Symbol:
Vwf
Name:
von Willebrand factor
RGD ID:
621759
Description:
Predicted to enable several functions, including identical protein binding activity; integrin binding activity; and protein-folding chaperone binding activity. Involved in several processes, including cellular response to cold; cellular response to lipopolysaccharide; and liver regeneration. Located in collagen-containing extracellular matrix and extracellular space. Used to study transient cerebral ischemia. Biomarker of hypertension; mesangial proliferative glomerulonephritis; myocardial infarction; pulmonary fibrosis; and type 1 diabetes mellitus. Human ortholog(s) of this gene implicated in several diseases, including Behcet's disease; Bernard-Soulier syndrome; end stage renal disease; essential thrombocythemia; and von Willebrand's disease (multiple). Orthologous to human VWF (von Willebrand factor); PARTICIPATES IN platelet aggregation pathway; cell-extracellular matrix signaling pathway; coagulation cascade pathway; INTERACTS WITH 17alpha-ethynylestradiol; 2,3,7,8-tetrachlorodibenzodioxine; 6-propyl-2-thiouracil.
Type:
protein-coding
RefSeq Status:
VALIDATED
Previously known as:
von Willebrand factor homolog
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Allele / Splice:
Vwfem2Mcwi
Vwfem3Mcwi
Vwfem1Mcwi
Vwfem4Mcwi
Genetic Models:
SS-Vwfem2Mcwi-/-
SD-Vwfem1Mcwi-/-
SS-Vwfem3Mcwi-/-
SS-Vwfem4Mcwi
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 4 160,042,900 - 160,177,757 (+) NCBI GRCr8 mRatBN7.2 4 158,360,152 - 158,491,539 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 4 158,360,152 - 158,491,539 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 4 164,595,998 - 164,727,404 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 4 160,378,929 - 160,510,343 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 4 159,012,985 - 159,144,157 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 4 158,085,059 - 158,219,525 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 4 158,088,505 - 158,219,523 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 4 225,098,521 - 225,229,257 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 4 161,723,415 - 161,854,766 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 4 162,053,065 - 162,055,090 (+) NCBI Celera 4 147,092,791 - 147,223,711 (+) NCBI Celera Cytogenetic Map 4 q42 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Vwf Rat (+)-dexrazoxane multiple interactions ISO Vwf (Mus musculus) 6480464 [Dexrazoxane co-treated with Doxorubicin] results in increased expression of VWF protein and Dexrazoxane inhibits the reaction [Doxorubicin results in increased expression of VWF protein] CTD PMID:30517846 Vwf Rat (S)-nicotine decreases expression ISO Vwf (Mus musculus) 6480464 Nicotine results in decreased expression of VWF mRNA CTD PMID:17456735 Vwf Rat (S)-nicotine increases expression ISO VWF (Homo sapiens) 6480464 Nicotine results in increased expression of VWF mRNA CTD PMID:11166759 Vwf Rat 1,1-bis(2-aminoethyl)-2-hydroxy-3-oxotriazane multiple interactions ISO VWF (Homo sapiens) 6480464 2 and 2'-(hydroxynitrosohydrazono)bis-ethanamine inhibits the reaction [TNF protein results in increased secretion of VWF protein] CTD PMID:34678311 Vwf Rat 1,2-dimethylhydrazine increases expression ISO Vwf (Mus musculus) 6480464 1 and 2-Dimethylhydrazine results in increased expression of VWF mRNA CTD PMID:22206623 Vwf Rat 1-naphthyl isothiocyanate multiple interactions ISO Vwf (Mus musculus) 6480464 1-Naphthylisothiocyanate results in increased expression of and results in increased activity of VWF protein more ... CTD PMID:34619301 Vwf Rat 1-naphthyl isothiocyanate affects response to substance ISO Vwf (Mus musculus) 6480464 VWF protein affects the susceptibility to 1-Naphthylisothiocyanate CTD PMID:34619301 Vwf Rat 17alpha-ethynylestradiol multiple interactions ISO VWF (Homo sapiens) 6480464 [Ethinyl Estradiol co-treated with Gestodene] results in increased expression of VWF protein CTD PMID:12616983 Vwf Rat 17alpha-ethynylestradiol increases expression EXP 6480464 Ethinyl Estradiol results in increased expression of VWF mRNA CTD PMID:29097150 Vwf Rat 17alpha-ethynylestradiol affects expression ISO Vwf (Mus musculus) 6480464 Ethinyl Estradiol affects the expression of VWF mRNA CTD PMID:17555576 Vwf Rat 17alpha-ethynylestradiol decreases expression ISO VWF (Homo sapiens) 6480464 Ethinyl Estradiol results in decreased expression of VWF mRNA and Ethinyl Estradiol results in decreased expression of VWF protein CTD PMID:18298783 and PMID:18936297 Vwf Rat 17beta-estradiol multiple interactions ISO VWF (Homo sapiens) 6480464 [Estradiol co-treated with TGFB1 protein] results in decreased expression of VWF mRNA and [Progesterone co-treated with Estradiol] results in increased expression of VWF mRNA CTD PMID:18692832 and PMID:30165855 Vwf Rat 17beta-estradiol increases expression ISO VWF (Homo sapiens) 6480464 Estradiol results in increased expression of VWF mRNA CTD PMID:31614463 Vwf Rat 2,3,7,8-tetrachlorodibenzodioxine affects expression EXP 6480464 Tetrachlorodibenzodioxin affects the expression of VWF mRNA CTD PMID:22298810 Vwf Rat 2,3,7,8-tetrachlorodibenzodioxine decreases expression EXP 6480464 Tetrachlorodibenzodioxin results in decreased expression of VWF mRNA CTD PMID:34747641 Vwf Rat 2,4,6-tribromophenol increases expression ISO VWF (Homo sapiens) 6480464 2 more ... CTD PMID:31675489 Vwf Rat 2,4,6-trinitrobenzenesulfonic acid increases expression ISO Vwf (Mus musculus) 6480464 Trinitrobenzenesulfonic Acid results in increased expression of VWF protein CTD PMID:25307345 Vwf Rat 2,4,6-trinitrobenzenesulfonic acid multiple interactions ISO Vwf (Mus musculus) 6480464 NTS protein promotes the reaction [Trinitrobenzenesulfonic Acid results in increased expression of VWF protein] CTD PMID:25307345 Vwf Rat 2,4-dibromophenyl 2,4,5-tribromophenyl ether affects expression ISO Vwf (Mus musculus) 6480464 2 more ... CTD PMID:38648751 Vwf Rat 2-hydroxypropanoic acid decreases expression ISO VWF (Homo sapiens) 6480464 Lactic Acid results in decreased expression of VWF mRNA CTD PMID:30851411 Vwf Rat 3,3',5,5'-tetrabromobisphenol A increases expression ISO VWF (Homo sapiens) 6480464 tetrabromobisphenol A results in increased expression of VWF protein CTD PMID:31675489 Vwf Rat 3-methylcholanthrene multiple interactions ISO Vwf (Mus musculus) 6480464 [Methylcholanthrene co-treated with Nanotubes and Carbon] affects the expression of VWF mRNA CTD PMID:25926378 Vwf Rat 4,4'-diaminodiphenylmethane decreases expression ISO Vwf (Mus musculus) 6480464 4 and 4'-diaminodiphenylmethane results in decreased expression of VWF mRNA CTD PMID:18648102 Vwf Rat 4,4'-sulfonyldiphenol increases expression ISO VWF (Homo sapiens) 6480464 bisphenol S results in increased expression of VWF mRNA CTD PMID:27685785 Vwf Rat 4,4'-sulfonyldiphenol affects methylation ISO Vwf (Mus musculus) 6480464 bisphenol S affects the methylation of VWF gene CTD PMID:31683443 Vwf Rat 4,4'-sulfonyldiphenol decreases expression ISO Vwf (Mus musculus) 6480464 bisphenol S results in decreased expression of VWF mRNA CTD PMID:39298647 Vwf Rat 4,4'-sulfonyldiphenol decreases methylation ISO Vwf (Mus musculus) 6480464 bisphenol S results in decreased methylation of VWF exon CTD PMID:33297965 Vwf Rat 4,4'-sulfonyldiphenol increases expression ISO Vwf (Mus musculus) 6480464 bisphenol S results in increased expression of VWF mRNA CTD PMID:30951980 Vwf Rat 4,4'-sulfonyldiphenol multiple interactions ISO Vwf (Mus musculus) 6480464 [bisphenol S co-treated with LIF protein] results in decreased expression of VWF mRNA CTD PMID:30951980 Vwf Rat 5-aza-2'-deoxycytidine affects expression ISO VWF (Homo sapiens) 6480464 Decitabine affects the expression of VWF mRNA CTD PMID:23300844 Vwf Rat 6-propyl-2-thiouracil decreases expression EXP 6480464 Propylthiouracil results in decreased expression of VWF mRNA CTD PMID:24780913 Vwf Rat 6-propyl-2-thiouracil increases expression EXP 6480464 Propylthiouracil results in increased expression of VWF mRNA CTD PMID:30047161 Vwf Rat 6alpha-methylprednisolone decreases expression ISO VWF (Homo sapiens) 6480464 Methylprednisolone results in decreased expression of VWF protein CTD PMID:20405515 Vwf Rat 6alpha-methylprednisolone increases expression ISO VWF (Homo sapiens) 6480464 Methylprednisolone results in increased expression of VWF protein CTD PMID:7491699 Vwf Rat 7,12-dimethyltetraphene increases expression EXP 6480464 9 more ... CTD PMID:19480007 Vwf Rat acrolein decreases expression ISO VWF (Homo sapiens) 6480464 Acrolein results in decreased expression of VWF protein CTD PMID:31634544 Vwf Rat aflatoxin B1 increases expression ISO VWF (Homo sapiens) 6480464 Aflatoxin B1 results in increased expression of VWF mRNA CTD PMID:21641981 Vwf Rat aflatoxin B1 increases expression EXP 6480464 Aflatoxin B1 results in increased expression of VWF mRNA CTD PMID:33354967 Vwf Rat aflatoxin B1 decreases methylation ISO VWF (Homo sapiens) 6480464 Aflatoxin B1 results in decreased methylation of VWF intron CTD PMID:30157460 Vwf Rat Aflatoxin B2 alpha decreases methylation ISO VWF (Homo sapiens) 6480464 aflatoxin B2 results in decreased methylation of VWF intron CTD PMID:30157460 Vwf Rat aldehydo-D-glucose decreases expression ISO VWF (Homo sapiens) 6480464 Glucose results in decreased expression of VWF mRNA CTD PMID:31655124 Vwf Rat alendronic acid decreases expression ISO VWF (Homo sapiens) 6480464 Alendronate results in decreased expression of VWF mRNA CTD PMID:39137827 Vwf Rat all-trans-retinoic acid multiple interactions ISO Vwf (Mus musculus) 6480464 [mono-(2-ethylhexyl)phthalate co-treated with Tretinoin] results in decreased expression of VWF mRNA CTD PMID:36189433 Vwf Rat amitrole increases expression EXP 6480464 Amitrole results in increased expression of VWF mRNA CTD PMID:30047161 Vwf Rat ammonium chloride affects expression EXP 6480464 Ammonium Chloride affects the expression of VWF mRNA CTD PMID:16483693 Vwf Rat arsane affects methylation ISO VWF (Homo sapiens) 6480464 Arsenic affects the methylation of VWF gene CTD PMID:25304211 Vwf Rat arsane multiple interactions ISO VWF (Homo sapiens) 6480464 [sodium arsenate results in increased abundance of Arsenic] which results in decreased expression of VWF mRNA CTD PMID:32525701 Vwf Rat arsenic atom affects methylation ISO VWF (Homo sapiens) 6480464 Arsenic affects the methylation of VWF gene CTD PMID:25304211 Vwf Rat arsenic atom multiple interactions ISO VWF (Homo sapiens) 6480464 [sodium arsenate results in increased abundance of Arsenic] which results in decreased expression of VWF mRNA CTD PMID:32525701 Vwf Rat arsenous acid increases expression ISO VWF (Homo sapiens) 6480464 Arsenic Trioxide results in increased expression of VWF mRNA CTD PMID:20458559 Vwf Rat atorvastatin calcium increases expression ISO VWF (Homo sapiens) 6480464 Atorvastatin results in increased expression of VWF protein CTD PMID:19171469 Vwf Rat benzene decreases expression EXP 6480464 Benzene results in decreased expression of VWF mRNA CTD PMID:17905399 Vwf Rat benzene decreases expression ISO Vwf (Mus musculus) 6480464 Benzene results in decreased expression of VWF mRNA CTD PMID:37084897 Vwf Rat benzo[a]pyrene increases mutagenesis ISO VWF (Homo sapiens) 6480464 Benzo(a)pyrene results in increased mutagenesis of VWF gene CTD PMID:25435355 Vwf Rat benzo[a]pyrene increases expression ISO Vwf (Mus musculus) 6480464 Benzo(a)pyrene results in increased expression of VWF mRNA CTD PMID:39111554 Vwf Rat benzo[a]pyrene increases methylation ISO VWF (Homo sapiens) 6480464 Benzo(a)pyrene results in increased methylation of VWF 5' UTR CTD PMID:27901495 Vwf Rat benzo[a]pyrene affects methylation ISO VWF (Homo sapiens) 6480464 Benzo(a)pyrene affects the methylation of VWF intron and Benzo(a)pyrene affects the methylation of VWF promoter CTD PMID:27901495 and PMID:30157460 Vwf Rat benzo[a]pyrene decreases expression ISO VWF (Homo sapiens) 6480464 Benzo(a)pyrene results in decreased expression of VWF mRNA CTD PMID:20064835 and PMID:21802500 Vwf Rat benzo[b]fluoranthene increases expression ISO Vwf (Mus musculus) 6480464 benzo(b)fluoranthene results in increased expression of VWF mRNA CTD PMID:26377693 Vwf Rat benzo[e]pyrene decreases methylation ISO VWF (Homo sapiens) 6480464 benzo(e)pyrene results in decreased methylation of VWF intron CTD PMID:30157460 Vwf Rat beta-naphthoflavone multiple interactions EXP 6480464 [Diethylnitrosamine co-treated with beta-Naphthoflavone] results in increased expression of VWF mRNA CTD PMID:18164116 Vwf Rat bilirubin IXalpha multiple interactions ISO Vwf (Mus musculus) 6480464 [VWF protein affects the susceptibility to 1-Naphthylisothiocyanate] which affects the abundance of Bilirubin CTD PMID:34619301 Vwf Rat bis(2-chloroethyl) sulfide increases expression EXP 6480464 Mustard Gas results in increased expression of VWF protein CTD PMID:28962529 Vwf Rat bisphenol A affects expression EXP 6480464 bisphenol A affects the expression of VWF mRNA CTD PMID:25181051 Vwf Rat bisphenol A increases expression ISO Vwf (Mus musculus) 6480464 bisphenol A results in increased expression of VWF mRNA CTD PMID:32156529 Vwf Rat bisphenol A decreases expression EXP 6480464 bisphenol A results in decreased expression of VWF mRNA CTD PMID:30816183 Vwf Rat bisphenol A multiple interactions ISO Vwf (Mus musculus) 6480464 [bisphenol A co-treated with LIF protein] results in decreased expression of VWF mRNA CTD PMID:30951980 Vwf Rat bisphenol A increases expression EXP 6480464 bisphenol A results in increased expression of VWF mRNA CTD PMID:29097150 Vwf Rat bisphenol A increases expression ISO VWF (Homo sapiens) 6480464 bisphenol A results in increased expression of VWF mRNA CTD PMID:27685785 Vwf Rat bisphenol F increases expression ISO Vwf (Mus musculus) 6480464 bisphenol F results in increased expression of VWF mRNA CTD PMID:30951980 Vwf Rat bleomycin A2 multiple interactions ISO Vwf (Mus musculus) 6480464 Cannabidiol analog inhibits the reaction [Bleomycin results in decreased expression of VWF protein] CTD PMID:30825431 Vwf Rat bleomycin A2 decreases expression ISO Vwf (Mus musculus) 6480464 Bleomycin results in decreased expression of VWF protein CTD PMID:30825431 Vwf Rat cadmium atom multiple interactions ISO VWF (Homo sapiens) 6480464 Cadmium results in increased expression of and results in increased secretion of VWF protein CTD PMID:29571895 Vwf Rat cadmium dichloride increases expression ISO VWF (Homo sapiens) 6480464 Cadmium Chloride results in increased expression of VWF mRNA CTD PMID:20580663 and PMID:29571895 Vwf Rat cadmium dichloride multiple interactions ISO VWF (Homo sapiens) 6480464 Cadmium Chloride promotes the reaction [ERG protein binds to VWF promoter] more ... CTD PMID:29571895 Vwf Rat cadmium dichloride increases expression ISO Vwf (Mus musculus) 6480464 Cadmium Chloride results in increased expression of VWF mRNA and Cadmium Chloride results in increased expression of VWF protein CTD PMID:29571895 Vwf Rat calcitriol increases expression ISO VWF (Homo sapiens) 6480464 Calcitriol results in increased expression of VWF mRNA CTD PMID:26485663 Vwf Rat cannabidiol increases expression ISO Vwf (Mus musculus) 6480464 Cannabidiol results in increased expression of VWF mRNA CTD PMID:21542829 Vwf Rat cannabidiol multiple interactions ISO Vwf (Mus musculus) 6480464 Cannabidiol analog inhibits the reaction [Bleomycin results in decreased expression of VWF protein] CTD PMID:30825431 Vwf Rat cantharidin decreases expression ISO Vwf (Mus musculus) 6480464 Cantharidin results in decreased expression of VWF mRNA CTD PMID:36907384 Vwf Rat carbon atom increases expression ISO VWF (Homo sapiens) 6480464 Carbon results in increased expression of VWF protein CTD PMID:20822968 Vwf Rat carbon nanotube increases expression ISO Vwf (Mus musculus) 6480464 Nanotubes more ... CTD PMID:25554681 Vwf Rat carbon nanotube multiple interactions ISO Vwf (Mus musculus) 6480464 [Methylcholanthrene co-treated with Nanotubes and Carbon] affects the expression of VWF mRNA CTD PMID:25926378 Vwf Rat CGP 52608 multiple interactions ISO VWF (Homo sapiens) 6480464 CGP 52608 promotes the reaction [RORA protein binds to VWF gene] CTD PMID:28238834 Vwf Rat cholesterol multiple interactions EXP 6480464 [Cholesterol co-treated with Ergosterol] results in increased expression of and results in increased secretion of VWF protein and resveratrol inhibits the reaction [[Cholesterol co-treated with Ergosterol] results in increased expression of and results in increased secretion of VWF protein] CTD PMID:25833014 Vwf Rat cisplatin increases expression ISO VWF (Homo sapiens) 6480464 Cisplatin results in increased expression of VWF protein CTD PMID:16301596 Vwf Rat cisplatin affects expression ISO VWF (Homo sapiens) 6480464 Cisplatin affects the expression of VWF mRNA CTD PMID:23300844 Vwf Rat cocaine increases expression ISO VWF (Homo sapiens) 6480464 Cocaine results in increased expression of VWF protein CTD PMID:10493323 and PMID:11988210 Vwf Rat copper atom decreases expression EXP 6480464 Copper results in decreased expression of VWF mRNA CTD PMID:22465980 Vwf Rat copper(0) decreases expression EXP 6480464 Copper results in decreased expression of VWF mRNA CTD PMID:22465980 Vwf Rat cortisol multiple interactions ISO VWF (Homo sapiens) 6480464 Mifepristone inhibits the reaction [Hydrocortisone results in increased expression of VWF mRNA] CTD PMID:25763180 Vwf Rat cortisol increases expression ISO VWF (Homo sapiens) 6480464 Hydrocortisone results in increased expression of VWF mRNA CTD PMID:25763180 Vwf Rat cumene multiple interactions ISO Vwf (Mus musculus) 6480464 [cumene co-treated with KRAS gene mutant form] results in decreased expression of VWF mRNA CTD PMID:18648096 Vwf Rat Cuprizon increases expression EXP 6480464 Cuprizone results in increased expression of VWF mRNA CTD PMID:26577399 Vwf Rat curcumin multiple interactions EXP 6480464 Curcumin inhibits the reaction [Carbon Tetrachloride results in increased expression of VWF mRNA] and Curcumin inhibits the reaction [Carbon Tetrachloride results in increased expression of VWF protein] CTD PMID:23845850 Vwf Rat Curcumol multiple interactions ISO Vwf (Mus musculus) 6480464 ATG5 protein inhibits the reaction [curcumol inhibits the reaction [Carbon Tetrachloride results in increased expression of VWF protein]] more ... CTD PMID:33549628 Vwf Rat D-glucose decreases expression ISO VWF (Homo sapiens) 6480464 Glucose results in decreased expression of VWF mRNA CTD PMID:31655124 Vwf Rat desmopressin increases activity ISO VWF (Homo sapiens) 6480464 Deamino Arginine Vasopressin results in increased activity of VWF protein CTD PMID:2738447 Vwf Rat desmopressin increases secretion ISO VWF (Homo sapiens) 6480464 Deamino Arginine Vasopressin results in increased secretion of VWF protein CTD PMID:1837767 and PMID:3259400 Vwf Rat diarsenic trioxide increases expression ISO VWF (Homo sapiens) 6480464 Arsenic Trioxide results in increased expression of VWF mRNA CTD PMID:20458559 Vwf Rat dibenz[a,h]anthracene increases expression ISO Vwf (Mus musculus) 6480464 1 more ... CTD PMID:26377693 Vwf Rat Dibutyl phosphate affects expression ISO VWF (Homo sapiens) 6480464 di-n-butylphosphoric acid affects the expression of VWF mRNA CTD PMID:37042841 Vwf Rat dibutyl phthalate decreases expression EXP 6480464 Dibutyl Phthalate results in decreased expression of VWF mRNA CTD PMID:21266533 Vwf Rat dioxygen multiple interactions ISO VWF (Homo sapiens) 6480464 HIF1A protein affects the reaction [Oxygen deficiency results in increased expression of VWF protein] and SENP1 protein affects the reaction [Oxygen deficiency results in increased expression of VWF protein] CTD PMID:31953908 Vwf Rat dioxygen increases expression ISO VWF (Homo sapiens) 6480464 Oxygen deficiency results in increased expression of VWF protein CTD PMID:31953908 Vwf Rat dorsomorphin multiple interactions ISO VWF (Homo sapiens) 6480464 [NOG protein co-treated with mercuric bromide co-treated with dorsomorphin co-treated with 4-(5-benzo(1 more ... CTD PMID:27188386 Vwf Rat doxorubicin increases expression ISO Vwf (Mus musculus) 6480464 Doxorubicin results in increased expression of VWF protein CTD PMID:30517846 Vwf Rat doxorubicin decreases expression ISO VWF (Homo sapiens) 6480464 Doxorubicin results in decreased expression of VWF mRNA CTD PMID:29803840 Vwf Rat doxorubicin multiple interactions ISO Vwf (Mus musculus) 6480464 [Dexrazoxane co-treated with Doxorubicin] results in increased expression of VWF protein and Dexrazoxane inhibits the reaction [Doxorubicin results in increased expression of VWF protein] CTD PMID:30517846 Vwf Rat elemental carbon increases expression ISO VWF (Homo sapiens) 6480464 Carbon results in increased expression of VWF protein CTD PMID:20822968 Vwf Rat enalapril decreases expression ISO Vwf (Mus musculus) 6480464 Enalapril results in decreased expression of VWF mRNA CTD PMID:25037058 Vwf Rat ergosterol multiple interactions EXP 6480464 [Cholesterol co-treated with Ergosterol] results in increased expression of and results in increased secretion of VWF protein and resveratrol inhibits the reaction [[Cholesterol co-treated with Ergosterol] results in increased expression of and results in increased secretion of VWF protein] CTD PMID:25833014 Vwf Rat ethanol multiple interactions ISO Vwf (Mus musculus) 6480464 [Carbon Tetrachloride co-treated with Ethanol] results in increased expression of VWF mRNA CTD PMID:30517762 Vwf Rat fenoldopam affects expression EXP 6480464 Fenoldopam affects the expression of VWF protein CTD PMID:11026604 Vwf Rat fenvalerate decreases expression EXP 6480464 fenvalerate results in decreased expression of VWF mRNA CTD PMID:30307764 Vwf Rat folic acid decreases expression ISO VWF (Homo sapiens) 6480464 Folic Acid results in decreased expression of VWF protein CTD PMID:26056802 Vwf Rat gemcitabine decreases expression ISO VWF (Homo sapiens) 6480464 Gemcitabine results in decreased expression of VWF protein CTD PMID:20531411 Vwf Rat genistein decreases expression ISO Vwf (Mus musculus) 6480464 Genistein results in decreased expression of VWF mRNA CTD PMID:32186404 Vwf Rat gentamycin increases expression EXP 6480464 Gentamicins results in increased expression of VWF mRNA CTD PMID:33387578 Vwf Rat gestodene multiple interactions ISO VWF (Homo sapiens) 6480464 [Ethinyl Estradiol co-treated with Gestodene] results in increased expression of VWF protein CTD PMID:12616983 Vwf Rat glucose decreases expression ISO VWF (Homo sapiens) 6480464 Glucose results in decreased expression of VWF mRNA CTD PMID:31655124 Vwf Rat graphite affects expression EXP 6480464 Graphite affects the expression of VWF mRNA CTD PMID:29933104 Vwf Rat indole-3-methanol affects expression EXP 6480464 indole-3-carbinol affects the expression of VWF mRNA CTD PMID:21396975 Vwf Rat indometacin decreases expression ISO Vwf (Mus musculus) 6480464 Indomethacin results in decreased expression of VWF protein CTD PMID:18431645 Vwf Rat indometacin multiple interactions ISO Vwf (Mus musculus) 6480464 allylpyrocatechol inhibits the reaction [Indomethacin results in decreased expression of VWF protein] CTD PMID:18431645 Vwf Rat isoprenaline increases expression ISO Vwf (Mus musculus) 6480464 Isoproterenol results in increased expression of VWF mRNA CTD PMID:20003209 Vwf Rat L-methionine increases degradation ISO VWF (Homo sapiens) 6480464 Methionine results in increased degradation of VWF protein CTD PMID:15870546 Vwf Rat Lasiocarpine decreases expression ISO VWF (Homo sapiens) 6480464 lasiocarpine metabolite results in decreased expression of VWF mRNA CTD PMID:30465738 Vwf Rat lipopolysaccharide multiple interactions ISO Vwf (Mus musculus) 6480464 Latex promotes the reaction [Lipopolysaccharides results in increased expression of VWF protein] CTD PMID:18938192 Vwf Rat lipopolysaccharide increases expression ISO Vwf (Mus musculus) 6480464 Lipopolysaccharides results in increased expression of VWF protein CTD PMID:18938192 Vwf Rat luteolin multiple interactions EXP 6480464 Luteolin inhibits the reaction [Methamphetamine results in increased expression of VWF mRNA] CTD PMID:32035215 Vwf Rat maneb multiple interactions ISO Vwf (Mus musculus) 6480464 [Maneb co-treated with Paraquat] results in decreased expression of VWF mRNA CTD PMID:36117858 Vwf Rat mercury dibromide decreases expression ISO VWF (Homo sapiens) 6480464 mercuric bromide results in decreased expression of VWF mRNA CTD PMID:26272509 Vwf Rat mercury dibromide multiple interactions ISO VWF (Homo sapiens) 6480464 [NOG protein co-treated with mercuric bromide co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of VWF mRNA CTD PMID:27188386 Vwf Rat methamphetamine multiple interactions EXP 6480464 Luteolin inhibits the reaction [Methamphetamine results in increased expression of VWF mRNA] CTD PMID:32035215 Vwf Rat methamphetamine increases expression EXP 6480464 Methamphetamine results in increased expression of VWF mRNA CTD PMID:32035215 Vwf Rat methapyrilene decreases methylation ISO VWF (Homo sapiens) 6480464 Methapyrilene results in decreased methylation of VWF intron CTD PMID:30157460 Vwf Rat methimazole increases expression EXP 6480464 Methimazole results in increased expression of VWF mRNA CTD PMID:30047161 Vwf Rat methoxychlor affects methylation EXP 6480464 Methoxychlor affects the methylation of VWF gene CTD PMID:35440735 Vwf Rat methylmercury chloride affects expression EXP 6480464 methylmercuric chloride affects the expression of VWF mRNA CTD PMID:20864626 Vwf Rat methylmercury chloride decreases expression ISO VWF (Homo sapiens) 6480464 methylmercuric chloride results in decreased expression of VWF mRNA CTD PMID:28001369 Vwf Rat mifepristone multiple interactions ISO VWF (Homo sapiens) 6480464 Mifepristone inhibits the reaction [Hydrocortisone results in increased expression of VWF mRNA] CTD PMID:25763180 Vwf Rat mono(2-ethylhexyl) phthalate multiple interactions ISO Vwf (Mus musculus) 6480464 [mono-(2-ethylhexyl)phthalate co-treated with Tretinoin] results in decreased expression of VWF mRNA CTD PMID:36189433 Vwf Rat N(gamma)-nitro-L-arginine methyl ester multiple interactions ISO VWF (Homo sapiens) 6480464 [NG-Nitroarginine Methyl Ester co-treated with TNF protein] results in increased secretion of VWF protein CTD PMID:34678311 Vwf Rat N-benzyloxycarbonyl-L-leucyl-L-leucyl-L-leucinal decreases expression ISO Vwf (Mus musculus) 6480464 benzyloxycarbonylleucyl-leucyl-leucine aldehyde results in decreased expression of VWF mRNA CTD PMID:25566086 Vwf Rat N-nitrosodiethylamine multiple interactions EXP 6480464 [Diethylnitrosamine co-treated with beta-Naphthoflavone] results in increased expression of VWF mRNA and [Diethylnitrosamine co-treated with caffeic acid phenethyl ester] results in decreased expression of VWF mRNA CTD PMID:18164116 and PMID:20360939 Vwf Rat nicotine decreases expression ISO Vwf (Mus musculus) 6480464 Nicotine results in decreased expression of VWF mRNA CTD PMID:17456735 Vwf Rat nicotine increases expression ISO VWF (Homo sapiens) 6480464 Nicotine results in increased expression of VWF mRNA CTD PMID:11166759 Vwf Rat nitrates multiple interactions ISO Vwf (Mus musculus) 6480464 [Particulate Matter results in increased abundance of Nitrates] which results in increased expression of VWF mRNA CTD PMID:35964746 Vwf Rat Nor-9-carboxy-delta9-THC multiple interactions ISO VWF (Homo sapiens) 6480464 [Cannabinoids results in increased abundance of 11-nor-delta(9)-tetrahydrocannabinol-9-carboxylic acid] which affects the methylation of VWF gene CTD PMID:30521419 Vwf Rat ozone increases expression EXP 6480464 Ozone results in increased expression of VWF mRNA CTD PMID:20980218 Vwf Rat ozone multiple interactions ISO Vwf (Mus musculus) 6480464 [Air Pollutants results in increased abundance of Ozone] which results in decreased expression of VWF mRNA CTD PMID:34911549 Vwf Rat p-menthan-3-ol multiple interactions EXP 6480464 [Tobacco Smoke Pollution co-treated with Menthol] results in increased expression of and results in increased secretion of VWF protein CTD PMID:27818348 Vwf Rat paracetamol affects expression ISO Vwf (Mus musculus) 6480464 Acetaminophen affects the expression of VWF mRNA CTD PMID:17562736 Vwf Rat paracetamol decreases expression EXP 6480464 Acetaminophen results in decreased expression of VWF mRNA CTD PMID:33387578 Vwf Rat paracetamol increases expression ISO VWF (Homo sapiens) 6480464 Acetaminophen results in increased expression of VWF protein CTD PMID:12654133 Vwf Rat paraquat multiple interactions ISO Vwf (Mus musculus) 6480464 [Maneb co-treated with Paraquat] results in decreased expression of VWF mRNA CTD PMID:36117858 Vwf Rat paricalcitol decreases expression ISO Vwf (Mus musculus) 6480464 paricalcitol results in decreased expression of VWF mRNA CTD PMID:25037058 Vwf Rat perfluorooctane-1-sulfonic acid affects expression ISO Vwf (Mus musculus) 6480464 perfluorooctane sulfonic acid affects the expression of VWF mRNA CTD PMID:19429403 Vwf Rat perfluorooctanoic acid affects expression ISO Vwf (Mus musculus) 6480464 perfluorooctanoic acid affects the expression of VWF mRNA CTD PMID:19429403 Vwf Rat perindopril decreases expression ISO VWF (Homo sapiens) 6480464 Perindopril results in decreased expression of VWF protein CTD PMID:12224817 Vwf Rat phenethyl caffeate multiple interactions EXP 6480464 [Diethylnitrosamine co-treated with caffeic acid phenethyl ester] results in decreased expression of VWF mRNA CTD PMID:20360939 Vwf Rat phenylmercury acetate decreases expression ISO VWF (Homo sapiens) 6480464 Phenylmercuric Acetate results in decreased expression of VWF mRNA CTD PMID:26272509 Vwf Rat phenylmercury acetate multiple interactions ISO VWF (Homo sapiens) 6480464 [NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of VWF mRNA CTD PMID:27188386 Vwf Rat phytoestrogen increases expression ISO VWF (Homo sapiens) 6480464 Phytoestrogens results in increased expression of VWF mRNA CTD PMID:16019205 Vwf Rat picoxystrobin decreases expression ISO VWF (Homo sapiens) 6480464 picoxystrobin results in decreased expression of VWF mRNA CTD PMID:33512557 Vwf Rat pregnenolone 16alpha-carbonitrile increases expression EXP 6480464 Pregnenolone Carbonitrile results in increased expression of VWF mRNA CTD PMID:30047161 Vwf Rat progesterone multiple interactions ISO VWF (Homo sapiens) 6480464 [Progesterone co-treated with Estradiol] results in increased expression of VWF mRNA CTD PMID:18692832 Vwf Rat rac-lactic acid decreases expression ISO VWF (Homo sapiens) 6480464 Lactic Acid results in decreased expression of VWF mRNA CTD PMID:30851411 Vwf Rat raloxifene increases expression ISO VWF (Homo sapiens) 6480464 Raloxifene Hydrochloride results in increased expression of VWF protein CTD PMID:15850603 Vwf Rat resveratrol multiple interactions EXP 6480464 resveratrol inhibits the reaction [[Cholesterol co-treated with Ergosterol] results in increased expression of and results in increased secretion of VWF protein] CTD PMID:25833014 Vwf Rat SB 431542 multiple interactions ISO VWF (Homo sapiens) 6480464 [NOG protein co-treated with mercuric bromide co-treated with dorsomorphin co-treated with 4-(5-benzo(1 more ... CTD PMID:27188386 Vwf Rat serpentine asbestos decreases expression ISO VWF (Homo sapiens) 6480464 Asbestos and Serpentine results in decreased expression of VWF mRNA CTD PMID:21148743 Vwf Rat silicon atom multiple interactions ISO Vwf (Mus musculus) 6480464 [Silicon Dioxide results in increased abundance of Silicon] which results in decreased expression of VWF mRNA CTD PMID:39353502 Vwf Rat silicon dioxide increases expression ISO VWF (Homo sapiens) 6480464 Silicon Dioxide results in increased expression of VWF protein CTD PMID:29658397 Vwf Rat silicon dioxide multiple interactions ISO Vwf (Mus musculus) 6480464 [Silicon Dioxide results in increased abundance of Silicon] which results in decreased expression of VWF mRNA CTD PMID:39353502 Vwf Rat silicon dioxide increases expression ISO Vwf (Mus musculus) 6480464 Silicon Dioxide results in increased expression of VWF mRNA CTD PMID:29203145 Vwf Rat simvastatin increases expression EXP 6480464 Simvastatin results in increased expression of VWF mRNA and Simvastatin results in increased expression of VWF protein CTD PMID:19109527 Vwf Rat sodium arsenate multiple interactions ISO VWF (Homo sapiens) 6480464 [sodium arsenate results in increased abundance of Arsenic] which results in decreased expression of VWF mRNA CTD PMID:32525701 Vwf Rat sodium arsenate decreases expression ISO Vwf (Mus musculus) 6480464 sodium arsenate results in decreased expression of VWF mRNA CTD PMID:21795629 Vwf Rat sodium arsenite increases expression ISO VWF (Homo sapiens) 6480464 sodium arsenite results in increased expression of VWF mRNA and sodium arsenite results in increased expression of VWF protein CTD PMID:12703962 more ... Vwf Rat sodium arsenite increases expression ISO Vwf (Mus musculus) 6480464 sodium arsenite results in increased expression of VWF protein CTD PMID:29044176 Vwf Rat sophoraflavanone B increases expression ISO VWF (Homo sapiens) 6480464 8-prenylnaringenin results in increased expression of VWF mRNA CTD PMID:16019205 Vwf Rat succimer multiple interactions ISO Vwf (Mus musculus) 6480464 [Succimer co-treated with Magnetite Nanoparticles] results in increased expression of VWF mRNA CTD PMID:26378955 Vwf Rat tamoxifen increases expression ISO VWF (Homo sapiens) 6480464 Tamoxifen results in increased expression of VWF protein CTD PMID:15850603 and PMID:9236565 Vwf Rat tetrachloromethane increases expression ISO Vwf (Mus musculus) 6480464 Carbon Tetrachloride results in increased expression of VWF protein CTD PMID:14716496 more ... Vwf Rat tetrachloromethane multiple interactions EXP 6480464 Curcumin inhibits the reaction [Carbon Tetrachloride results in increased expression of VWF mRNA] and Curcumin inhibits the reaction [Carbon Tetrachloride results in increased expression of VWF protein] CTD PMID:23845850 Vwf Rat tetrachloromethane increases expression EXP 6480464 Carbon Tetrachloride results in increased expression of VWF mRNA and Carbon Tetrachloride results in increased expression of VWF protein CTD PMID:23845850 Vwf Rat tetrachloromethane multiple interactions ISO Vwf (Mus musculus) 6480464 [Carbon Tetrachloride co-treated with Ethanol] results in increased expression of VWF mRNA more ... CTD PMID:14716496 more ... Vwf Rat toluene increases expression EXP 6480464 Toluene results in increased expression of VWF mRNA CTD PMID:22967744 Vwf Rat tremolite asbestos increases expression ISO Vwf (Mus musculus) 6480464 tremolite results in increased expression of VWF mRNA CTD PMID:29279043 Vwf Rat triadimefon decreases expression EXP 6480464 triadimefon results in decreased expression of VWF mRNA and triadimefon results in decreased expression of VWF protein CTD PMID:36179991 Vwf Rat trichloroethene decreases expression EXP 6480464 Trichloroethylene results in decreased expression of VWF mRNA CTD PMID:17905399 Vwf Rat trichloroethene increases expression EXP 6480464 Trichloroethylene results in increased expression of VWF mRNA CTD PMID:33387578 Vwf Rat triclosan increases expression ISO VWF (Homo sapiens) 6480464 Triclosan results in increased expression of VWF mRNA CTD PMID:34681664 Vwf Rat triphenyl phosphate affects expression ISO VWF (Homo sapiens) 6480464 triphenyl phosphate affects the expression of VWF mRNA CTD PMID:37042841 Vwf Rat triptonide increases expression ISO Vwf (Mus musculus) 6480464 triptonide results in increased expression of VWF mRNA CTD PMID:33045310 Vwf Rat valproic acid decreases expression ISO VWF (Homo sapiens) 6480464 Valproic Acid results in decreased expression of VWF mRNA CTD PMID:23179753 Vwf Rat vincaleukoblastine increases expression EXP 6480464 Vinblastine results in increased expression of VWF mRNA CTD PMID:20624997 Vwf Rat vincristine increases expression EXP 6480464 Vincristine results in increased expression of VWF mRNA CTD PMID:20624997 Vwf Rat vitamin E increases expression ISO VWF (Homo sapiens) 6480464 Vitamin E results in increased expression of VWF mRNA CTD PMID:19244175 Vwf Rat xanthohumol increases expression ISO VWF (Homo sapiens) 6480464 xanthohumol results in increased expression of VWF mRNA CTD PMID:16019205 Vwf Rat zoledronic acid increases expression ISO VWF (Homo sapiens) 6480464 zoledronic acid results in increased expression of VWF mRNA CTD PMID:24714768
Imported Annotations - KEGG (archival)
(+)-dexrazoxane (ISO) (S)-nicotine (ISO) 1,1-bis(2-aminoethyl)-2-hydroxy-3-oxotriazane (ISO) 1,2-dimethylhydrazine (ISO) 1-naphthyl isothiocyanate (ISO) 17alpha-ethynylestradiol (EXP,ISO) 17beta-estradiol (ISO) 2,3,7,8-tetrachlorodibenzodioxine (EXP) 2,4,6-tribromophenol (ISO) 2,4,6-trinitrobenzenesulfonic acid (ISO) 2,4-dibromophenyl 2,4,5-tribromophenyl ether (ISO) 2-hydroxypropanoic acid (ISO) 3,3',5,5'-tetrabromobisphenol A (ISO) 3-methylcholanthrene (ISO) 4,4'-diaminodiphenylmethane (ISO) 4,4'-sulfonyldiphenol (ISO) 5-aza-2'-deoxycytidine (ISO) 6-propyl-2-thiouracil (EXP) 6alpha-methylprednisolone (ISO) 7,12-dimethyltetraphene (EXP) acrolein (ISO) aflatoxin B1 (EXP,ISO) Aflatoxin B2 alpha (ISO) aldehydo-D-glucose (ISO) alendronic acid (ISO) all-trans-retinoic acid (ISO) amitrole (EXP) ammonium chloride (EXP) arsane (ISO) arsenic atom (ISO) arsenous acid (ISO) atorvastatin calcium (ISO) benzene (EXP,ISO) benzo[a]pyrene (ISO) benzo[b]fluoranthene (ISO) benzo[e]pyrene (ISO) beta-naphthoflavone (EXP) bilirubin IXalpha (ISO) bis(2-chloroethyl) sulfide (EXP) bisphenol A (EXP,ISO) bisphenol F (ISO) bleomycin A2 (ISO) cadmium atom (ISO) cadmium dichloride (ISO) calcitriol (ISO) cannabidiol (ISO) cantharidin (ISO) carbon atom (ISO) carbon nanotube (ISO) CGP 52608 (ISO) cholesterol (EXP) cisplatin (ISO) cocaine (ISO) copper atom (EXP) copper(0) (EXP) cortisol (ISO) cumene (ISO) Cuprizon (EXP) curcumin (EXP) Curcumol (ISO) D-glucose (ISO) desmopressin (ISO) diarsenic trioxide (ISO) dibenz[a,h]anthracene (ISO) Dibutyl phosphate (ISO) dibutyl phthalate (EXP) dioxygen (ISO) dorsomorphin (ISO) doxorubicin (ISO) elemental carbon (ISO) enalapril (ISO) ergosterol (EXP) ethanol (ISO) fenoldopam (EXP) fenvalerate (EXP) folic acid (ISO) gemcitabine (ISO) genistein (ISO) gentamycin (EXP) gestodene (ISO) glucose (ISO) graphite (EXP) indole-3-methanol (EXP) indometacin (ISO) isoprenaline (ISO) L-methionine (ISO) Lasiocarpine (ISO) lipopolysaccharide (ISO) luteolin (EXP) maneb (ISO) mercury dibromide (ISO) methamphetamine (EXP) methapyrilene (ISO) methimazole (EXP) methoxychlor (EXP) methylmercury chloride (EXP,ISO) mifepristone (ISO) mono(2-ethylhexyl) phthalate (ISO) N(gamma)-nitro-L-arginine methyl ester (ISO) N-benzyloxycarbonyl-L-leucyl-L-leucyl-L-leucinal (ISO) N-nitrosodiethylamine (EXP) nicotine (ISO) nitrates (ISO) Nor-9-carboxy-delta9-THC (ISO) ozone (EXP,ISO) p-menthan-3-ol (EXP) paracetamol (EXP,ISO) paraquat (ISO) paricalcitol (ISO) perfluorooctane-1-sulfonic acid (ISO) perfluorooctanoic acid (ISO) perindopril (ISO) phenethyl caffeate (EXP) phenylmercury acetate (ISO) phytoestrogen (ISO) picoxystrobin (ISO) pregnenolone 16alpha-carbonitrile (EXP) progesterone (ISO) rac-lactic acid (ISO) raloxifene (ISO) resveratrol (EXP) SB 431542 (ISO) serpentine asbestos (ISO) silicon atom (ISO) silicon dioxide (ISO) simvastatin (EXP) sodium arsenate (ISO) sodium arsenite (ISO) sophoraflavanone B (ISO) succimer (ISO) tamoxifen (ISO) tetrachloromethane (EXP,ISO) toluene (EXP) tremolite asbestos (ISO) triadimefon (EXP) trichloroethene (EXP) triclosan (ISO) triphenyl phosphate (ISO) triptonide (ISO) valproic acid (ISO) vincaleukoblastine (EXP) vincristine (EXP) vitamin E (ISO) xanthohumol (ISO) zoledronic acid (ISO)
1.
Small bowel ischaemia-reperfusion increases plasma concentrations of oxidised proteins in rats.
Abu-Zidan FM, etal., Eur J Surg. 1999 Apr;165(4):383-9.
2.
Baseline vWF factor predicts the development of elevated pulmonary artery pressure in systemic sclerosis.
Barnes T, etal., Rheumatology (Oxford). 2012 Sep;51(9):1606-9. Epub 2012 May 16.
3.
Von Willebrand factor in plasma and in liver tissue after partial hepatectomy in the rat.
Baruch Y, etal., J Hepatol 2002 Oct;37(4):471-7.
4.
The genetic association database.
Becker KG, etal., Nat Genet. 2004 May;36(5):431-2.
5.
Fibrin polymerization is crucial for thrombin generation in platelet-rich plasma in a VWF-GPIb-dependent process, defective in Bernard-Soulier syndrome.
Beguin S, etal., J Thromb Haemost. 2004 Jan;2(1):170-6.
6.
The vascular biology of the glycoprotein Ib-IX-V complex.
Berndt MC, etal., Thromb Haemost. 2001 Jul;86(1):178-88.
7.
Von Willebrand factor antigen levels in Behcet disease.
Beyan E, etal., Am J Hematol. 2005 May;79(1):70-2.
8.
Increased deposition of von Willebrand factor in the rat heart after local ionizing irradiation.
Boerma M, etal., Strahlenther Onkol. 2004 Feb;180(2):109-16.
9.
Hypoxia and altered platelet behavior influence von Willebrand factor multimeric composition in secondary pulmonary hypertension.
Caramuru LH, etal., Clin Appl Thromb Hemost. 2003 Jul;9(3):251-8.
10.
Rosiglitazone does not improve vascular function in subjects with chronic kidney disease.
Chan DT, etal., Nephrol Dial Transplant. 2011 Nov;26(11):3543-9. doi: 10.1093/ndt/gfr049. Epub 2011 Mar 4.
11.
Variable content of von Willebrand factor mutant monomer drives the phenotypic variability in a family with von Willebrand disease.
Chen J, etal., Blood. 2015 Jul 9;126(2):262-9. doi: 10.1182/blood-2014-11-613935. Epub 2015 May 27.
12.
Effect of abdominal obesity on prothrombotic tendency in type 2 diabetes. Behavior of clotting factors VII and VIII, fibrinogen and von Willebrand Factor.
Coca M, etal., Rom J Intern Med. 2005;43(1-2):115-26.
13.
Oxidation of Met1606 in von Willebrand factor is a risk factor for thrombotic and septic complications in chronic renal failure.
De Filippis V, etal., Biochem J. 2012 Mar 1;442(2):423-32. doi: 10.1042/BJ20111798.
14.
Dominant type 1 von Willebrand disease caused by mutated cysteine residues in the D3 domain of von Willebrand factor.
Eikenboom JC, etal., Blood. 1996 Oct 1;88(7):2433-41.
15.
Small intestinal production of nitric oxide is decreased following resuscitated hemorrhage.
Fruchterman TM, etal., J Surg Res. 1998 Nov;80(1):102-9.
16.
Circulating thrombomodulin and hematological alterations in type 2 diabetic patients with retinopathy.
Fujiwara Y, etal., J Atheroscler Thromb. 1998;5(1):21-8.
17.
Long Non-coding RNA MALAT1/microRNA-143/VEGFA Signal Axis Modulates Vascular Endothelial Injury-Induced Intracranial Aneurysm.
Gao G, etal., Nanoscale Res Lett. 2020 Jun 29;15(1):139. doi: 10.1186/s11671-020-03357-2.
18.
Effects of Radix et Rhizoma Rhodiolae Kirilowii on expressions of von Willebrand factor, hypoxia-inducible factor 1 and vascular endothelial growth factor in myocardium of rats with acute myocardial infarction.
Gao XF, etal., Zhong Xi Yi Jie He Xue Bao. 2009 May;7(5):434-40. doi: 10.3736/jcim20090507.
19.
Phylogenetic-based propagation of functional annotations within the Gene Ontology consortium.
Gaudet P, etal., Brief Bioinform. 2011 Sep;12(5):449-62. doi: 10.1093/bib/bbr042. Epub 2011 Aug 27.
20.
Hemostatic efficacy, safety, and pharmacokinetics of a recombinant von Willebrand factor in severe von Willebrand disease.
Gill JC, etal., Blood. 2015 Oct 22;126(17):2038-46. doi: 10.1182/blood-2015-02-629873. Epub 2015 Aug 3.
21.
Mechanisms of severe acute respiratory syndrome coronavirus-induced acute lung injury.
Gralinski LE, etal., mBio. 2013 Aug 6;4(4). pii: mBio.00271-13. doi: 10.1128/mBio.00271-13.
22.
Impact of alpha-tocopherol and vitamin C on endothelial markers in rats with streptozotocin-induced diabetes.
Haidara MA, etal., Med Sci Monit. 2004 Feb;10(2):BR41-6.
23.
Neurovascular protection conferred by 2-BFI treatment during rat cerebral ischemia.
Han Z, etal., Biochem Biophys Res Commun. 2012 Aug 3;424(3):544-8. doi: 10.1016/j.bbrc.2012.06.152. Epub 2012 Jul 6.
24.
Type 2M vWD resulting from a lysine deletion within a four lysine residue repeat in the A1 loop of von Willebrand factor.
Hilbert L, etal., Thromb Haemost. 2000 Aug;84(2):188-94.
25.
Similar immune profile in bipolar disorder and schizophrenia: selective increase in soluble tumor necrosis factor receptor I and von Willebrand factor.
Hope S, etal., Bipolar Disord. 2009 Nov;11(7):726-34. doi: 10.1111/j.1399-5618.2009.00757.x.
26.
Hypothermia-induced activation of the splenic platelet pool as a risk factor for thrombotic disease in a mouse model.
Horioka K, etal., J Thromb Haemost. 2019 Oct;17(10):1762-1771. doi: 10.1111/jth.14555. Epub 2019 Jul 17.
27.
Molecular evolution of the nuclear von Willebrand factor gene in mammals and the phylogeny of rodents.
Huchon D, etal., Mol Biol Evol 1999 May;16(5):577-89.
28.
Elevated Von Willebrand factor propeptide for the diagnosis of thrombotic microangiopathy and for predicting a poor outcome.
Ito-Habe N, etal., Int J Hematol. 2011 Jan;93(1):47-52. doi: 10.1007/s12185-010-0732-4. Epub 2010 Dec 9.
29.
Stress-induced rise in endothelaemia, von Willebrand factor and hypothalamic-pituitary-adrenocortical axis activation is reduced by pretreatment with pentoxifylline.
Jezova D, etal., J Physiol Pharmacol. 2003 Sep;54(3):329-38.
30.
A randomised pilot trial of the anti-von Willebrand factor aptamer ARC1779 in patients with type 2b von Willebrand disease.
Jilma B, etal., Thromb Haemost. 2010 Sep;104(3):563-70. doi: 10.1160/TH10-01-0027. Epub 2010 Jun 29.
31.
Endothelial haemostatic markers in members of families with familial combined hyperlipidemia.
Karásek D, etal., Thromb Res. 2009;123(3):466-75. doi: 10.1016/j.thromres.2008.02.011. Epub 2008 Apr 16.
32.
Distribution of von Willebrand factor in capillary endothelial cells of rat lungs with pulmonary fibrosis.
Kasper M, etal., Exp Toxicol Pathol. 1996 Jun;48(4):283-8.
33.
Expression of von Willebrand factor in normal and diseased rat livers and in cultivated liver cells.
Knittel T, etal., Hepatology. 1995 Feb;21(2):470-6.
34.
An association of candidate gene haplotypes and bleeding severity in von Willebrand disease (VWD) type 1 pedigrees.
Kunicki TJ, etal., Blood. 2004 Oct 15;104(8):2359-67. Epub 2004 Jun 29.
35.
An association of candidate gene haplotypes and bleeding severity in von Willebrand disease type 2A, 2B, and 2M pedigrees.
Kunicki TJ, etal., J Thromb Haemost. 2006 Jan;4(1):137-47.
36.
Qualitative and quantitative modifications of von Willebrand factor in patients with essential thrombocythemia and controlled platelet count.
Lancellotti S, etal., J Thromb Haemost. 2015 Jul;13(7):1226-37. doi: 10.1111/jth.12967. Epub 2015 May 22.
37.
Anticoagulatory, antiinflammatory, and antioxidative effects of protocatechuic acid in diabetic mice.
Lin CY, etal., J Agric Food Chem. 2009 Aug 12;57(15):6661-7. doi: 10.1021/jf9015202.
38.
Total plasmatic homocysteine and von Willebrand factor in experimental diabetes mellitus.
Lopes RD, etal., Arq Bras Cardiol. 2007 Apr;88(4):424-9.
39.
Type 2M:Milwaukee-1 von Willebrand disease: an in-frame deletion in the Cys509-Cys695 loop of the von Willebrand factor A1 domain causes deficient binding of von Willebrand factor to platelets.
Mancuso DJ, etal., Blood. 1996 Oct 1;88(7):2559-68.
40.
Characterization of partial gene deletions in type III von Willebrand disease with alloantibody inhibitors.
Mancuso DJ, etal., Thromb Haemost. 1994 Aug;72(2):180-5.
41.
Diffuse and persistent blood-spinal cord barrier disruption after contusive spinal cord injury rapidly recovers following intravenous infusion of bone marrow mesenchymal stem cells.
Matsushita T, etal., Exp Neurol. 2015 May;267:152-64. doi: 10.1016/j.expneurol.2015.03.001. Epub 2015 Mar 12.
42.
Is visceral adipose tissue a determinant of von Willebrand factor in overweight and obese premenopausal women?
Mertens I, etal., Metabolism. 2006 May;55(5):650-5.
43.
Rat ISS GO annotations from MGI mouse gene data--August 2006
MGD data from the GO Consortium
44.
von Willebrand factor, ADAMTS-13, and thrombotic thrombocytopenic purpura.
Moake JL Semin Hematol. 2004 Jan;41(1):4-14.
45.
Electronic Transfer of LocusLink and RefSeq Data
NCBI rat LocusLink and RefSeq merged data July 26, 2002
46.
OMIM Disease Annotation Pipeline
OMIM Disease Annotation Pipeline
47.
Kynurenine pathway - a new link between endothelial dysfunction and carotid atherosclerosis in chronic kidney disease patients.
Pawlak K, etal., Adv Med Sci. 2010;55(2):196-203. doi: 10.2478/v10039-010-0015-6.
48.
Plasma concentration of von Willebrand factor predicts mortality in patients on chronic renal replacement therapy.
Pequeriaux NC, etal., Nephrol Dial Transplant. 2012 Jun;27(6):2452-7. doi: 10.1093/ndt/gfr735. Epub 2011 Dec 20.
49.
Caplacizumab for Acquired Thrombotic Thrombocytopenic Purpura.
Peyvandi F, etal., N Engl J Med. 2016 Feb 11;374(6):511-22. doi: 10.1056/NEJMoa1505533.
50.
KEGG Annotation Import Pipeline
Pipeline to import KEGG annotations from KEGG into RGD
51.
Mutation and ADAMTS13-dependent modulation of disease severity in a mouse model for von Willebrand disease type 2B.
Rayes J, etal., Blood. 2010 Jun 10;115(23):4870-7. doi: 10.1182/blood-2009-11-254193. Epub 2010 Mar 3.
52.
Injury induces increase of von Willebrand factor in rat endothelial cells.
Reidy MA, etal., Am J Pathol. 1989 Apr;134(4):857-64.
53.
GOA pipeline
RGD automated data pipeline
54.
ClinVar Automated Import and Annotation Pipeline
RGD automated import pipeline for ClinVar variants, variant-to-disease annotations and gene-to-disease annotations
55.
Data Import for Chemical-Gene Interactions
RGD automated import pipeline for gene-chemical interactions
56.
Comprehensive gene review and curation
RGD comprehensive gene curation
57.
Aortic endothelial cell von Willebrand factor content, and circulating plasminogen activator inhibitor-1 are increased, but expression of endothelial leukocyte adhesion molecules is unchanged in insulin-dependent diabetic BB rats.
Ribau JC, etal., Atherosclerosis. 2000 Apr;149(2):331-42.
58.
Plasma von Willebrand factor levels are an independent risk factor for adverse events including mortality and major bleeding in anticoagulated atrial fibrillation patients.
Roldan V, etal., J Am Coll Cardiol. 2011 Jun 21;57(25):2496-504. doi: 10.1016/j.jacc.2010.12.033. Epub 2011 Apr 14.
59.
Characterization of cytomegalovirus disease in solid organ transplant recipients by markers of inflammation in plasma.
Rollag H, etal., PLoS One. 2013 Apr 8;8(4):e60767. doi: 10.1371/journal.pone.0060767. Print 2013.
60.
Increased levels of endothelial haemostatic markers in patients with coronary heart disease.
Schumacher A, etal., Thromb Res. 2002 Jan 1;105(1):25-31.
61.
[Effect of the recombinant staphylokinase on pancreatic ischemia in severe acute pancreatitis of rats].
Sha JP, etal., Zhongguo Wei Zhong Bing Ji Jiu Yi Xue. 2007 Aug;19(8):467-70.
62.
The important role of von Willebrand factor in platelet-derived FVIII gene therapy for murine hemophilia A in the presence of inhibitory antibodies.
Shi Q, etal., J Thromb Haemost. 2015 Jul;13(7):1301-9. doi: 10.1111/jth.13001. Epub 2015 Jun 11.
63.
Changes in coagulation and fibrinolysis of post-SARS osteonecrosis in a Chinese population.
Sun W, etal., Int Orthop. 2006 Jun;30(3):143-6. doi: 10.1007/s00264-005-0067-6. Epub 2006 Mar 18.
64.
Zhejiang da xue xue bao. Yi xue ban = Journal of Zhejiang University. Medical sciences
Sun YX, etal., Zhejiang Da Xue Xue Bao Yi Xue Ban. 2006 May;35(3):315-8.
65.
Injury of the renal microvascular endothelium alters barrier function after ischemia.
Sutton TA, etal., Am J Physiol Renal Physiol. 2003 Aug;285(2):F191-8. Epub 2003 Apr 8.
66.
Platelet adherence to isolated rat hepatic sinusoidal endothelial cells after cold preservation.
Upadhya GA and Strasberg SM, Transplantation. 2002 Jun 15;73(11):1764-70.
67.
Sunitinib-induced changes in circulating endothelial cell-related proteins in patients with metastatic renal cell cancer.
van der Veldt AA, etal., Int J Cancer. 2012 Aug 15;131(4):E484-93. doi: 10.1002/ijc.26456. Epub 2011 Nov 8.
68.
Expression of the molecule detectable by anti-propolypeptide of von Willebrand factor antibody in rat mesangial cells in anti-Thy 1.1 mAb 1-22-3 induced glomerulonephritis: A marker of injured mesangial cells.
Wakasugi M, etal., Nephron. 1999;82(4):338-47.
69.
The differential involvement of von Willebrand factor, fibrinogen and fibronectin in acute experimental thrombosis in rat cerebral and mesenteric microvessels.
Yamamoto J, etal., Jpn J Physiol. 1997 Oct;47(5):431-41.
70.
Adjuvant effect of antibodies against von Willebrand Factor, fibrinogen, and fibronectin on staphylokinase-induced thrombolysis as measured using mural thrombi formed in rat mesenteric venules.
Yamamoto J, etal., Thromb Res. 2000 Mar 1;97(5):327-33.
71.
Biomarkers of endothelial dysfunction in patients with primary focal segmental glomerulosclerosis.
Zhang Q, etal., Nephrology (Carlton). 2012 May;17(4):338-45. doi: 10.1111/j.1440-1797.2012.01575.x.
72.
[Study on changes of blood coagulation factors in rats with hemorrhagic shock].
Zhang YJ, etal., Zhongguo Shi Yan Xue Ye Xue Za Zhi. 2005 Feb;13(1):110-3.
73.
Integrated Analysis of Multiple Microarray Studies to Identify Core Gene-Expression Signatures Involved in Tubulointerstitial Injury in Diabetic Nephropathy.
Zhou H, etal., Biomed Res Int. 2022 May 10;2022:9554658. doi: 10.1155/2022/9554658. eCollection 2022.
Vwf Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 4 160,042,900 - 160,177,757 (+) NCBI GRCr8 mRatBN7.2 4 158,360,152 - 158,491,539 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 4 158,360,152 - 158,491,539 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 4 164,595,998 - 164,727,404 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 4 160,378,929 - 160,510,343 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 4 159,012,985 - 159,144,157 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 4 158,085,059 - 158,219,525 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 4 158,088,505 - 158,219,523 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 4 225,098,521 - 225,229,257 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 4 161,723,415 - 161,854,766 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 4 162,053,065 - 162,055,090 (+) NCBI Celera 4 147,092,791 - 147,223,711 (+) NCBI Celera Cytogenetic Map 4 q42 NCBI
VWF Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 12 5,948,877 - 6,124,670 (-) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 12 5,948,877 - 6,124,770 (-) Ensembl GRCh38 hg38 GRCh38 GRCh37 12 6,058,043 - 6,233,836 (-) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 12 5,928,301 - 6,104,097 (-) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 12 5,928,307 - 6,104,097 NCBI Celera 12 7,677,686 - 7,853,476 (-) NCBI Celera Cytogenetic Map 12 p13.31 NCBI HuRef 12 5,910,003 - 6,085,514 (-) NCBI HuRef CHM1_1 12 6,057,433 - 6,233,298 (-) NCBI CHM1_1 T2T-CHM13v2.0 12 5,956,421 - 6,132,275 (-) NCBI T2T-CHM13v2.0
Vwf Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 6 125,529,911 - 125,663,642 (+) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 6 125,523,737 - 125,663,642 (+) Ensembl GRCm39 Ensembl GRCm38 6 125,552,948 - 125,686,679 (+) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 6 125,546,774 - 125,686,679 (+) Ensembl GRCm38 mm10 GRCm38 MGSCv37 6 125,502,981 - 125,636,695 (+) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 6 125,520,072 - 125,652,161 (+) NCBI MGSCv36 mm8 Celera 6 127,212,807 - 127,346,911 (+) NCBI Celera Cytogenetic Map 6 F3 NCBI cM Map 6 59.32 NCBI
Vwf Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955413 3,672,470 - 3,819,571 (-) Ensembl ChiLan1.0 ChiLan1.0 NW_004955413 3,672,470 - 3,825,588 (-) NCBI ChiLan1.0 ChiLan1.0
VWF Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 10 11,504,401 - 11,680,404 (-) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 12 11,501,159 - 11,677,162 (-) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 12 6,073,836 - 6,249,806 (-) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 12 5,990,612 - 6,166,632 (-) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 12 5,990,612 - 6,165,153 (-) Ensembl panpan1.1 panPan2
VWF Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 27 38,834,812 - 38,972,614 (+) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 27 38,833,837 - 39,320,142 (+) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 27 7,641,828 - 7,779,174 (-) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 27 39,191,850 - 39,329,540 (+) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 27 39,193,140 - 39,329,536 (+) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 27 39,062,625 - 39,200,071 (+) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 27 39,104,190 - 39,241,989 (+) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 27 7,119,622 - 7,257,688 (-) NCBI UU_Cfam_GSD_1.0
Vwf Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024404945 102,910,587 - 103,074,328 (+) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936709 1,579,096 - 1,741,754 (+) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936709 1,578,137 - 1,741,877 (+) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
VWF Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 5 64,517,555 - 64,655,938 (+) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 5 64,516,627 - 64,655,938 (+) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 5 66,999,793 - 67,078,133 (+) NCBI Sscrofa10.2 Sscrofa10.2 susScr3 Pig Cytomap 5 q21 NCBI
VWF Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 11 5,994,499 - 6,176,949 (-) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 11 5,994,039 - 6,162,260 (-) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666063 2,072,116 - 2,236,240 (+) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Vwf
.
Predicted Target Of
Count of predictions: 61 Count of miRNA genes: 56 Interacting mature miRNAs: 60 Transcripts: ENSRNOT00000026643 Prediction methods: Miranda, Rnahybrid, Targetscan Result types: miRGate_prediction
6478754 Anxrr43 Anxiety related response QTL 43 0.14035 locomotor behavior trait (VT:0001392) distance moved per unit of time into, out of or within a discrete space in an experimental apparatus (CMO:0001493) 4 144639524 182687754 Rat 724558 Plsm2 Polydactyly-luxate syndrome (PLS) morphotypes QTL 2 0.0003 hindlimb integrity trait (VT:0010563) hind foot phalanges count (CMO:0001949) 4 132422778 177422778 Rat 1582237 Kidm34 Kidney mass QTL 34 4 0.0001 kidney mass (VT:0002707) both kidneys wet weight to body weight ratio (CMO:0000340) 4 148090542 168069246 Rat 6478693 Anxrr32 Anxiety related response QTL 32 0.00092 locomotor behavior trait (VT:0001392) measurement of voluntary locomotion into, out of or within a discrete space in an experimental apparatus (CMO:0000957) 4 144639524 182687754 Rat 10755501 Bp390 Blood pressure QTL 390 2.5 arterial blood pressure trait (VT:2000000) diastolic blood pressure (CMO:0000005) 4 26775591 168368347 Rat 631683 Bp116 Blood pressure QTL 116 0.0001 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 4 124303370 169303370 Rat 61451 Ciaa4 CIA Autoantibody QTL 4 3.1 blood autoantibody amount (VT:0003725) calculated serum anti-rat type 2 collagen autoantibody titer (CMO:0001281) 4 126395976 167139601 Rat 1331738 Bp209 Blood pressure QTL 209 2.979 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 4 138503169 179293946 Rat 6478700 Anxrr33 Anxiety related response QTL 33 0.00896 locomotor behavior trait (VT:0001392) amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958) 4 144639524 182687754 Rat 1298524 Oia8 Oil induced arthritis QTL 8 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 4 138503169 173369699 Rat 10053718 Scort25 Serum corticosterone level QTL 25 2.15 0.0097 blood corticosterone amount (VT:0005345) plasma corticosterone level (CMO:0001173) 4 155561574 182687754 Rat 1549827 Scl46 Serum cholesterol level QTL 46 3.5 blood cholesterol amount (VT:0000180) serum total cholesterol level (CMO:0000363) 4 132396220 177396220 Rat 634335 Anxrr16 Anxiety related response QTL 16 7.22 locomotor behavior trait (VT:0001392) number of entries into a discrete space in an experimental apparatus (CMO:0000960) 4 93308457 167139447 Rat 737821 Hcar9 Hepatocarcinoma resistance QTL 9 3.7 liver integrity trait (VT:0010547) volume of individual liver tumorous lesion (CMO:0001078) 4 109866907 167139601 Rat 7411558 Bw133 Body weight QTL 133 13.84 0.001 body mass (VT:0001259) body weight gain (CMO:0000420) 4 125590636 170590636 Rat 6478778 Anxrr51 Anxiety related response QTL 51 0.25384 locomotor behavior trait (VT:0001392) measurement of voluntary locomotion into, out of or within a discrete space in an experimental apparatus (CMO:0000957) 4 124778595 169778595 Rat 10401796 Kidm48 Kidney mass QTL 48 kidney mass (VT:0002707) both kidneys wet weight (CMO:0000085) 4 145568712 182687754 Rat 6478718 Anxrr34 Anxiety related response QTL 34 0.00896 locomotor behavior trait (VT:0001392) amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958) 4 144639524 182687754 Rat 631511 Pia7 Pristane induced arthritis QTL 7 4.3 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 4 131730738 167139601 Rat 1581574 Eae20 Experimental allergic encephalomyelitis QTL 20 7.8 nervous system integrity trait (VT:0010566) percentage of study population developing experimental autoimmune encephalomyelitis during a period of time (CMO:0001047) 4 153031106 158841762 Rat 1300109 Rf13 Renal function QTL 13 3.91 renal blood flow trait (VT:2000006) absolute change in renal blood flow rate (CMO:0001168) 4 157710145 182687754 Rat 634347 Hcar8 Hepatocarcinoma resistance QTL 8 5.8 liver integrity trait (VT:0010547) liver tumorous lesion area to total liver area ratio (CMO:0001075) 4 123143783 168143783 Rat 1576316 Ept5 Estrogen-induced pituitary tumorigenesis QTL 5 3.8 pituitary gland mass (VT:0010496) pituitary gland wet weight (CMO:0000853) 4 83428419 177635233 Rat 2303623 Vencon2 Ventilatory control QTL 2 3.8 respiration trait (VT:0001943) minute ventilation (CMO:0000132) 4 135204660 180204660 Rat 1581566 Eae21 Experimental allergic encephalomyelitis QTL 21 6.2 body mass (VT:0001259) maximum body weight loss to initial body weight ratio (CMO:0001400) 4 157680158 158841762 Rat 1578674 Bmd12 Bone mineral density QTL 12 3.8 femur mineral mass (VT:0010011) compact volumetric bone mineral density (CMO:0001730) 4 135699135 180699135 Rat 1358202 Gluco11 Glucose level QTL 11 2.4 0.02 adipocyte glucose uptake trait (VT:0004185) absolute change in adipocyte glucose uptake (CMO:0000873) 4 85379421 167139601 Rat 61422 Cia13 Collagen induced arthritis QTL 13 4.5 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 4 132642577 167139601 Rat 634342 Cia24 Collagen induced arthritis QTL 24 4.5 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 4 146565735 175236377 Rat 737978 Pia23 Pristane induced arthritis QTL 23 5.3 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 4 131730738 167139601 Rat 61362 Oia2 Oil induced arthritis QTL 2 0.001 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 4 138503169 173369699 Rat 12798519 Anxrr54 Anxiety related response QTL 54 2.54 0.05 locomotor behavior trait (VT:0001392) distance moved per unit of time into, out of or within a discrete space in an experimental apparatus (CMO:0001493) 4 114627026 159627026 Rat 2293659 Bmd35 Bone mineral density QTL 35 4.5 0.0001 femur strength trait (VT:0010010) femoral neck ultimate force (CMO:0001703) 4 137755016 181392681 Rat 1331759 Hrtrt13 Heart rate QTL 13 3.54628 heart pumping trait (VT:2000009) heart rate (CMO:0000002) 4 110275411 168266883 Rat 724535 Cm18 Cardiac mass QTL 18 2.6 heart mass (VT:0007028) calculated heart weight (CMO:0000073) 4 118856416 163856416 Rat 2316958 Gluco58 Glucose level QTL 58 10 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 4 11320076 180699135 Rat 6478748 Anxrr42 Anxiety related response QTL 42 0.28008 locomotor behavior trait (VT:0001392) amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958) 4 144639524 182687754 Rat 12798525 Anxrr57 Anxiety related response QTL 57 3.21 0.05 locomotor behavior trait (VT:0001392) amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958) 4 147278504 167139601 Rat
D4Wox36
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 4 158,447,303 - 158,447,479 (+) MAPPER mRatBN7.2 Rnor_6.0 4 158,175,129 - 158,175,304 NCBI Rnor6.0 Rnor_5.0 4 225,185,117 - 225,185,292 UniSTS Rnor5.0 RGSC_v3.4 4 161,808,751 - 161,808,926 UniSTS RGSC3.4 Celera 4 147,179,655 - 147,179,830 UniSTS Cytogenetic Map 4 q42 UniSTS
Vwf
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 4 158,447,823 - 158,448,025 (+) MAPPER mRatBN7.2 Rnor_6.0 4 158,175,649 - 158,175,850 NCBI Rnor6.0 Rnor_5.0 4 225,185,637 - 225,185,838 UniSTS Rnor5.0 RGSC_v3.4 4 161,809,271 - 161,809,472 UniSTS RGSC3.4 Celera 4 147,180,175 - 147,180,376 UniSTS Cytogenetic Map 4 q42 UniSTS
RH132777
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 4 158,491,246 - 158,491,439 (+) MAPPER mRatBN7.2 Rnor_6.0 4 158,219,233 - 158,219,425 NCBI Rnor6.0 Rnor_5.0 4 225,228,965 - 225,229,157 UniSTS Rnor5.0 RGSC_v3.4 4 161,854,469 - 161,854,661 UniSTS RGSC3.4 Celera 4 147,223,419 - 147,223,611 UniSTS Cytogenetic Map 4 q42 UniSTS
This gene Vwf is modified in the following models/strains:
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
11
49
113
91
90
59
25
59
6
218
97
93
45
60
31
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000026643 ⟹ ENSRNOP00000026643
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 4 158,360,152 - 158,491,539 (+) Ensembl Rnor_6.0 Ensembl 4 158,088,505 - 158,219,523 (+) Ensembl
Ensembl Acc Id:
ENSRNOT00000116998 ⟹ ENSRNOP00000084421
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 4 158,394,481 - 158,491,539 (+) Ensembl
Ensembl Acc Id:
ENSRNOT00000117299 ⟹ ENSRNOP00000091836
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 4 158,361,767 - 158,491,539 (+) Ensembl
Ensembl Acc Id:
ENSRNOT00000118023 ⟹ ENSRNOP00000079544
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 4 158,381,564 - 158,491,539 (+) Ensembl
RefSeq Acc Id:
NM_053889 ⟹ NP_446341
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 160,046,369 - 160,177,757 (+) NCBI mRatBN7.2 4 158,360,152 - 158,491,539 (+) NCBI Rnor_6.0 4 158,088,533 - 158,219,525 (+) NCBI Rnor_5.0 4 225,098,521 - 225,229,257 (+) NCBI Celera 4 147,092,791 - 147,223,711 (+) NCBI
Sequence:
AACTTGAAGCTATTGCAGTGCAGAGGAATGGGCTTGGCCTCAGCTTGGGCTTGCTCTCTCTGGCTGTGACGACTTCAAAGCCCCTGGACAACTCGCCAGCCCAGAGCCTGAGCAGATCCATCCAGCAT
hide sequence
RefSeq Acc Id:
XM_063285420 ⟹ XP_063141490
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 160,042,900 - 160,177,757 (+) NCBI
RefSeq Acc Id:
NP_446341 ⟸ NM_053889
- Peptide Label:
precursor
- UniProtKB:
A0A8J8XVZ5 (UniProtKB/TrEMBL), A6ILU6 (UniProtKB/TrEMBL)
- Sequence:
MNPFGYEICLLVLALTWPGTLCTEDPRDRPSTARCSLFGDGFINTFDEAMYSFAGGCSYLLAGDCQKRSFSILGNFQDGKRVGLSVYLGEFFDIHLFANGTVMQGDQSISMPYASKGLYVEHEAGYYK
hide sequence
Ensembl Acc Id:
ENSRNOP00000026643 ⟸ ENSRNOT00000026643
Ensembl Acc Id:
ENSRNOP00000091836 ⟸ ENSRNOT00000117299
Ensembl Acc Id:
ENSRNOP00000084421 ⟸ ENSRNOT00000116998
Ensembl Acc Id:
ENSRNOP00000079544 ⟸ ENSRNOT00000118023
RefSeq Acc Id:
XP_063141490 ⟸ XM_063285420
- Peptide Label:
isoform X1
- UniProtKB:
A0A8J8XVZ5 (UniProtKB/TrEMBL), A6ILU6 (UniProtKB/TrEMBL)
RGD ID: 13693414 Promoter ID: EPDNEW_R3939 Type: single initiation site Name: Vwf_1 Description: von Willebrand factor SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Rat Assembly Chr Position (strand) Source Rnor_6.0 4 158,088,533 - 158,088,593 EPDNEW
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2010-05-25
Vwf
von Willebrand factor
Vwf
von Willebrand factor homolog
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2009-10-22
Vwf
von Willebrand factor homolog
Vwf
Von Willebrand factor homolog
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2008-05-15
Vwf
Von Willebrand factor homolog
Vwf
von Willebrand factor
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2006-03-30
Vwf
von Willebrand factor
Symbol and Name status set to approved
1299863 APPROVED
2002-08-07
Vwf
Von Willebrand factor
Symbol and Name status set to provisional
70820 PROVISIONAL
Note Type
Note
Reference
gene_expression
protein levels increase after partial hepatectomy
727737
