Symbol:
Polr2g
Name:
RNA polymerase II subunit G
RGD ID:
621284
Description:
Predicted to enable single-stranded DNA binding activity; single-stranded RNA binding activity; and translation initiation factor binding activity. Predicted to be involved in regulation of gene expression and transcription initiation at RNA polymerase II promoter. Predicted to be located in nucleoplasm. Predicted to be part of RNA polymerase II, core complex. Predicted to be active in P-body. Orthologous to human POLR2G (RNA polymerase II subunit G); PARTICIPATES IN RNA polymerase II transcription pathway; Huntington's disease pathway; purine metabolic pathway; INTERACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; 2,4-dinitrotoluene; 2,6-dinitrotoluene.
Type:
protein-coding
RefSeq Status:
PROVISIONAL
Previously known as:
DNA-directed RNA polymerase II subunit G; DNA-directed RNA polymerase II subunit RPB7; MGC72732; MGC72993; polymerase (RNA) II (DNA directed) polypeptide G; polymerase (RNA) II (DNA directed)polypeptide G; polymerase (RNA) II subunit G; RNA polymerase II subunit B7; Rpb7
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 1 215,118,278 - 215,125,389 (-) NCBI GRCr8 mRatBN7.2 1 205,689,160 - 205,692,537 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 1 205,689,160 - 205,692,686 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 1 214,097,574 - 214,100,946 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 1 221,132,707 - 221,136,084 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 1 213,825,410 - 213,828,787 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 1 224,991,250 - 224,998,355 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 1 224,991,222 - 224,994,653 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 1 231,929,423 - 231,936,528 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 1 211,462,321 - 211,465,698 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 1 211,620,752 - 211,627,860 (-) NCBI Celera 1 203,202,089 - 203,205,466 (-) NCBI Celera Cytogenetic Map 1 q43 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Polr2g Rat (+)-catechin multiple interactions ISO POLR2G (Homo sapiens) 6480464 [Catechin co-treated with Grape Seed Proanthocyanidins] results in increased expression of POLR2G mRNA CTD PMID:24763279 Polr2g Rat 1,2-dimethylhydrazine multiple interactions ISO Polr2g (Mus musculus) 6480464 [1 and 2-Dimethylhydrazine co-treated with Folic Acid] results in decreased expression of POLR2G mRNA CTD PMID:22206623 Polr2g Rat 17alpha-ethynylestradiol increases expression ISO Polr2g (Mus musculus) 6480464 Ethinyl Estradiol results in increased expression of POLR2G mRNA CTD PMID:17942748 Polr2g Rat 17alpha-ethynylestradiol multiple interactions ISO Polr2g (Mus musculus) 6480464 [Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of POLR2G mRNA CTD PMID:17942748 Polr2g Rat 17beta-estradiol decreases expression ISO Polr2g (Mus musculus) 6480464 Estradiol results in decreased expression of POLR2G mRNA CTD PMID:39298647 Polr2g Rat 2,2',4,4'-Tetrabromodiphenyl ether affects expression ISO Polr2g (Mus musculus) 6480464 2 more ... CTD PMID:30294300 Polr2g Rat 2,3,7,8-tetrachlorodibenzodioxine multiple interactions ISO Polr2g (Mus musculus) 6480464 [Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of POLR2G mRNA CTD PMID:17942748 Polr2g Rat 2,3,7,8-tetrachlorodibenzodioxine increases expression EXP 6480464 Tetrachlorodibenzodioxin results in increased expression of POLR2G mRNA CTD PMID:34747641 Polr2g Rat 2,4-dinitrotoluene affects expression EXP 6480464 2 and 4-dinitrotoluene affects the expression of POLR2G mRNA CTD PMID:21346803 Polr2g Rat 2,6-dinitrotoluene affects expression EXP 6480464 2 and 6-dinitrotoluene affects the expression of POLR2G mRNA CTD PMID:21346803 Polr2g Rat 2-hydroxypropanoic acid decreases expression ISO POLR2G (Homo sapiens) 6480464 Lactic Acid results in decreased expression of POLR2G mRNA CTD PMID:30851411 Polr2g Rat 4,4'-sulfonyldiphenol decreases expression ISO Polr2g (Mus musculus) 6480464 bisphenol S results in decreased expression of POLR2G mRNA CTD PMID:33297965 Polr2g Rat 6-propyl-2-thiouracil increases expression EXP 6480464 Propylthiouracil results in increased expression of POLR2G mRNA CTD PMID:30047161 Polr2g Rat actinomycin D multiple interactions ISO POLR2G (Homo sapiens) 6480464 [Dactinomycin co-treated with nutlin 3] results in increased secretion of POLR2G protein CTD PMID:38460933 Polr2g Rat aflatoxin B1 increases methylation ISO POLR2G (Homo sapiens) 6480464 Aflatoxin B1 results in increased methylation of POLR2G gene CTD PMID:27153756 Polr2g Rat amitrole increases expression EXP 6480464 Amitrole results in increased expression of POLR2G mRNA CTD PMID:30047161 Polr2g Rat ammonium chloride affects expression EXP 6480464 Ammonium Chloride affects the expression of POLR2G mRNA CTD PMID:16483693 Polr2g Rat arsane affects methylation ISO POLR2G (Homo sapiens) 6480464 Arsenic affects the methylation of POLR2G gene CTD PMID:25304211 Polr2g Rat arsane multiple interactions ISO POLR2G (Homo sapiens) 6480464 [sodium arsenite results in increased abundance of Arsenic] which results in decreased expression of POLR2G mRNA CTD PMID:39836092 Polr2g Rat arsenic atom affects methylation ISO POLR2G (Homo sapiens) 6480464 Arsenic affects the methylation of POLR2G gene CTD PMID:25304211 Polr2g Rat arsenic atom multiple interactions ISO POLR2G (Homo sapiens) 6480464 [sodium arsenite results in increased abundance of Arsenic] which results in decreased expression of POLR2G mRNA CTD PMID:39836092 Polr2g Rat arsenite(3-) multiple interactions ISO POLR2G (Homo sapiens) 6480464 arsenite promotes the reaction [G3BP1 protein binds to POLR2G mRNA] CTD PMID:32406909 Polr2g Rat benzo[a]pyrene increases expression ISO Polr2g (Mus musculus) 6480464 Benzo(a)pyrene results in increased expression of POLR2G mRNA CTD PMID:22228805 Polr2g Rat bis(2-ethylhexyl) phthalate increases expression ISO Polr2g (Mus musculus) 6480464 Diethylhexyl Phthalate results in increased expression of POLR2G mRNA CTD PMID:33754040 Polr2g Rat bisphenol A increases expression EXP 6480464 bisphenol A results in increased expression of POLR2G mRNA CTD PMID:25181051 Polr2g Rat cadmium dichloride increases expression ISO POLR2G (Homo sapiens) 6480464 Cadmium Chloride results in increased expression of POLR2G protein CTD PMID:38185225 Polr2g Rat chloropicrin increases expression ISO POLR2G (Homo sapiens) 6480464 chloropicrin results in increased expression of POLR2G mRNA CTD PMID:26352163 Polr2g Rat cisplatin increases expression ISO POLR2G (Homo sapiens) 6480464 Cisplatin results in increased expression of POLR2G mRNA CTD PMID:27392435 Polr2g Rat clofibrate multiple interactions ISO Polr2g (Mus musculus) 6480464 [Clofibrate co-treated with Acetaminophen] affects the expression of POLR2G mRNA and PPARA affects the reaction [[Clofibrate co-treated with Acetaminophen] affects the expression of POLR2G mRNA] CTD PMID:17585979 Polr2g Rat copper(II) sulfate decreases expression ISO POLR2G (Homo sapiens) 6480464 Copper Sulfate results in decreased expression of POLR2G mRNA CTD PMID:19549813 Polr2g Rat coumestrol increases expression ISO POLR2G (Homo sapiens) 6480464 Coumestrol results in increased expression of POLR2G mRNA CTD PMID:19167446 Polr2g Rat dicrotophos decreases expression ISO POLR2G (Homo sapiens) 6480464 dicrotophos results in decreased expression of POLR2G mRNA CTD PMID:28302478 Polr2g Rat doxorubicin decreases expression ISO POLR2G (Homo sapiens) 6480464 Doxorubicin results in decreased expression of POLR2G mRNA CTD PMID:29803840 Polr2g Rat flutamide increases expression EXP 6480464 Flutamide results in increased expression of POLR2G mRNA CTD PMID:24136188 Polr2g Rat folic acid multiple interactions ISO Polr2g (Mus musculus) 6480464 [1 and 2-Dimethylhydrazine co-treated with Folic Acid] results in decreased expression of POLR2G mRNA CTD PMID:22206623 Polr2g Rat gentamycin increases expression EXP 6480464 Gentamicins results in increased expression of POLR2G mRNA CTD PMID:22061828 Polr2g Rat N-methyl-4-phenylpyridinium increases expression ISO Polr2g (Mus musculus) 6480464 1-Methyl-4-phenylpyridinium results in increased expression of POLR2G protein CTD PMID:26558463 Polr2g Rat nimesulide increases expression EXP 6480464 nimesulide results in increased expression of POLR2G mRNA CTD PMID:24136188 Polr2g Rat Nutlin-3 multiple interactions ISO POLR2G (Homo sapiens) 6480464 [Dactinomycin co-treated with nutlin 3] results in increased secretion of POLR2G protein CTD PMID:38460933 Polr2g Rat paracetamol multiple interactions ISO Polr2g (Mus musculus) 6480464 [Clofibrate co-treated with Acetaminophen] affects the expression of POLR2G mRNA and PPARA affects the reaction [[Clofibrate co-treated with Acetaminophen] affects the expression of POLR2G mRNA] CTD PMID:17585979 Polr2g Rat paracetamol affects expression ISO Polr2g (Mus musculus) 6480464 Acetaminophen affects the expression of POLR2G mRNA CTD PMID:17562736 Polr2g Rat rac-lactic acid decreases expression ISO POLR2G (Homo sapiens) 6480464 Lactic Acid results in decreased expression of POLR2G mRNA CTD PMID:30851411 Polr2g Rat resveratrol increases expression ISO Polr2g (Mus musculus) 6480464 resveratrol results in increased expression of POLR2G mRNA CTD PMID:22610192 Polr2g Rat resveratrol multiple interactions ISO POLR2G (Homo sapiens) 6480464 [Plant Extracts co-treated with Resveratrol] results in increased expression of POLR2G mRNA CTD PMID:23557933 Polr2g Rat resveratrol decreases expression ISO Polr2g (Mus musculus) 6480464 resveratrol results in decreased expression of POLR2G protein CTD PMID:25505154 Polr2g Rat sodium arsenite multiple interactions ISO POLR2G (Homo sapiens) 6480464 [sodium arsenite results in increased abundance of Arsenic] which results in decreased expression of POLR2G mRNA CTD PMID:39836092 Polr2g Rat sulfadimethoxine increases expression EXP 6480464 Sulfadimethoxine results in increased expression of POLR2G mRNA CTD PMID:30047161 Polr2g Rat sunitinib increases expression ISO POLR2G (Homo sapiens) 6480464 Sunitinib results in increased expression of POLR2G mRNA CTD PMID:31533062 Polr2g Rat testosterone decreases expression ISO POLR2G (Homo sapiens) 6480464 Testosterone results in decreased expression of POLR2G mRNA CTD PMID:33359661 Polr2g Rat tetrachloromethane increases expression ISO Polr2g (Mus musculus) 6480464 Carbon Tetrachloride results in increased expression of POLR2G mRNA CTD PMID:31919559 Polr2g Rat thioacetamide increases expression EXP 6480464 Thioacetamide results in increased expression of POLR2G mRNA CTD PMID:34492290 Polr2g Rat tolcapone decreases expression EXP 6480464 tolcapone results in decreased expression of POLR2G mRNA CTD PMID:24136188 Polr2g Rat triphenyl phosphate affects expression ISO POLR2G (Homo sapiens) 6480464 triphenyl phosphate affects the expression of POLR2G mRNA CTD PMID:37042841 Polr2g Rat valproic acid affects expression ISO POLR2G (Homo sapiens) 6480464 Valproic Acid affects the expression of POLR2G mRNA CTD PMID:25979313
Imported Annotations - KEGG (archival)
(+)-catechin (ISO) 1,2-dimethylhydrazine (ISO) 17alpha-ethynylestradiol (ISO) 17beta-estradiol (ISO) 2,2',4,4'-Tetrabromodiphenyl ether (ISO) 2,3,7,8-tetrachlorodibenzodioxine (EXP,ISO) 2,4-dinitrotoluene (EXP) 2,6-dinitrotoluene (EXP) 2-hydroxypropanoic acid (ISO) 4,4'-sulfonyldiphenol (ISO) 6-propyl-2-thiouracil (EXP) actinomycin D (ISO) aflatoxin B1 (ISO) amitrole (EXP) ammonium chloride (EXP) arsane (ISO) arsenic atom (ISO) arsenite(3-) (ISO) benzo[a]pyrene (ISO) bis(2-ethylhexyl) phthalate (ISO) bisphenol A (EXP) cadmium dichloride (ISO) chloropicrin (ISO) cisplatin (ISO) clofibrate (ISO) copper(II) sulfate (ISO) coumestrol (ISO) dicrotophos (ISO) doxorubicin (ISO) flutamide (EXP) folic acid (ISO) gentamycin (EXP) N-methyl-4-phenylpyridinium (ISO) nimesulide (EXP) Nutlin-3 (ISO) paracetamol (ISO) rac-lactic acid (ISO) resveratrol (ISO) sodium arsenite (ISO) sulfadimethoxine (EXP) sunitinib (ISO) testosterone (ISO) tetrachloromethane (ISO) thioacetamide (EXP) tolcapone (EXP) triphenyl phosphate (ISO) valproic acid (ISO)
Polr2g Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 1 215,118,278 - 215,125,389 (-) NCBI GRCr8 mRatBN7.2 1 205,689,160 - 205,692,537 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 1 205,689,160 - 205,692,686 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 1 214,097,574 - 214,100,946 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 1 221,132,707 - 221,136,084 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 1 213,825,410 - 213,828,787 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 1 224,991,250 - 224,998,355 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 1 224,991,222 - 224,994,653 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 1 231,929,423 - 231,936,528 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 1 211,462,321 - 211,465,698 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 1 211,620,752 - 211,627,860 (-) NCBI Celera 1 203,202,089 - 203,205,466 (-) NCBI Celera Cytogenetic Map 1 q43 NCBI
POLR2G Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 11 62,761,580 - 62,766,710 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 11 62,761,565 - 62,766,710 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 11 62,529,052 - 62,534,182 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 11 62,285,591 - 62,290,757 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 11 62,285,590 - 62,290,757 NCBI Celera 11 59,857,593 - 59,862,769 (+) NCBI Celera Cytogenetic Map 11 q12.3 NCBI HuRef 11 58,857,889 - 58,863,065 (+) NCBI HuRef CHM1_1 11 62,412,016 - 62,417,192 (+) NCBI CHM1_1 T2T-CHM13v2.0 11 62,750,899 - 62,756,030 (+) NCBI T2T-CHM13v2.0
Polr2g Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 19 8,770,493 - 8,775,921 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 19 8,770,491 - 8,775,941 (-) Ensembl GRCm39 Ensembl GRCm38 19 8,793,129 - 8,798,557 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 19 8,793,127 - 8,798,577 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 19 8,867,619 - 8,873,047 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 19 8,860,174 - 8,865,602 (-) NCBI MGSCv36 mm8 Celera 19 8,553,021 - 8,558,449 (-) NCBI Celera Cytogenetic Map 19 A NCBI cM Map 19 5.62 NCBI
Polr2g Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955599 464,879 - 471,976 (-) Ensembl ChiLan1.0 ChiLan1.0 NW_004955599 469,233 - 471,761 (-) NCBI ChiLan1.0 ChiLan1.0
POLR2G Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 9 63,986,513 - 63,991,720 (+) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 11 65,029,219 - 65,034,411 (+) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 11 58,116,833 - 58,122,031 (+) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 11 61,470,866 - 61,476,073 (+) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 11 61,470,866 - 61,476,073 (+) Ensembl panpan1.1 panPan2
POLR2G Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 18 53,916,431 - 53,919,724 (-) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 18 53,916,435 - 53,919,549 (-) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 18 52,522,261 - 52,530,211 (-) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 18 54,968,916 - 54,976,918 (-) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 18 54,966,549 - 54,972,077 (-) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 18 54,065,288 - 54,073,274 (-) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 18 53,639,765 - 53,647,770 (-) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 18 54,436,033 - 54,444,050 (-) NCBI UU_Cfam_GSD_1.0
Polr2g
POLR2G Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 2 9,004,390 - 9,017,779 (-) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 2 9,004,388 - 9,008,631 (-) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 2 8,349,630 - 8,353,856 (-) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
POLR2G Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 1 11,140,897 - 11,150,879 (-) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 1 11,140,867 - 11,150,882 (-) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666038 108,483,625 - 108,488,373 (-) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Polr2g
.
Predicted Target Of
Count of predictions: 56 Count of miRNA genes: 48 Interacting mature miRNAs: 56 Transcripts: ENSRNOT00000026313 Prediction methods: Miranda, Rnahybrid, Targetscan Result types: miRGate_prediction
1578778 Pur4 Proteinuria QTL 4 3.3 0.003 urine total protein amount (VT:0000032) urine total protein excretion rate (CMO:0000756) 1 150700247 252085048 Rat 1354646 Kidm18 Kidney mass QTL 18 5.7 kidney mass (VT:0002707) calculated kidney weight (CMO:0000160) 1 151162512 256448636 Rat 1357335 Bw39 Body weight QTL 39 3.3 body mass (VT:0001259) body weight (CMO:0000012) 1 197814409 242814409 Rat 1578780 Cm52 Cardiac mass QTL 52 3.3 0.0001 heart mass (VT:0007028) heart wet weight (CMO:0000069) 1 81591954 219808434 Rat 2302375 Bw83 Body weight QTL 83 4.87 0.0002 body mass (VT:0001259) body weight (CMO:0000012) 1 197697768 242697768 Rat 1354652 Kidm20 Kidney mass QTL 20 4.3 kidney mass (VT:0002707) calculated kidney weight (CMO:0000160) 1 177227632 256448636 Rat 2293674 Bss39 Bone structure and strength QTL 39 7.1 0.0001 femur strength trait (VT:0010010) femur total energy absorbed before break (CMO:0001677) 1 201554356 246554356 Rat 2302378 Insul11 Insulin level QTL 11 3.25 blood insulin amount (VT:0001560) serum insulin level (CMO:0000358) 1 144267353 251128347 Rat 1354653 Despr9 Despair related QTL 9 0.00019 locomotor behavior trait (VT:0001392) amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958) 1 167909849 212909849 Rat 2293673 Bss27 Bone structure and strength QTL 27 18.63 0.0001 femur morphology trait (VT:0000559) femur midshaft cortical cross-sectional area (CMO:0001663) 1 171629477 216629477 Rat 2293677 Bss41 Bone structure and strength QTL 41 9.38 0.0001 lumbar vertebra size trait (VT:0010518) lumbar vertebra cross-sectional area (CMO:0001689) 1 171629477 216629477 Rat 1302787 Stl25 Serum triglyceride level QTL 25 2.7 0.0073 blood triglyceride amount (VT:0002644) plasma triglyceride level (CMO:0000548) 1 180359209 210702199 Rat 1549830 Bss1 Bone structure and strength QTL 1 4.8 femur strength trait (VT:0010010) femur ultimate force (CMO:0001675) 1 172609619 217609619 Rat 7794788 Mcs32 Mammary carcinoma susceptibility QTL 32 2.61 mammary gland integrity trait (VT:0010552) mammary tumor incidence/prevalence measurement (CMO:0000946) 1 115540693 238914717 Rat 70163 Bw20 Body weight QTL 20 5.1 body mass (VT:0001259) body weight (CMO:0000012) 1 174133260 219133260 Rat 1578763 Kidm29 Kidney mass QTL 29 3.3 0.0001 kidney mass (VT:0002707) both kidneys wet weight (CMO:0000085) 1 179567751 260522016 Rat 1600395 Niddm69 Non-insulin dependent diabetes mellitus QTL 69 4.14 0.0002 blood insulin amount (VT:0001560) plasma insulin level (CMO:0000342) 1 195804352 257091168 Rat 1354624 Cm35 Cardiac mass QTL35 5.7 heart left ventricle mass (VT:0007031) calculated heart weight (CMO:0000073) 1 177227632 256448636 Rat 1600396 Niddm68 Non-insulin dependent diabetes mellitus QTL 68 4.97 0.0003 blood glucose amount (VT:0000188) blood glucose level area under curve (AUC) (CMO:0000350) 1 195804352 257091168 Rat 1558658 Bw59 Body weight QTL 59 3.5 0.0003 body mass (VT:0001259) body weight (CMO:0000012) 1 178784622 223784622 Rat 631838 Niddm36 Non-insulin dependent diabetes mellitus QTL 36 0.01 insulin secretion trait (VT:0003564) calculated pancreatic islet insulin release measurement (CMO:0001217) 1 184550676 229550676 Rat 1549837 Hcar15 Hepatocarcinoma resistance QTL 15 0.05 liver integrity trait (VT:0010547) liver tumorous lesion number (CMO:0001068) 1 153136852 260522016 Rat 2293689 Bss47 Bone structure and strength QTL 47 7.25 0.0001 lumbar vertebra size trait (VT:0010518) lumbar vertebra trabecular cross-sectional area (CMO:0001692) 1 171629477 216629477 Rat 152025235 Bw194 Body weight QTL 194 4.86 body mass (VT:0001259) 1 123556856 242907031 Rat 1600388 Niddm67 Non-insulin dependent diabetes mellitus QTL 67 5.84 0.000004 blood glucose amount (VT:0000188) blood glucose level area under curve (AUC) (CMO:0000350) 1 195804352 257091168 Rat 2293694 Bss38 Bone structure and strength QTL 38 7.05 0.0001 femur strength trait (VT:0010010) femur stiffness (CMO:0001674) 1 201554356 246554356 Rat 1598853 Memor3 Memory QTL 3 4.5 exploratory behavior trait (VT:0010471) total horizontal distance resulting from voluntary locomotion in an experimental apparatus (CMO:0001443) 1 143506580 212458660 Rat 61341 Bp26 Blood pressure QTL 26 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 169537671 214537671 Rat 1578759 Uae30 Urinary albumin excretion QTL 30 3.3 0.003 urine albumin amount (VT:0002871) urine albumin excretion rate (CMO:0000757) 1 150700247 252085048 Rat 2293693 Bss22 Bone structure and strength QTL 22 33.52 0.0001 femur morphology trait (VT:0000559) femur cross-sectional area (CMO:0001661) 1 171629477 216629477 Rat 2300161 Bmd43 Bone mineral density QTL 43 8.4 0.0001 femur mineral mass (VT:0010011) volumetric bone mineral density (CMO:0001553) 1 171629477 216629477 Rat 1300145 Rf7 Renal function QTL 7 2.96 urine creatinine amount (VT:0010540) urine creatinine level (CMO:0000125) 1 185145134 221264292 Rat 8655655 Arrd2 Age-related retinal degeneration QTL 2 7.79 retinal layer morphology trait (VT:0003727) percentage of study population developing retinopathy during a period of time (CMO:0002453) 1 183970203 243914901 Rat 1358898 Bp255 Blood pressure QTL 255 3.6 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 1 191019702 246062233 Rat 631214 Bw61 Body weight QTL61 3.4 0.0001 intramuscular adipose amount (VT:0010044) intramuscular fat area (CMO:0001162) 1 173108781 218108781 Rat 7771612 Cm80 Cardiac mass QTL 80 8.4 heart left ventricle mass (VT:0007031) heart left ventricle weight (CMO:0000776) 1 149448574 221264292 Rat 731168 Bp154 Blood pressure QTL 154 3.4 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 94642644 214537671 Rat 2300175 Bmd40 Bone mineral density QTL 40 15.4 0.0001 femur mineral mass (VT:0010011) bone mineral density (CMO:0001226) 1 201554356 246554356 Rat 2300174 Bmd42 Bone mineral density QTL 42 8.4 0.0001 lumbar vertebra mineral mass (VT:0010511) bone mineral density (CMO:0001226) 1 171629477 216629477 Rat 737828 Hcas3 Hepatocarcinoma susceptibility QTL 3 4.9 liver integrity trait (VT:0010547) liver tumorous lesion volume to total liver volume ratio (CMO:0001082) 1 144267353 222987745 Rat 1354661 Bw33 Body weight QTL 33 5.2 body mass (VT:0001259) body weight (CMO:0000012) 1 151162512 256448636 Rat 1358886 Bp260 Blood pressure QTL 260 3.67 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 1 151162766 225824951 Rat 737977 Bp160 Blood pressure QTL 160 0.001 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 1 181133855 226133855 Rat 2293654 Bss30 Bone structure and strength QTL 30 32.65 0.0001 femur strength trait (VT:0010010) femur midshaft polar moment of inertia (CMO:0001669) 1 171629477 216629477 Rat 2293655 Bss36 Bone structure and strength QTL 36 10.66 0.0001 femur strength trait (VT:0010010) femur ultimate force (CMO:0001675) 1 201554356 246554356 Rat 1298084 Thym4 Thymus enlargement QTL 4 10.68 thymus mass (VT:0004954) thymus weight to body weight ratio (CMO:0000612) 1 197814409 242814409 Rat 724531 Uae5 Urinary albumin excretion QTL 5 4 urine albumin amount (VT:0002871) urine albumin level (CMO:0000130) 1 150700142 252085212 Rat 2300187 Bmd41 Bone mineral density QTL 41 8.9 0.0001 femur mineral mass (VT:0010011) volumetric bone mineral density (CMO:0001553) 1 171629477 216629477 Rat 8552891 Epfw5 Epididymal fat weight QTL 5 4.4 epididymal fat pad mass (VT:0010421) epididymal fat pad weight to body weight ratio (CMO:0000658) 1 193113876 238113876 Rat 1354580 Scort1 Serum corticosterone level QTL 1 3.4 blood corticosterone amount (VT:0005345) blood corticosterone level (CMO:0001172) 1 156677124 256448636 Rat 1358292 Cm37 Cardiac mass QTL 37 6.2 8e-07 heart mass (VT:0007028) heart weight to body weight ratio (CMO:0000074) 1 196248093 241248093 Rat 61376 Bp42 Blood pressure QTL 42 23.4 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 197814409 242814409 Rat 634313 Niddm43 Non-insulin dependent diabetes mellitus QTL 43 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 1 199050459 259647894 Rat 634312 Bp143 Blood pressure QTL 143 3 0.0002 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 182623426 219932796 Rat 1358294 Bw37 Body weight QTL 37 5 0.000011 body mass (VT:0001259) body weight (CMO:0000012) 1 171310381 216310381 Rat 724559 Pancm1 Pancreatic morphology QTL 1 7.1 islet of Langerhans morphology trait (VT:0005215) pancreatic islet damage composite score (CMO:0001156) 1 181759564 214537555 Rat 2312420 Pur17 Proteinuria QTL 17 7.1 0.0001 urine protein amount (VT:0005160) urine total protein excretion rate (CMO:0000756) 1 156677124 218753816 Rat 10059600 Bp378 Blood pressure QTL 378 3.08 0.05 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 176869060 221869060 Rat 7421630 Bp362 Blood pressure QTL 362 0.001 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 1 118608292 241799120 Rat 619613 Bp77 Blood pressure QTL 77 0.01 arterial blood pressure trait (VT:2000000) diastolic blood pressure (CMO:0000005) 1 164747424 209747424 Rat 2312564 Glom18 Glomerulus QTL 18 2.4 0.003 kidney glomerulus morphology trait (VT:0005325) index of glomerular damage (CMO:0001135) 1 185356336 231689108 Rat 634321 Hc1 Hypercalciuria QTL 1 2.91 urine calcium amount (VT:0002985) urine calcium excretion rate (CMO:0000763) 1 178810256 240830002 Rat 2292218 Kidm35 Kidney mass QTL 35 kidney mass (VT:0002707) both kidneys wet weight to body weight ratio (CMO:0000340) 1 199368955 224569684 Rat 724562 Rends1 Renal damage susceptibility QTL 1 0.05 kidney glomerulus integrity trait (VT:0010546) index of glomerular damage (CMO:0001135) 1 169537671 214537671 Rat 1331790 Bp201 Blood pressure QTL 201 3.127 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 1 198211513 225126682 Rat 10059587 Bw173 Body weight QTL 173 3.23 0.025 body mass (VT:0001259) body weight (CMO:0000012) 1 202069611 247069611 Rat 2292222 Bp307 Blood pressure QTL 307 3.06 0.0014 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 164310393 213533942 Rat 2292220 Bp306 Blood pressure QTL 306 3.47 0.00087 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 164310393 243914901 Rat 10059590 Kidm44 Kidney mass QTL 44 3.42 0.025 kidney mass (VT:0002707) both kidneys wet weight to body weight ratio (CMO:0000340) 1 191033875 236033875 Rat 1641926 Teswt2 Testicular weight QTL 2 2.82 testis mass (VT:1000644) both testes wet weight (CMO:0000175) 1 197697768 238755659 Rat 631658 Cm7 Cardiac mass QTL 7 5.32 0.0001 aorta mass (VT:0002845) aorta weight (CMO:0000076) 1 196248093 241248093 Rat 1600380 Niddm70 Non-insulin dependent diabetes mellitus QTL 70 3.1 0.0008 blood insulin amount (VT:0001560) plasma insulin level (CMO:0000342) 1 176550523 221550523 Rat 1354610 Bw34 Body weight QTL 34 4.1 body mass (VT:0001259) body weight (CMO:0000012) 1 151162512 256448636 Rat 1582206 Kidm33 Kidney mass QTL 33 6.9 kidney mass (VT:0002707) both kidneys wet weight to body weight ratio (CMO:0000340) 1 188377360 224054420 Rat 8655855 Arrd3 Age-related retinal degeneration QTL 3 3.07 lens clarity trait (VT:0001304) cataract incidence/prevalence measurement (CMO:0001585) 1 183970203 243914901 Rat 634338 Hcar4 Hepatocarcinoma resistance QTL 4 4.6 liver integrity trait (VT:0010547) liver tumorous lesion number to liver area ratio (CMO:0001210) 1 193422268 214537671 Rat 6903303 Scl34 Serum cholesterol QTL 34 2.5 0.0033 blood cholesterol amount (VT:0000180) plasma total cholesterol level (CMO:0000585) 1 180359209 218108781 Rat 1600374 Mcs17 Mammary carcinoma susceptibility QTL 17 3 mammary gland integrity trait (VT:0010552) mammary tumor number (CMO:0000343) 1 197670404 242670404 Rat 1600363 Hc6 Hypercalciuria QTL 6 2.7 urine calcium amount (VT:0002985) urine calcium excretion rate (CMO:0000763) 1 203995416 244113296 Rat 2293083 Iddm25 Insulin dependent diabetes mellitus QTL 25 4.18 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 1 181829673 224569684 Rat 1354606 Bp246 Blood pressure QTL 246 3.6 arterial blood pressure trait (VT:2000000) pulse pressure (CMO:0000292) 1 102813953 218753816 Rat 738032 Hcas5 Hepatocarcinoma susceptibility QTL 5 3.12 liver integrity trait (VT:0010547) liver tumorous lesion number (CMO:0001068) 1 176426412 257976495 Rat 1358191 Ept10 Estrogen-induced pituitary tumorigenesis QTL 10 3.8 pituitary gland mass (VT:0010496) pituitary gland wet weight (CMO:0000853) 1 192825253 243914732 Rat 7394701 Uae46 Urinary albumin excretion QTL 46 3.6 0.0056 urine albumin amount (VT:0002871) urine albumin excretion rate (CMO:0000757) 1 201554356 246554356 Rat
RH127893
Rat Assembly Chr Position (strand) Source JBrowse GRCr8 1 215,118,462 - 215,119,253 (+) Marker Load Pipeline mRatBN7.2 1 205,689,343 - 205,690,134 (+) MAPPER mRatBN7.2 Rnor_6.0 1 224,991,435 - 224,992,225 NCBI Rnor6.0 Rnor_5.0 1 231,929,608 - 231,930,398 UniSTS Rnor5.0 RGSC_v3.4 1 211,462,505 - 211,463,295 UniSTS RGSC3.4 Celera 1 203,202,273 - 203,203,063 UniSTS RH 3.4 Map 1 1510.0 UniSTS Cytogenetic Map 1 q43 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
11
49
113
91
90
59
25
59
6
218
97
93
45
60
31
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000026313 ⟹ ENSRNOP00000026313
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 1 205,689,160 - 205,692,686 (-) Ensembl Rnor_6.0 Ensembl 1 224,991,222 - 224,994,653 (-) Ensembl
Ensembl Acc Id:
ENSRNOT00000096042 ⟹ ENSRNOP00000093882
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 1 205,689,175 - 205,692,686 (-) Ensembl
RefSeq Acc Id:
NM_053948 ⟹ NP_446400
RefSeq Status:
PROVISIONAL
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 1 215,118,279 - 215,121,656 (-) NCBI mRatBN7.2 1 205,689,160 - 205,692,537 (-) NCBI Rnor_6.0 1 224,991,251 - 224,994,628 (-) NCBI Rnor_5.0 1 231,929,423 - 231,936,528 (-) NCBI RGSC_v3.4 1 211,462,321 - 211,465,698 (-) RGD Celera 1 203,202,089 - 203,205,466 (-) RGD
Sequence:
GACTTCTGCTAGTGCTTCCGGCGAGGTCCCTTCCTGGGGAGTTCTGGCCTCTGCGGTCCAAGCTTCTGCAGAAGATGTTTTATCATATTTCCCTGGAGCACGAGATCCTACTGCACCCACGCTACTTT
hide sequence
RefSeq Acc Id:
XM_063266367 ⟹ XP_063122437
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 1 215,118,278 - 215,121,755 (-) NCBI
RefSeq Acc Id:
XM_063266376 ⟹ XP_063122446
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 1 215,118,278 - 215,125,389 (-) NCBI
RefSeq Acc Id:
XM_063266389 ⟹ XP_063122459
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 1 215,118,278 - 215,124,753 (-) NCBI
RefSeq Acc Id:
XM_063266404 ⟹ XP_063122474
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 1 215,118,278 - 215,122,161 (-) NCBI
RefSeq Acc Id:
NP_446400 ⟸ NM_053948
- UniProtKB:
P62489 (UniProtKB/Swiss-Prot), A6HZU1 (UniProtKB/TrEMBL), A0A8I6GKH4 (UniProtKB/TrEMBL)
- Sequence:
MFYHISLEHEILLHPRYFGPNLLNTVKQKLFTEVEGTCTGKYGFVIAVTTIDNIGAGVIQPGRGFVLYPVKYKAIVFRPFKGEVVDAVVTQVNKVGLFTEIGPMSCFISRHSIPSEMEFDPNSNPPCY
hide sequence
Ensembl Acc Id:
ENSRNOP00000026313 ⟸ ENSRNOT00000026313
Ensembl Acc Id:
ENSRNOP00000093882 ⟸ ENSRNOT00000096042
RefSeq Acc Id:
XP_063122446 ⟸ XM_063266376
- Peptide Label:
isoform X2
- UniProtKB:
P62489 (UniProtKB/Swiss-Prot), A6HZU1 (UniProtKB/TrEMBL), A0A8I6GKH4 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063122459 ⟸ XM_063266389
- Peptide Label:
isoform X2
- UniProtKB:
P62489 (UniProtKB/Swiss-Prot), A6HZU1 (UniProtKB/TrEMBL), A0A8I6GKH4 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063122474 ⟸ XM_063266404
- Peptide Label:
isoform X2
- UniProtKB:
P62489 (UniProtKB/Swiss-Prot), A6HZU1 (UniProtKB/TrEMBL), A0A8I6GKH4 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063122437 ⟸ XM_063266367
- Peptide Label:
isoform X1
- UniProtKB:
A0A8I6GKH4 (UniProtKB/TrEMBL)
RGD ID: 13690737 Promoter ID: EPDNEW_R1261 Type: initiation region Name: Polr2g_1 Description: RNA polymerase II subunit G SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Rat Assembly Chr Position (strand) Source Rnor_6.0 1 224,994,632 - 224,994,692 EPDNEW
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2016-07-21
Polr2g
RNA polymerase II subunit G
Polr2g
polymerase (RNA) II subunit G
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2016-03-09
Polr2g
polymerase (RNA) II subunit G
Polr2g
polymerase (RNA) II (DNA directed) polypeptide G
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2004-09-10
Polr2g
polymerase (RNA) II (DNA directed) polypeptide G
polymerase (RNA) II (DNA directed)polypeptide G
Name updated
1299863 APPROVED
2002-08-07
Polr2g
polymerase (RNA) II (DNA directed)polypeptide G
Symbol and Name status set to provisional
70820 PROVISIONAL
