMID:32959892 Hip1 Rat kojic acid increases expression ISO HIP1 (Homo sapiens) 6480464 kojic acid results in increased expression of HIP1 mRNA CTD PMID:16595896 Hip1 Rat manganese atom multiple interactions ISO HIP1 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in decreased expression of HIP1 mRNA CTD PMID:39836092 Hip1 Rat manganese(0) multiple interactions ISO HIP1 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in decreased expression of HIP1 mRNA CTD PMID:39836092 Hip1 Rat manganese(II) chloride multiple interactions ISO HIP1 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in decreased expression of HIP1 mRNA CTD PMID:39836092 Hip1 Rat methapyrilene increases methylation ISO HIP1 (Homo sapiens) 6480464 Methapyrilene results in increased methylation of HIP1 intron CTD PMID:30157460 Hip1 Rat methoxychlor affects methylation EXP 6480464 Methoxychlor affects the methylation of HIP1 gene CTD PMID:35440735 Hip1 Rat nickel dichloride affects expression EXP 6480464 nickel chloride affects the expression of HIP1 mRNA CTD PMID:22110744 and PMID:22546817 Hip1 Rat nickel sulfate increases expression ISO HIP1 (Homo sapiens) 6480464 nickel sulfate results in increased expression of HIP1 mRNA CTD PMID:16780908 Hip1 Rat nitrofen decreases expression EXP 6480464 nitrofen results in decreased expression of HIP1 mRNA CTD PMID:33484710 Hip1 Rat p-toluidine decreases expression EXP 6480464 4-toluidine results in decreased expression of HIP1 mRNA CTD PMID:27638505 Hip1 Rat panobinostat increases expression ISO HIP1 (Homo sapiens) 6480464 Panobinostat results in increased expression of HIP1 mRNA CTD PMID:33770205 Hip1 Rat paracetamol decreases expression ISO HIP1 (Homo sapiens) 6480464 Acetaminophen results in decreased expression of HIP1 mRNA CTD PMID:21420995 Hip1 Rat paracetamol decreases expression EXP 6480464 Acetaminophen results in decreased expression of HIP1 mRNA CTD PMID:33387578 Hip1 Rat phosgene affects expression ISO Hip1 (Mus musculus) 6480464 Phosgene affects the expression of HIP1 mRNA CTD PMID:16300373 Hip1 Rat pinostrobin increases expression ISO HIP1 (Homo sapiens) 6480464 pinostrobin results in increased expression of HIP1 mRNA CTD PMID:37777166 Hip1 Rat potassium chromate decreases expression ISO HIP1 (Homo sapiens) 6480464 potassium chromate(VI) results in decreased expression of HIP1 mRNA CTD PMID:22079256 Hip1 Rat potassium chromate multiple interactions ISO HIP1 (Homo sapiens) 6480464 [potassium chromate(VI) co-treated with epigallocatechin gallate] results in decreased expression of HIP1 mRNA CTD PMID:22079256 Hip1 Rat SB 431542 multiple interactions ISO HIP1 (Homo sapiens) 6480464 [LDN 193189 co-treated with 4-(5-benzo(1 more ... CTD PMID:27188386 and PMID:37664457 Hip1 Rat silicon dioxide decreases expression ISO HIP1 (Homo sapiens) 6480464 Silicon Dioxide analog results in decreased expression of HIP1 mRNA CTD PMID:25895662 Hip1 Rat sodium arsenite increases expression ISO HIP1 (Homo sapiens) 6480464 sodium arsenite results in increased expression of HIP1 mRNA CTD PMID:34032870 Hip1 Rat sodium arsenite multiple interactions ISO HIP1 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in decreased expression of HIP1 mRNA CTD PMID:39836092 Hip1 Rat succimer multiple interactions ISO Hip1 (Mus musculus) 6480464 [Succimer binds to Magnetite Nanoparticles] which results in decreased expression of HIP1 mRNA and [Succimer co-treated with Magnetite Nanoparticles] results in decreased expression of HIP1 mRNA CTD PMID:21641980 and PMID:26378955 Hip1 Rat tamoxifen increases expression ISO HIP1 (Homo sapiens) 6480464 Tamoxifen results in increased expression of HIP1 mRNA CTD PMID:15590111 Hip1 Rat testosterone multiple interactions EXP 6480464 [estradiol 3-benzoate co-treated with [Testosterone co-treated with Estradiol]] results in increased expression of HIP1 mRNA CTD PMID:32741896 Hip1 Rat thimerosal decreases expression ISO HIP1 (Homo sapiens) 6480464 Thimerosal results in decreased expression of HIP1 mRNA CTD PMID:27188386 Hip1 Rat thioacetamide increases expression EXP 6480464 Thioacetamide results in increased expression of HIP1 mRNA CTD PMID:34492290 Hip1 Rat titanium dioxide decreases expression ISO Hip1 (Mus musculus) 6480464 titanium dioxide results in decreased expression of HIP1 mRNA CTD PMID:29264374 Hip1 Rat titanium dioxide decreases methylation ISO Hip1 (Mus musculus) 6480464 titanium dioxide results in decreased methylation of HIP1 gene and titanium dioxide results in decreased methylation of HIP1 promoter CTD PMID:35295148 Hip1 Rat titanium dioxide increases methylation ISO Hip1 (Mus musculus) 6480464 titanium dioxide results in increased methylation of HIP1 gene CTD PMID:35295148 Hip1 Rat trichloroethene decreases expression EXP 6480464 Trichloroethylene results in decreased expression of HIP1 mRNA CTD PMID:33387578 Hip1 Rat trichostatin A decreases expression ISO HIP1 (Homo sapiens) 6480464 trichostatin A results in decreased expression of HIP1 mRNA CTD PMID:24935251 and PMID:26272509 Hip1 Rat trichostatin A affects expression ISO HIP1 (Homo sapiens) 6480464 trichostatin A affects the expression of HIP1 mRNA CTD PMID:28542535 Hip1 Rat trichostatin A multiple interactions ISO HIP1 (Homo sapiens) 6480464 [NOG protein co-treated with trichostatin A co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of HIP1 mRNA CTD PMID:27188386 Hip1 Rat triphenyl phosphate affects expression ISO HIP1 (Homo sapiens) 6480464 triphenyl phosphate affects the expression of HIP1 mRNA CTD PMID:37042841 Hip1 Rat triptonide decreases expression ISO Hip1 (Mus musculus) 6480464 triptonide results in decreased expression of HIP1 mRNA CTD PMID:33045310 Hip1 Rat urethane decreases expression ISO HIP1 (Homo sapiens) 6480464 Urethane results in decreased expression of HIP1 mRNA CTD PMID:28818685 Hip1 Rat valproic acid decreases expression ISO HIP1 (Homo sapiens) 6480464 Valproic Acid results in decreased expression of HIP1 mRNA CTD PMID:28001369 Hip1 Rat vinclozolin affects expression EXP 6480464 vinclozolin affects the expression of HIP1 mRNA CTD PMID:19015723
Imported Annotations - KEGG (archival)
(-)-epigallocatechin 3-gallate (ISO) 1,2-dimethylhydrazine (ISO) 17alpha-ethynylestradiol (ISO) 17beta-estradiol (EXP,ISO) 17beta-estradiol 3-benzoate (EXP) 2,3,7,8-tetrachlorodibenzodioxine (EXP,ISO) 4,4'-sulfonyldiphenol (EXP,ISO) 4-hydroxyphenyl retinamide (ISO) 6-propyl-2-thiouracil (EXP) acetamide (EXP) aflatoxin B1 (ISO) Aflatoxin B2 alpha (ISO) all-trans-retinoic acid (ISO) amitrole (EXP) ammonium chloride (EXP) antirheumatic drug (ISO) arsane (ISO) arsenic atom (ISO) arsenite(3-) (ISO) atrazine (ISO) benzo[a]pyrene (ISO) benzo[e]pyrene (ISO) bis(2-chloroethyl) sulfide (EXP) bisphenol A (EXP,ISO) bisphenol F (EXP) cadmium atom (ISO) cadmium dichloride (ISO) caffeine (ISO) cannabidiol (ISO) CGP 52608 (ISO) chlorpyrifos (ISO) clotrimazole (EXP) cobalt dichloride (EXP) copper(II) sulfate (ISO) decabromodiphenyl ether (EXP) Dibutyl phosphate (ISO) dibutyl phthalate (ISO) dicrotophos (ISO) dorsomorphin (ISO) ethanol (ISO) folic acid (ISO) FR900359 (ISO) fulvestrant (ISO) gentamycin (EXP) glycine betaine (EXP) isotretinoin (ISO) ivermectin (ISO) kojic acid (ISO) manganese atom (ISO) manganese(0) (ISO) manganese(II) chloride (ISO) methapyrilene (ISO) methoxychlor (EXP) nickel dichloride (EXP) nickel sulfate (ISO) nitrofen (EXP) p-toluidine (EXP) panobinostat (ISO) paracetamol (EXP,ISO) phosgene (ISO) pinostrobin (ISO) potassium chromate (ISO) SB 431542 (ISO) silicon dioxide (ISO) sodium arsenite (ISO) succimer (ISO) tamoxifen (ISO) testosterone (EXP) thimerosal (ISO) thioacetamide (EXP) titanium dioxide (ISO) trichloroethene (EXP) trichostatin A (ISO) triphenyl phosphate (ISO) triptonide (ISO) urethane (ISO) valproic acid (ISO) vinclozolin (EXP)
1.
Phylogenetic-based propagation of functional annotations within the Gene Ontology consortium.
Gaudet P, etal., Brief Bioinform. 2011 Sep;12(5):449-62. doi: 10.1093/bib/bbr042. Epub 2011 Aug 27.
2.
Rat ISS GO annotations from GOA human gene data--August 2006
GOA data from the GO Consortium
3.
HIP1 and HIP12 display differential binding to F-actin, AP2, and clathrin. Identification of a novel interaction with clathrin light chain.
Legendre-Guillemin V, etal., J Biol Chem 2002 May 31;277(22):19897-904.
4.
Clathrin- and AP-2-binding sites in HIP1 uncover a general assembly role for endocytic accessory proteins.
Mishra SK, etal., J Biol Chem 2001 Dec 7;276(49):46230-6. Epub 2001 Sep 27.
5.
Electronic Transfer of LocusLink and RefSeq Data
NCBI rat LocusLink and RefSeq merged data July 26, 2002
6.
OMIM Disease Annotation Pipeline
OMIM Disease Annotation Pipeline
7.
KEGG Annotation Import Pipeline
Pipeline to import KEGG annotations from KEGG into RGD
8.
GOA pipeline
RGD automated data pipeline
9.
Data Import for Chemical-Gene Interactions
RGD automated import pipeline for gene-chemical interactions
10.
Partially overlapping distribution of epsin1 and HIP1 at the synapse: analysis by immunoelectron microscopy.
Yao PJ, etal., J Comp Neurol. 2006 Jan 10;494(2):368-79.
Hip1 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 12 26,769,868 - 26,904,367 (+) NCBI GRCr8 mRatBN7.2 12 21,133,364 - 21,267,796 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 12 21,133,406 - 21,267,725 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 12 22,275,219 - 22,409,598 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 12 22,887,561 - 23,021,930 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 12 21,954,027 - 22,088,410 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 12 24,180,795 - 24,315,373 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 12 24,180,937 - 24,315,373 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 12 26,178,145 - 26,312,676 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 12 22,287,861 - 22,422,163 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 12 22,396,520 - 22,408,493 (+) NCBI Celera 12 22,895,802 - 23,030,274 (+) NCBI Celera Cytogenetic Map 12 q12 NCBI
HIP1 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 7 75,533,298 - 75,738,941 (-) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 7 75,533,298 - 75,738,962 (-) Ensembl GRCh38 hg38 GRCh38 GRCh37 7 75,162,619 - 75,368,259 (-) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 7 75,001,345 - 75,206,215 (-) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 7 74,808,059 - 75,012,930 NCBI Celera 7 70,031,212 - 70,236,048 (-) NCBI Celera Cytogenetic Map 7 q11.23 NCBI HuRef 7 70,248,359 - 70,453,525 (-) NCBI HuRef CHM1_1 7 75,092,714 - 75,298,283 (-) NCBI CHM1_1 T2T-CHM13v2.0 7 76,820,630 - 77,026,024 (-) NCBI T2T-CHM13v2.0 CRA_TCAGchr7v2 7 74,495,683 - 74,701,354 (-) NCBI
Hip1 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 5 135,435,350 - 135,574,167 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 5 135,435,385 - 135,573,974 (-) Ensembl GRCm39 Ensembl GRCm38 5 135,406,496 - 135,545,323 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 5 135,406,531 - 135,545,120 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 5 135,882,388 - 136,020,992 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 5 135,692,653 - 135,829,742 (-) NCBI MGSCv36 mm8 Celera 5 132,418,220 - 132,556,655 (-) NCBI Celera Cytogenetic Map 5 G2 NCBI cM Map 5 75.18 NCBI
Hip1 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955456 14,392,921 - 14,529,213 (-) Ensembl ChiLan1.0 ChiLan1.0 NW_004955456 14,389,282 - 14,529,317 (-) NCBI ChiLan1.0 ChiLan1.0
HIP1 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 6 94,215,412 - 94,420,460 (+) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 7 142,480,052 - 142,685,098 (+) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 7 68,281,899 - 68,464,233 (+) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 7 82,187,193 - 82,193,058 (-) NCBI panpan1.1 PanPan1.1 panPan2
HIP1 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 6 6,957,760 - 7,115,676 (-) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 6 6,961,053 - 7,115,618 (-) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 6 8,654,406 - 8,812,467 (-) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 6 6,778,147 - 6,936,340 (-) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 6 6,778,151 - 6,936,438 (-) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 6 6,747,968 - 6,905,918 (-) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 6 6,711,133 - 6,869,280 (-) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 6 6,874,374 - 7,032,555 (-) NCBI UU_Cfam_GSD_1.0
Hip1 Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024409344 131,467,552 - 131,540,287 (-) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936543 2,522,154 - 2,565,376 (+) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936543 2,496,301 - 2,569,019 (+) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
HIP1 Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 3 10,416,475 - 10,578,366 (+) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 3 10,416,418 - 10,578,374 (+) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 3 10,176,878 - 10,282,562 (+) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
HIP1 Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 28 9,805,985 - 10,007,931 (-) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 28 9,807,672 - 9,914,047 (-) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666070 6,432,081 - 6,658,245 (+) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Hip1
.
Predicted Target Of
Count of predictions: 560 Count of miRNA genes: 269 Interacting mature miRNAs: 361 Transcripts: ENSRNOT00000030497 Prediction methods: Miranda, Targetscan Result types: miRGate_prediction
631560 Apr1 Acute phase response QTL 1 6.1 orosomucoid 1 amount (VT:0010541) plasma orosomucoid 1 level (CMO:0001467) 12 19144362 46669029 Rat 8552964 Pigfal17 Plasma insulin-like growth factor 1 level QTL 17 3.5 blood insulin-like growth factor amount (VT:0010479) plasma insulin-like growth factor 1 level (CMO:0001299) 12 5564495 46669029 Rat 61324 Eae5 Experimental allergic encephalomyelitis QTL 5 14 nervous system integrity trait (VT:0010566) percentage of study population developing relapsing-remitting experimental autoimmune encephalomyelitis during a period of time (CMO:0001402) 12 19610870 46669029 Rat 9590147 Scort7 Serum corticosterone level QTL 7 13.61 0.001 blood corticosterone amount (VT:0005345) plasma corticosterone level (CMO:0001173) 12 1 42110980 Rat 1549829 Scl48 Serum cholesterol level QTL 48 5 blood cholesterol amount (VT:0000180) serum total cholesterol level (CMO:0000363) 12 9603277 46669029 Rat 61331 Eau2 Experimental allergic uveoretinitis QTL 2 0.0005 uvea integrity trait (VT:0010551) experimental autoimmune uveitis score (CMO:0001504) 12 8525423 28064601 Rat 737822 Alc10 Alcohol consumption QTL 10 2.2 consumption behavior trait (VT:0002069) ethanol drink intake rate (CMO:0001407) 12 19610870 40218516 Rat 2293684 Bmd26 Bone mineral density QTL 26 4.4 0.0002 femur mineral mass (VT:0010011) total volumetric bone mineral density (CMO:0001728) 12 15872653 32974238 Rat 6893681 Bw109 Body weight QTL 109 2.3 0.004 body mass (VT:0001259) body weight (CMO:0000012) 12 1 23297788 Rat 1302792 Scl21 Serum cholesterol level QTL 21 3.8 0.0011 blood cholesterol amount (VT:0000180) plasma total cholesterol level (CMO:0000585) 12 7196730 46669029 Rat 1598855 Bp294 Blood pressure QTL 294 3.5 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 12 1 34851688 Rat 10755457 Coatc14 Coat color QTL 14 0.01759 coat/hair pigmentation trait (VT:0010463) pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812) 12 1 22591684 Rat 1331761 Bp218 Blood pressure QTL 218 2.973 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 12 11073825 45055165 Rat 8694179 Bw150 Body weight QTL 150 2.9 0.001 body mass (VT:0001259) body weight gain (CMO:0000420) 12 1 42110980 Rat 7411545 Bw128 Body weight QTL 128 5.2 0.001 body mass (VT:0001259) body weight gain (CMO:0000420) 12 1 42110980 Rat 7411547 Bw129 Body weight QTL 129 0.001 body mass (VT:0001259) body weight gain (CMO:0000420) 6 5564495 46669029 Rat 1300157 Rf21 Renal function QTL 21 4.4 renal blood flow trait (VT:2000006) absolute change in renal blood flow rate (CMO:0001168) 12 9318216 32103380 Rat 737979 Pia22 Pristane induced arthritis QTL 22 53.1 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 12 1 44465750 Rat 1298081 Cia25 Collagen induced arthritis QTL 25 4.7 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 12 19610889 35682913 Rat 2300186 Bmd59 Bone mineral density QTL 59 7.1 0.0001 lumbar vertebra mineral mass (VT:0010511) volumetric bone mineral density (CMO:0001553) 12 10474137 46669029 Rat 7411660 Foco28 Food consumption QTL 28 10.9 0.001 eating behavior trait (VT:0001431) feed conversion ratio (CMO:0001312) 12 1 42110980 Rat 11530002 Bss119 Bone structure and strength QTL 119 16.39 4e-17 lumbar vertebra area (VT:0010570) lumbar vertebra area (CMO:0001688) 12 20873419 21346740 Rat 1331755 Bp219 Blood pressure QTL 219 3.041 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 12 11073825 28064557 Rat 70213 Niddm27 Non-insulin dependent diabetes mellitus QTL 27 3.72 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 12 19835789 38193007 Rat 2306789 Ean6 Experimental allergic neuritis QTL 6 4.9 nervous system integrity trait (VT:0010566) experimental autoimmune neuritis severity score (CMO:0001528) 12 19610870 24139202 Rat 7411641 Foco19 Food consumption QTL 19 27.7 0.001 eating behavior trait (VT:0001431) feed conversion ratio (CMO:0001312) 12 5564495 46669029 Rat 7411643 Foco20 Food consumption QTL 20 0.001 eating behavior trait (VT:0001431) feed conversion ratio (CMO:0001312) 12 20328819 46669029 Rat 5684888 Pia42 Pristane induced arthritis QTL 42 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 12 19610870 42828880 Rat 1549912 Bp268 Blood pressure QTL 268 arterial blood pressure trait (VT:2000000) diastolic blood pressure (CMO:0000005) 10 13182736 46669029 Rat 2302060 Pia37 Pristane induced arthritis QTL 37 6.1 0.001 blood immunoglobulin amount (VT:0002460) serum immunoglobulin G1 level (CMO:0002115) 12 13198157 46669029 Rat 1641928 Alcrsp5 Alcohol response QTL 5 response to alcohol trait (VT:0010489) duration of loss of righting reflex (CMO:0002289) 12 12812385 46669029 Rat 8552912 Pigfal6 Plasma insulin-like growth factor 1 level QTL 6 5 blood insulin-like growth factor amount (VT:0010479) plasma insulin-like growth factor 1 level (CMO:0001299) 12 5564498 46669029 Rat 10059594 Kidm46 Kidney mass QTL 46 3.79 0.025 kidney mass (VT:0002707) both kidneys wet weight to body weight ratio (CMO:0000340) 12 6107579 46669029 Rat 1581516 Cm56 Cardiac mass QTL 56 4.2 0.05 heart left ventricle mass (VT:0007031) heart left ventricle weight to body weight ratio (CMO:0000530) 12 1 29333307 Rat 9590086 Insglur6 Insulin/glucose ratio QTL 6 18.97 0.001 blood insulin amount (VT:0001560) calculated plasma insulin level (CMO:0002170) 12 1 42110980 Rat 8552918 Pigfal7 Plasma insulin-like growth factor 1 level QTL 7 blood insulin-like growth factor amount (VT:0010479) plasma insulin-like growth factor 1 level (CMO:0001299) 12 5564495 46669029 Rat 1549902 Bp269 Blood pressure QTL 269 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 12 13182736 46669029 Rat 61404 Bw120 Body weight QTL 120 5.1 body mass (VT:0001259) body mass index (BMI) (CMO:0000105) 12 12351619 46669029 Rat 1331786 Kidm11 Kidney mass QTL 11 3.571 kidney mass (VT:0002707) right kidney wet weight (CMO:0000082) 12 11073825 24234895 Rat 2293699 Bss49 Bone structure and strength QTL 49 5.61 0.0001 lumbar vertebra size trait (VT:0010518) lumbar vertebra trabecular cross-sectional area (CMO:0001692) 12 10474137 46669029 Rat 634351 Apr5 Acute phase response QTL 5 6.7 blood interleukin-6 amount (VT:0008595) plasma interleukin-6 level (CMO:0001927) 12 1 44503507 Rat 634350 Apr4 Acute phase response QTL 4 6 orosomucoid 1 amount (VT:0010541) plasma orosomucoid 1 level (CMO:0001467) 12 1172005 46172005 Rat 61416 Pia4 Pristane induced arthritis QTL 4 8.4 joint integrity trait (VT:0010548) arthritic paw count (CMO:0001460) 12 13635523 30827399 Rat 631521 Pia12 Pristane induced arthritis QTL 12 8.9 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 12 20259417 23672083 Rat 7387292 Kidm42 Kidney mass QTL 42 3.03 0.0004 kidney mass (VT:0002707) left kidney wet weight (CMO:0000083) 12 1 36247923 Rat 61421 Cia12 Collagen induced arthritis QTL 12 4.6 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 12 13635523 35682913 Rat 2303569 Gluco44 Glucose level QTL 44 2 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 12 12812385 46669029 Rat 7411586 Foco5 Food consumption QTL 5 5.4 0.001 eating behavior trait (VT:0001431) feed conversion ratio (CMO:0001312) 12 1 42110980 Rat 2303575 Insul14 Insulin level QTL 14 4 blood insulin amount (VT:0001560) blood insulin level (CMO:0000349) 12 1 42450532 Rat 7411588 Foco6 Food consumption QTL 6 0.001 eating behavior trait (VT:0001431) feed conversion ratio (CMO:0001312) 12 5564495 46669029 Rat 2302042 Pia38 Pristane induced arthritis QTL 38 3.5 0.001 blood immunoglobulin amount (VT:0002460) serum immunoglobulin G1 level (CMO:0002115) 12 1 44503507 Rat 7411595 Foco9 Food consumption QTL 9 4 0.001 eating behavior trait (VT:0001431) feed conversion ratio (CMO:0001312) 12 1 42110980 Rat 7411597 Foco10 Food consumption QTL 10 0.001 eating behavior trait (VT:0001431) feed conversion ratio (CMO:0001312) 12 5564495 46669029 Rat 2293086 Iddm30 Insulin dependent diabetes mellitus QTL 30 3.82 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 12 8449490 28302290 Rat 631543 Bp83 Blood pressure QTL 83 5.8 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 12 15550826 38478808 Rat
D12Rat33
Rat Assembly Chr Position (strand) Source JBrowse GRCr8 12 26,782,759 - 26,782,998 (+) Marker Load Pipeline mRatBN7.2 12 21,146,177 - 21,146,418 (+) MAPPER mRatBN7.2 Rnor_6.0 12 24,193,707 - 24,193,945 NCBI Rnor6.0 Rnor_5.0 12 26,191,010 - 26,191,248 UniSTS Rnor5.0 RGSC_v3.4 12 22,300,630 - 22,300,868 UniSTS RGSC3.4 RGSC_v3.4 12 22,300,576 - 22,300,992 RGD RGSC3.4 RGSC_v3.1 12 22,287,675 - 22,287,913 RGD Celera 12 22,908,570 - 22,908,808 UniSTS RH 3.4 Map 12 336.2 RGD RH 3.4 Map 12 336.2 UniSTS RH 2.0 Map 12 225.2 RGD SHRSP x BN Map 12 23.8199 RGD FHH x ACI Map 12 10.1799 RGD Cytogenetic Map 12 q12 UniSTS
BE116737
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 12 21,145,698 - 21,145,874 (+) MAPPER mRatBN7.2 Rnor_6.0 12 24,193,228 - 24,193,403 NCBI Rnor6.0 Rnor_5.0 12 26,190,531 - 26,190,706 UniSTS Rnor5.0 RGSC_v3.4 12 22,300,151 - 22,300,326 UniSTS RGSC3.4 Celera 12 22,908,091 - 22,908,266 UniSTS RH 3.4 Map 12 337.9 UniSTS Cytogenetic Map 12 q12 UniSTS
RH128125
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 12 21,267,317 - 21,267,526 (+) MAPPER mRatBN7.2 Rnor_6.0 12 24,314,966 - 24,315,174 NCBI Rnor6.0 Rnor_5.0 12 26,312,269 - 26,312,477 UniSTS Rnor5.0 RGSC_v3.4 12 22,421,756 - 22,421,964 UniSTS RGSC3.4 Celera 12 23,029,867 - 23,030,075 UniSTS RH 3.4 Map 12 338.1 UniSTS Cytogenetic Map 12 q12 UniSTS
RH128368
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 12 21,185,779 - 21,185,995 (+) MAPPER mRatBN7.2 Rnor_6.0 12 24,233,606 - 24,233,821 NCBI Rnor6.0 Rnor_5.0 12 26,230,909 - 26,231,124 UniSTS Rnor5.0 RGSC_v3.4 12 22,340,224 - 22,340,439 UniSTS RGSC3.4 Celera 12 22,948,620 - 22,948,835 UniSTS RH 3.4 Map 12 339.4 UniSTS Cytogenetic Map 12 q12 UniSTS
RH133161
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 12 21,264,284 - 21,264,492 (+) MAPPER mRatBN7.2 Rnor_6.0 12 24,311,933 - 24,312,140 NCBI Rnor6.0 Rnor_5.0 12 26,309,236 - 26,309,443 UniSTS Rnor5.0 RGSC_v3.4 12 22,418,723 - 22,418,930 UniSTS RGSC3.4 Celera 12 23,026,834 - 23,027,041 UniSTS RH 3.4 Map 12 338.5 UniSTS Cytogenetic Map 12 q12 UniSTS
AA964673
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 12 21,265,289 - 21,265,406 (+) MAPPER mRatBN7.2 Rnor_6.0 12 24,312,938 - 24,313,054 NCBI Rnor6.0 Rnor_5.0 12 26,310,241 - 26,310,357 UniSTS Rnor5.0 RGSC_v3.4 12 22,419,728 - 22,419,844 UniSTS RGSC3.4 Celera 12 23,027,839 - 23,027,955 UniSTS RH 3.4 Map 12 338.5 UniSTS Cytogenetic Map 12 q12 UniSTS
AU047037
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 18 70,634,718 - 70,634,762 (-) MAPPER mRatBN7.2 mRatBN7.2 12 21,166,067 - 21,166,275 (+) MAPPER mRatBN7.2 mRatBN7.2 1 95,470,595 - 95,470,642 (+) MAPPER mRatBN7.2 mRatBN7.2 9 8,240,881 - 8,240,924 (-) MAPPER mRatBN7.2 mRatBN7.2 7 17,956,378 - 17,956,423 (-) MAPPER mRatBN7.2 mRatBN7.2 10 71,494,412 - 71,494,456 (-) MAPPER mRatBN7.2 mRatBN7.2 17 10,516,594 - 10,516,637 (-) MAPPER mRatBN7.2 mRatBN7.2 8 107,082,514 - 107,082,558 (+) MAPPER mRatBN7.2 mRatBN7.2 19 45,524,578 - 45,524,621 (-) MAPPER mRatBN7.2 mRatBN7.2 4 168,388,066 - 168,388,109 (-) MAPPER mRatBN7.2 Rnor_6.0 12 24,213,901 - 24,214,110 NCBI Rnor6.0 Rnor_5.0 12 26,211,204 - 26,211,413 UniSTS Rnor5.0 RGSC_v3.4 12 22,320,518 - 22,320,727 UniSTS RGSC3.4 Celera 12 22,928,914 - 22,929,123 UniSTS Cytogenetic Map 12 q12 UniSTS
RH135309
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 12 21,170,851 - 21,171,053 (+) MAPPER mRatBN7.2 Rnor_6.0 12 24,218,687 - 24,218,888 NCBI Rnor6.0 Rnor_5.0 12 26,215,990 - 26,216,191 UniSTS Rnor5.0 RGSC_v3.4 12 22,325,304 - 22,325,505 UniSTS RGSC3.4 Celera 12 22,933,700 - 22,933,901 UniSTS RH 3.4 Map 12 337.6 UniSTS Cytogenetic Map 12 q12 UniSTS
AU048794
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 12 21,160,147 - 21,160,379 (+) MAPPER mRatBN7.2 mRatBN7.2 8 70,861,070 - 70,862,047 (+) MAPPER mRatBN7.2 Rnor_6.0 8 76,618,937 - 76,619,913 NCBI Rnor6.0 Rnor_6.0 12 24,207,674 - 24,207,905 NCBI Rnor6.0 Rnor_5.0 12 26,204,977 - 26,205,208 UniSTS Rnor5.0 RGSC_v3.4 12 22,314,597 - 22,314,828 UniSTS RGSC3.4 RGSC_v3.4 8 74,643,445 - 74,644,421 UniSTS RGSC3.4 Celera 12 22,922,992 - 22,923,225 UniSTS Celera 12 4,359,958 - 4,361,111 UniSTS Cytogenetic Map 12 p12 UniSTS Cytogenetic Map 12 q12 UniSTS
RH91194
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 12 21,193,622 - 21,195,182 (+) MAPPER mRatBN7.2 Rnor_6.0 12 24,241,646 - 24,243,205 NCBI Rnor6.0 Rnor_5.0 12 26,238,949 - 26,240,508 UniSTS Rnor5.0 RGSC_v3.4 12 22,348,066 - 22,349,625 UniSTS RGSC3.4 Celera 12 22,956,395 - 22,957,954 UniSTS Cytogenetic Map 12 q12 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
11
49
113
91
90
59
25
59
6
218
97
93
45
60
31
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000030497 ⟹ ENSRNOP00000031153
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 12 21,133,408 - 21,267,725 (+) Ensembl Rnor_6.0 Ensembl 12 24,180,937 - 24,315,373 (+) Ensembl
Ensembl Acc Id:
ENSRNOT00000098638 ⟹ ENSRNOP00000088574
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 12 21,190,263 - 21,267,725 (+) Ensembl
Ensembl Acc Id:
ENSRNOT00000104382 ⟹ ENSRNOP00000078035
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 12 21,211,411 - 21,267,725 (+) Ensembl
Ensembl Acc Id:
ENSRNOT00000119935 ⟹ ENSRNOP00000083048
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 12 21,133,406 - 21,263,011 (+) Ensembl
RefSeq Acc Id:
NM_001100475 ⟹ NP_001093945
RefSeq Status:
PROVISIONAL
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 12 26,769,991 - 26,904,296 (+) NCBI mRatBN7.2 12 21,133,408 - 21,267,725 (+) NCBI Rnor_6.0 12 24,180,937 - 24,315,373 (+) NCBI Rnor_5.0 12 26,178,145 - 26,312,676 (+) NCBI RGSC_v3.4 12 22,287,861 - 22,422,163 (+) RGD Celera 12 22,895,802 - 23,030,274 (+) RGD
Sequence:
GGCGGGAGGCGCCGCGGGGATCCCGGGGCGGCCGAGGGCCCCTGACTCTGTTCACCCAGACAACATGGACCGGATGGCCAGCTCCATGAAGCAGGTACCCAACCCGCTGCCCAAAGTGTTGAGCCGGC
hide sequence
RefSeq Acc Id:
NM_001415756 ⟹ NP_001402685
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 12 26,769,947 - 26,904,367 (+) NCBI mRatBN7.2 12 21,133,364 - 21,267,796 (+) NCBI
RefSeq Acc Id:
XM_006249099 ⟹ XP_006249161
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 12 26,847,953 - 26,904,367 (+) NCBI mRatBN7.2 12 21,211,402 - 21,267,796 (+) NCBI Rnor_6.0 12 24,259,296 - 24,313,361 (+) NCBI Rnor_5.0 12 26,178,145 - 26,312,676 (+) NCBI
Sequence:
CTACCCAGTAGCAAGGCCTGGAAACTTCTCATTGGTCACATCCAGGCTGATCTGCCTGGAGGGAGTCTGTAAATAGGGAGACCTGGAGGGGGAGGAAGAGAAGTGGAGAGAGAAAGCCTCCCTTCCTT
hide sequence
RefSeq Acc Id:
XM_006249100 ⟹ XP_006249162
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 12 26,826,531 - 26,904,367 (+) NCBI mRatBN7.2 12 21,189,958 - 21,267,796 (+) NCBI Rnor_6.0 12 24,238,278 - 24,313,361 (+) NCBI Rnor_5.0 12 26,178,145 - 26,312,676 (+) NCBI
Sequence:
CCCCCGCCGTGCTCCGTCCAGCCGCGGTGCGGCCGGCCACCACCAGGGCCCCCGTCGGCCGCTG
hide sequence
RefSeq Acc Id:
XM_017598252 ⟹ XP_017453741
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 12 26,850,478 - 26,904,367 (+) NCBI mRatBN7.2 12 21,213,903 - 21,267,785 (+) NCBI Rnor_6.0 12 24,261,168 - 24,313,361 (+) NCBI
Sequence:
CTGAGTTCAGTTTCCAGCGCCCACATCAGGCGGCTTACAACTCTGGCTCCAATTCCCCTGGCTCCAATTCCCCTGGCCTCTGGCACCCACACTAAAGTGGGCATACCCACAATCACCCATGCATACGT
hide sequence
RefSeq Acc Id:
XM_017598253 ⟹ XP_017453742
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 12 26,850,478 - 26,904,367 (+) NCBI mRatBN7.2 12 21,213,903 - 21,267,796 (+) NCBI Rnor_6.0 12 24,261,168 - 24,313,361 (+) NCBI
Sequence:
CTGAGTTCAGTTTCCAGCGCCCACATCAGGCGGCTTACAACTCTGGCTCCAATTCCCCTGGCTCCAATTCCCCTGGCCTCTGGCACCCACACTAAAGTGGGCATACCCACAATCACCCATGCATACGT
hide sequence
RefSeq Acc Id:
XM_039089055 ⟹ XP_038944983
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 12 26,850,478 - 26,904,367 (+) NCBI mRatBN7.2 12 21,213,903 - 21,267,796 (+) NCBI
RefSeq Acc Id:
XM_063271032 ⟹ XP_063127102
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 12 26,769,868 - 26,904,367 (+) NCBI
RefSeq Acc Id:
XM_063271033 ⟹ XP_063127103
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 12 26,769,868 - 26,904,367 (+) NCBI
RefSeq Acc Id:
XM_063271034 ⟹ XP_063127104
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 12 26,826,528 - 26,904,367 (+) NCBI
RefSeq Acc Id:
XM_063271035 ⟹ XP_063127105
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 12 26,873,015 - 26,904,367 (+) NCBI
RefSeq Acc Id:
XM_063271036 ⟹ XP_063127106
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 12 26,867,778 - 26,904,367 (+) NCBI
RefSeq Acc Id:
NP_001093945 ⟸ NM_001100475
- Peptide Label:
isoform 1
- UniProtKB:
A6J0C8 (UniProtKB/TrEMBL), A0A8I6GA90 (UniProtKB/TrEMBL)
- Sequence:
MDRMASSMKQVPNPLPKVLSRRGVGAGMEAAERESFERTQTVSVNKAINTQEVAVKEKHARTCILGTHHEKGAQTFWSVVNRLPLSSNAMLCWKFCHVFHKLLRDGHPNVLKDSLRYKNELSDMSRMW
hide sequence
RefSeq Acc Id:
XP_006249162 ⟸ XM_006249100
- Peptide Label:
isoform X4
- UniProtKB:
A0A8I6AA26 (UniProtKB/TrEMBL), A6J0C9 (UniProtKB/TrEMBL)
- Sequence:
MDVNKMTVSVNKAINTQEVAVKEKHARTCILGTHHEKGAQTFWSVVNRLPLSSNAMLCWKFCHV
hide sequence
RefSeq Acc Id:
XP_006249161 ⟸ XM_006249099
- Peptide Label:
isoform X3
- UniProtKB:
A0A8I5Y6T0 (UniProtKB/TrEMBL), A6J0C9 (UniProtKB/TrEMBL)
- Sequence:
MFSNLDPPPETVSVNKAINTQEVAVKEKHARTCILGTHHEKGAQTFWSVVNRLPLSSNAMLCWK
hide sequence
RefSeq Acc Id:
XP_017453741 ⟸ XM_017598252
- Peptide Label:
isoform X1
- UniProtKB:
A6J0C9 (UniProtKB/TrEMBL)
- Sequence:
MPGSKACSLGTAWDSWSGSAAHLCATPSPKRGTREDPEGPWMVSWPSSIPRTVSVNKAINTQEV
hide sequence
RefSeq Acc Id:
XP_017453742 ⟸ XM_017598253
- Peptide Label:
isoform X1
- UniProtKB:
A6J0C9 (UniProtKB/TrEMBL)
- Sequence:
MPGSKACSLGTAWDSWSGSAAHLCATPSPKRGTREDPEGPWMVSWPSSIPRTVSVNKAINTQEVAVKEKHARTCILGTHHEKGAQTFWSVVNRLPLSSNAMLCWKFCHVFHKLLRDGHPNVLKDSLRY
hide sequence
Ensembl Acc Id:
ENSRNOP00000031153 ⟸ ENSRNOT00000030497
RefSeq Acc Id:
XP_038944983 ⟸ XM_039089055
- Peptide Label:
isoform X1
- UniProtKB:
A6J0C9 (UniProtKB/TrEMBL)
Ensembl Acc Id:
ENSRNOP00000078035 ⟸ ENSRNOT00000104382
Ensembl Acc Id:
ENSRNOP00000088574 ⟸ ENSRNOT00000098638
Ensembl Acc Id:
ENSRNOP00000083048 ⟸ ENSRNOT00000119935
RefSeq Acc Id:
NP_001402685 ⟸ NM_001415756
- Peptide Label:
isoform 2
- UniProtKB:
G3V8Y8 (UniProtKB/TrEMBL), A0A8I6GA90 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063127102 ⟸ XM_063271032
- Peptide Label:
isoform X2
- UniProtKB:
G3V8Y8 (UniProtKB/TrEMBL), A0A8I6GA90 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063127103 ⟸ XM_063271033
- Peptide Label:
isoform X2
- UniProtKB:
G3V8Y8 (UniProtKB/TrEMBL), A0A8I6GA90 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063127104 ⟸ XM_063271034
- Peptide Label:
isoform X4
- UniProtKB:
A0A8I6AA26 (UniProtKB/TrEMBL), A6J0C9 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063127106 ⟸ XM_063271036
- Peptide Label:
isoform X5
RefSeq Acc Id:
XP_063127105 ⟸ XM_063271035
- Peptide Label:
isoform X5
RGD ID: 13698551 Promoter ID: EPDNEW_R9076 Type: initiation region Name: Hip1_1 Description: huntingtin interacting protein 1 SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Rat Assembly Chr Position (strand) Source Rnor_6.0 12 24,180,986 - 24,181,046 EPDNEW
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2004-02-26
Hip1
huntingtin interacting protein 1
Symbol and Name status set to approved
625702 APPROVED
2002-08-07
Hip1
huntingtin interacting protein 1
Symbol and Name status set to provisional
70820 PROVISIONAL
