Symbol:
CCL7
Name:
C-C motif chemokine ligand 7
RGD ID:
1352377
HGNC Page
HGNC:10634
Description:
Enables CCR1 chemokine receptor binding activity and chemokine activity. Involved in several processes, including eosinophil chemotaxis; positive regulation of natural killer cell chemotaxis; and regulation of cell shape. Predicted to be located in extracellular region. Predicted to be active in extracellular space. Implicated in multiple sclerosis. Biomarker of several diseases, including autoimmune disease (multiple); lung disease (multiple); nose disease (multiple); periapical periodontitis (multiple); and viral infectious disease (multiple).
Type:
protein-coding
RefSeq Status:
REVIEWED
Previously known as:
C-C motif chemokine 7; chemokine (C-C motif) ligand 7; FIC; MARC; MCP-3; MCP3; MGC138463; MGC138465; monocyte chemoattractant protein 3; monocyte chemotactic protein 3; NC28; SCYA6; SCYA7; small inducible cytokine A7 (monocyte chemotactic protein 3); small-inducible cytokine A7
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Species
Gene symbol and name
Data Source
Assertion derived from
less info ...
Orthologs 1
Mus musculus (house mouse):
Ccl7 (C-C motif chemokine ligand 7) HGNC
EggNOG, Ensembl, HGNC, OMA, Panther, PhylomeDB, Treefam
Rattus norvegicus (Norway rat):
Ccl7 (C-C motif chemokine ligand 7) HGNC
EggNOG, Ensembl, OMA, Panther, PhylomeDB, Treefam
Canis lupus familiaris (dog):
CCL7 (C-C motif chemokine ligand 7) HGNC
Ensembl, HomoloGene, Inparanoid, OMA, OrthoDB, OrthoMCL, Panther, Treefam
Chlorocebus sabaeus (green monkey):
CCL7 (C-C motif chemokine ligand 7) NCBI
Ortholog
Other homologs 2
Mus musculus (house mouse):
Ccl12 (C-C motif chemokine ligand 12) HGNC
Ensembl, Inparanoid, OrthoDB
Rattus norvegicus (Norway rat):
Ccl12 (C-C motif chemokine ligand 12) HGNC
EggNOG, Ensembl, OrthoDB
Canis lupus familiaris (dog):
CCL8 (C-C motif chemokine ligand 8) HGNC
OrthoDB, Panther
Sus scrofa (pig):
CCL8 (chemokine (C-C motif) ligand 8) HGNC
OrthoDB, Panther
Sus scrofa (pig):
CCL2 (chemokine (C-C motif) ligand 2) HGNC
EggNOG, OrthoDB
Mus musculus (house mouse):
Ccl11 (C-C motif chemokine ligand 11) HGNC
OMA, OrthoDB
Rattus norvegicus (Norway rat):
Ccl11 (C-C motif chemokine ligand 11) HGNC
OrthoDB
Mus musculus (house mouse):
Ccl8 (C-C motif chemokine ligand 8) HGNC
OrthoDB
Canis lupus familiaris (dog):
CCL2 (C-C motif chemokine ligand 2) HGNC
OrthoDB
Sus scrofa (pig):
CCL11 (chemokine (C-C motif) ligand 11) HGNC
OrthoDB
Rattus norvegicus (Norway rat):
Polr2g (RNA polymerase II subunit G) HGNC
OMA
Alliance orthologs 3
Rattus norvegicus (Norway rat):
Ccl12 (C-C motif chemokine ligand 12)
Alliance
DIOPT (Hieranoid|InParanoid|OMA|OrthoInspector|SonicParanoid)
Rattus norvegicus (Norway rat):
Ccl7 (C-C motif chemokine ligand 7)
Alliance
DIOPT (HGNC|OMA|OrthoFinder|PANTHER|PhylomeDB)
Mus musculus (house mouse):
Ccl7 (C-C motif chemokine ligand 7)
Alliance
DIOPT (HGNC|OMA|OrthoFinder|PANTHER|PhylomeDB)
Danio rerio (zebrafish):
ccl39.1 (chemokine (C-C motif) ligand 39, duplicate 1)
Alliance
DIOPT (Hieranoid|OMA|OrthoFinder)
Allele / Splice:
See ClinVar data
Latest Assembly:
GRCh38 - Human Genome Assembly GRCh38
Position:
Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 17 34,270,221 - 34,272,242 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 17 34,270,221 - 34,272,242 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 17 32,597,240 - 32,599,261 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 17 29,621,353 - 29,623,369 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 17 29,621,352 - 29,623,368 NCBI Celera 17 29,507,053 - 29,509,069 (+) NCBI Celera Cytogenetic Map 17 q12 NCBI HuRef 17 28,782,528 - 28,784,554 (+) NCBI HuRef CHM1_1 17 32,661,096 - 32,663,122 (+) NCBI CHM1_1 T2T-CHM13v2.0 17 35,216,497 - 35,218,518 (+) NCBI T2T-CHM13v2.0
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
CCL7 Human 1,2-dimethylhydrazine increases expression ISO Ccl7 (Mus musculus) 6480464 1 and 2-Dimethylhydrazine results in increased expression of CCL7 mRNA CTD PMID:22206623 CCL7 Human 1,4-phenylenediamine increases expression EXP 6480464 4-phenylenediamine results in increased expression of CCL7 mRNA CTD PMID:27585668 CCL7 Human 1-chloro-2,4-dinitrobenzene increases expression ISO Ccl7 (Rattus norvegicus) 6480464 Dinitrochlorobenzene results in increased expression of CCL7 mRNA CTD PMID:21893156 CCL7 Human 1-chloro-2,4-dinitrobenzene increases expression ISO Ccl7 (Mus musculus) 6480464 Dinitrochlorobenzene results in increased expression of CCL7 mRNA CTD PMID:19647056 and PMID:21404309 CCL7 Human 15-acetyldeoxynivalenol increases expression ISO Ccl7 (Mus musculus) 6480464 15-acetyldeoxynivalenol results in increased expression of CCL7 mRNA CTD PMID:24793808 CCL7 Human 17alpha-ethynylestradiol affects expression ISO Ccl7 (Rattus norvegicus) 6480464 Ethinyl Estradiol affects the expression of CCL7 mRNA CTD PMID:15212814 CCL7 Human 17beta-estradiol affects expression ISO Ccl7 (Mus musculus) 6480464 Estradiol affects the expression of CCL7 mRNA CTD PMID:15598610 CCL7 Human 17beta-estradiol multiple interactions ISO Ccl7 (Rattus norvegicus) 6480464 [estradiol 3-benzoate co-treated with [Testosterone co-treated with Estradiol]] results in increased expression of CCL7 mRNA CTD PMID:32741896 CCL7 Human 17beta-estradiol increases expression ISO Ccl7 (Mus musculus) 6480464 Estradiol results in increased expression of CCL7 mRNA CTD PMID:19484750 CCL7 Human 17beta-estradiol increases expression ISO Ccl7 (Rattus norvegicus) 6480464 Estradiol results in increased expression of CCL7 mRNA CTD PMID:17010207 CCL7 Human 17beta-estradiol 3-benzoate multiple interactions ISO Ccl7 (Rattus norvegicus) 6480464 [estradiol 3-benzoate co-treated with [Testosterone co-treated with Estradiol]] results in increased expression of CCL7 mRNA CTD PMID:32741896 CCL7 Human 2,2',4,4',5,5'-hexachlorobiphenyl increases expression EXP 6480464 2 more ... CTD PMID:23146750 CCL7 Human 2,2',4,4'-Tetrabromodiphenyl ether increases expression EXP 6480464 2 more ... CTD PMID:23146750 CCL7 Human 2,2',4,4'-Tetrabromodiphenyl ether decreases expression ISO Ccl7 (Rattus norvegicus) 6480464 2 more ... CTD PMID:27291303 CCL7 Human 2,2',5,5'-tetrachlorobiphenyl decreases expression EXP 6480464 2 more ... CTD PMID:36804509 CCL7 Human 2,3,7,8-tetrachlorodibenzodioxine multiple interactions ISO Ccl7 (Mus musculus) 6480464 Tetrachlorodibenzodioxin inhibits the reaction [EGF protein results in increased expression of CCL7 mRNA] CTD PMID:15667827 CCL7 Human 2,3,7,8-tetrachlorodibenzodioxine increases expression ISO Ccl7 (Rattus norvegicus) 6480464 Tetrachlorodibenzodioxin results in increased expression of CCL7 mRNA CTD PMID:33387578 and PMID:34747641 CCL7 Human 2,3,7,8-tetrachlorodibenzodioxine increases expression ISO Ccl7 (Mus musculus) 6480464 Tetrachlorodibenzodioxin results in increased expression of CCL7 mRNA CTD PMID:29673856 CCL7 Human 2,3,7,8-tetrachlorodibenzodioxine affects expression ISO Ccl7 (Mus musculus) 6480464 Tetrachlorodibenzodioxin affects the expression of CCL7 mRNA CTD PMID:21570461 CCL7 Human 2,3,7,8-tetrachlorodibenzodioxine decreases expression EXP 6480464 Tetrachlorodibenzodioxin results in decreased expression of CCL7 mRNA CTD PMID:21296121 CCL7 Human 2,3,7,8-tetrachlorodibenzodioxine decreases expression ISO Ccl7 (Mus musculus) 6480464 Tetrachlorodibenzodioxin results in decreased expression of CCL7 mRNA CTD PMID:19933214 CCL7 Human 2,4,6-trinitrobenzenesulfonic acid increases expression ISO Ccl7 (Mus musculus) 6480464 Trinitrobenzenesulfonic Acid results in increased expression of CCL7 mRNA CTD PMID:17982090 CCL7 Human 2,4-dibromophenyl 2,4,5-tribromophenyl ether affects expression ISO Ccl7 (Mus musculus) 6480464 2 more ... CTD PMID:38648751 CCL7 Human 2,4-dinitrobenzenesulfonic acid increases expression ISO Ccl7 (Mus musculus) 6480464 2 and 4-dinitrobenzenesulfonic acid results in increased expression of CCL7 mRNA CTD PMID:30116771 CCL7 Human 2-acetamidofluorene increases expression ISO Ccl7 (Rattus norvegicus) 6480464 2-Acetylaminofluorene results in increased expression of CCL7 protein CTD PMID:25051504 CCL7 Human 2-amino-2-deoxy-D-glucopyranose multiple interactions ISO Ccl7 (Rattus norvegicus) 6480464 Glucosamine inhibits the reaction [IL1B results in increased expression of CCL7 mRNA] and IL1B promotes the reaction [Glucosamine results in increased expression of CCL7 mRNA] CTD PMID:17109745 CCL7 Human 2-amino-2-deoxy-D-glucopyranose increases expression ISO Ccl7 (Rattus norvegicus) 6480464 Glucosamine results in increased expression of CCL7 mRNA CTD PMID:17109745 CCL7 Human 3'-amino-3'-deoxy-N(6),N(6)-dimethyladenosine affects expression ISO Ccl7 (Rattus norvegicus) 6480464 Puromycin Aminonucleoside affects the expression of CCL7 mRNA CTD PMID:10867541 CCL7 Human 3-acetyldeoxynivalenol increases expression ISO Ccl7 (Mus musculus) 6480464 3-acetyldeoxynivalenol results in increased expression of CCL7 mRNA CTD PMID:24793808 CCL7 Human 3-isobutyl-1-methyl-7H-xanthine multiple interactions ISO Ccl7 (Mus musculus) 6480464 [Dexamethasone co-treated with Rosiglitazone co-treated with 1-Methyl-3-isobutylxanthine co-treated with INS1 protein] results in decreased expression of CCL7 mRNA more ... CTD PMID:16054899 and PMID:23503329 CCL7 Human 3-methylcholanthrene increases expression ISO Ccl7 (Mus musculus) 6480464 Methylcholanthrene results in increased expression of CCL7 mRNA CTD PMID:20713471 CCL7 Human 4,4'-sulfonyldiphenol increases expression ISO Ccl7 (Mus musculus) 6480464 bisphenol S results in increased expression of CCL7 mRNA CTD PMID:37611474 CCL7 Human 4-(ethoxymethylene)-2-phenyloxazol-5-one increases expression ISO Ccl7 (Rattus norvegicus) 6480464 Oxazolone results in increased expression of CCL7 mRNA CTD PMID:21893156 CCL7 Human 4-(ethoxymethylene)-2-phenyloxazol-5-one increases expression ISO Ccl7 (Mus musculus) 6480464 Oxazolone results in increased expression of CCL7 mRNA CTD PMID:19647056 and PMID:21404309 CCL7 Human 4-hydroxynon-2-enal decreases expression ISO Ccl7 (Mus musculus) 6480464 4-hydroxy-2-nonenal results in decreased expression of CCL7 mRNA CTD PMID:19191707 CCL7 Human 4-hydroxyphenyl retinamide increases expression ISO Ccl7 (Mus musculus) 6480464 Fenretinide results in increased expression of CCL7 mRNA CTD PMID:28973697 CCL7 Human 4-nitroquinoline N-oxide increases expression ISO Ccl7 (Mus musculus) 6480464 4-Nitroquinoline-1-oxide results in increased expression of CCL7 mRNA CTD PMID:22561872 CCL7 Human AB-Fubinaca decreases expression ISO Ccl7 (Rattus norvegicus) 6480464 AB-FUBINACA results in decreased expression of CCL7 mRNA CTD PMID:26517302 CCL7 Human abexinostat decreases expression EXP 6480464 abexinostat results in decreased expression of CCL7 mRNA CTD PMID:19417023 CCL7 Human acetamide increases expression ISO Ccl7 (Rattus norvegicus) 6480464 acetamide results in increased expression of CCL7 mRNA CTD PMID:31881176 CCL7 Human Aeol 10150 decreases expression ISO Ccl7 (Mus musculus) 6480464 AEOL 10150 results in decreased expression of CCL7 mRNA CTD PMID:12374626 CCL7 Human aflatoxin B1 decreases methylation EXP 6480464 Aflatoxin B1 results in decreased methylation of CCL7 gene CTD PMID:27153756 CCL7 Human aflatoxin B1 decreases expression ISO Ccl7 (Rattus norvegicus) 6480464 Aflatoxin B1 results in decreased expression of CCL7 mRNA CTD PMID:25378103 CCL7 Human aldehydo-D-glucosamine increases expression ISO Ccl7 (Rattus norvegicus) 6480464 Glucosamine results in increased expression of CCL7 mRNA CTD PMID:17109745 CCL7 Human aldehydo-D-glucosamine multiple interactions ISO Ccl7 (Rattus norvegicus) 6480464 Glucosamine inhibits the reaction [IL1B results in increased expression of CCL7 mRNA] and IL1B promotes the reaction [Glucosamine results in increased expression of CCL7 mRNA] CTD PMID:17109745 CCL7 Human aldehydo-D-glucose multiple interactions ISO Ccl7 (Mus musculus) 6480464 [lard co-treated with Cholesterol and Dietary co-treated with Dietary Sucrose co-treated with Fructose co-treated with Glucose] results in increased expression of CCL7 mRNA CTD PMID:37567420 CCL7 Human all-trans-retinoic acid multiple interactions EXP 6480464 [arsenic trioxide co-treated with Tretinoin] results in increased expression of CCL7 mRNA and [arsenic trioxide co-treated with Tretinoin] results in increased expression of CCL7 protein CTD PMID:19828696 CCL7 Human all-trans-retinoic acid increases expression EXP 6480464 Tretinoin results in increased expression of CCL7 mRNA and Tretinoin results in increased expression of CCL7 protein CTD PMID:19828696 and PMID:33167477 CCL7 Human alpha-amanitin affects expression ISO Ccl7 (Mus musculus) 6480464 Alpha-Amanitin affects the expression of CCL7 mRNA CTD PMID:38531469 CCL7 Human alpha-Zearalanol multiple interactions ISO Ccl7 (Rattus norvegicus) 6480464 [Zeranol co-treated with perfluorooctanoic acid] results in increased expression of CCL7 mRNA CTD PMID:35163327 CCL7 Human aluminium atom decreases expression ISO Ccl7 (Mus musculus) 6480464 Aluminum results in decreased expression of CCL7 mRNA CTD PMID:37544489 CCL7 Human aluminium(0) decreases expression ISO Ccl7 (Mus musculus) 6480464 Aluminum results in decreased expression of CCL7 mRNA CTD PMID:37544489 CCL7 Human ammonium chloride affects expression ISO Ccl7 (Rattus norvegicus) 6480464 Ammonium Chloride affects the expression of CCL7 mRNA CTD PMID:16483693 CCL7 Human amphibole asbestos increases expression ISO Ccl7 (Rattus norvegicus) 6480464 Asbestos and Amphibole results in increased expression of CCL7 mRNA CTD PMID:22168577 CCL7 Human apocynin multiple interactions EXP 6480464 acetovanillone inhibits the reaction [TNF protein results in increased expression of CCL7 mRNA] CTD PMID:22414048 CCL7 Human arsane increases expression ISO Ccl7 (Rattus norvegicus) 6480464 Arsenic results in increased expression of CCL7 mRNA CTD PMID:18315880 CCL7 Human arsane multiple interactions EXP 6480464 [Arsenic results in increased abundance of Arsenicals] which affects the expression of CCL7 mRNA CTD PMID:28793237 CCL7 Human arsenic atom increases expression ISO Ccl7 (Rattus norvegicus) 6480464 Arsenic results in increased expression of CCL7 mRNA CTD PMID:18315880 CCL7 Human arsenic atom multiple interactions EXP 6480464 [Arsenic results in increased abundance of Arsenicals] which affects the expression of CCL7 mRNA CTD PMID:28793237 CCL7 Human arsenous acid increases expression EXP 6480464 Arsenic Trioxide results in increased expression of CCL7 mRNA and Arsenic Trioxide results in increased expression of CCL7 protein CTD PMID:19828696 CCL7 Human arsenous acid increases expression ISO Ccl7 (Mus musculus) 6480464 Arsenic Trioxide results in increased expression of CCL7 protein CTD PMID:37166470 CCL7 Human arsenous acid multiple interactions EXP 6480464 [Arsenic Trioxide co-treated with Tretinoin] results in increased expression of CCL7 mRNA and [Arsenic Trioxide co-treated with Tretinoin] results in increased expression of CCL7 protein CTD PMID:19828696 CCL7 Human asperentin decreases expression ISO Ccl7 (Mus musculus) 6480464 cladosporin results in decreased expression of CCL7 mRNA CTD PMID:19818335 CCL7 Human astemizole decreases expression ISO Ccl7 (Rattus norvegicus) 6480464 Astemizole results in decreased expression of CCL7 mRNA CTD PMID:20221588 CCL7 Human atrazine multiple interactions EXP 6480464 [Atrazine co-treated with Arsenates] results in increased expression of CCL7 mRNA CTD PMID:18585445 CCL7 Human atrazine increases expression EXP 6480464 Atrazine results in increased expression of CCL7 mRNA CTD PMID:22378314 CCL7 Human Azoxymethane multiple interactions ISO Ccl7 (Mus musculus) 6480464 [titanium dioxide co-treated with Azoxymethane co-treated with Dextran Sulfate] results in decreased expression of CCL7 mRNA CTD PMID:29950665 CCL7 Human barium sulfate increases expression ISO Ccl7 (Rattus norvegicus) 6480464 Barium Sulfate results in increased expression of CCL7 mRNA CTD PMID:29463257 CCL7 Human benzalkonium chloride increases expression ISO Ccl7 (Mus musculus) 6480464 Benzalkonium Compounds results in increased expression of CCL7 mRNA and Benzalkonium Compounds results in increased expression of CCL7 protein CTD PMID:30171875 and PMID:30517752 CCL7 Human benzo[a]pyrene affects expression EXP 6480464 Benzo(a)pyrene affects the expression of CCL7 mRNA CTD PMID:22316170 CCL7 Human benzo[a]pyrene decreases expression ISO Ccl7 (Mus musculus) 6480464 Benzo(a)pyrene results in decreased expression of CCL7 mRNA CTD PMID:32417428 CCL7 Human benzo[a]pyrene increases expression ISO Ccl7 (Mus musculus) 6480464 Benzo(a)pyrene results in increased expression of CCL7 mRNA CTD PMID:22228805 and PMID:23735875 CCL7 Human beta-D-glucosamine multiple interactions ISO Ccl7 (Rattus norvegicus) 6480464 Glucosamine inhibits the reaction [IL1B results in increased expression of CCL7 mRNA] and IL1B promotes the reaction [Glucosamine results in increased expression of CCL7 mRNA] CTD PMID:17109745 CCL7 Human beta-D-glucosamine increases expression ISO Ccl7 (Rattus norvegicus) 6480464 Glucosamine results in increased expression of CCL7 mRNA CTD PMID:17109745 CCL7 Human bis(2-chloroethyl) sulfide increases expression ISO Ccl7 (Mus musculus) 6480464 Mustard Gas results in increased expression of CCL7 mRNA CTD PMID:15674843 CCL7 Human bis(2-chloroethyl) sulfide increases secretion EXP 6480464 Mustard Gas results in increased secretion of CCL7 protein CTD PMID:33491125 CCL7 Human bisphenol A increases expression ISO Ccl7 (Rattus norvegicus) 6480464 bisphenol A results in increased expression of CCL7 mRNA CTD PMID:25181051 and PMID:34947998 CCL7 Human bisphenol A decreases expression ISO Ccl7 (Mus musculus) 6480464 bisphenol A results in decreased expression of CCL7 mRNA CTD PMID:37105096 CCL7 Human bisphenol A increases expression ISO Ccl7 (Mus musculus) 6480464 bisphenol A results in increased expression of CCL7 mRNA CTD PMID:32144343 CCL7 Human bisphenol A multiple interactions ISO Ccl7 (Mus musculus) 6480464 [Ovalbumin co-treated with bisphenol A] results in increased expression of and results in increased secretion of CCL7 protein CTD PMID:29737898 CCL7 Human bisphenol A increases expression EXP 6480464 bisphenol A results in increased expression of CCL7 mRNA CTD PMID:29275510 CCL7 Human bisphenol A decreases expression ISO Ccl7 (Rattus norvegicus) 6480464 bisphenol A results in decreased expression of CCL7 mRNA CTD PMID:30816183 and PMID:32528016 CCL7 Human bisphenol F increases expression ISO Ccl7 (Mus musculus) 6480464 bisphenol F results in increased expression of CCL7 mRNA CTD PMID:38685157 CCL7 Human bleomycin A2 decreases expression ISO Ccl7 (Mus musculus) 6480464 Bleomycin results in decreased expression of CCL7 mRNA CTD PMID:29720568 CCL7 Human Brevianamide A decreases expression ISO Ccl7 (Mus musculus) 6480464 brevianamide A results in decreased expression of CCL7 mRNA CTD PMID:19818335 CCL7 Human bromobenzene decreases expression ISO Ccl7 (Rattus norvegicus) 6480464 bromobenzene results in decreased expression of CCL7 mRNA CTD PMID:32479839 CCL7 Human butanal increases expression EXP 6480464 butyraldehyde results in increased expression of CCL7 mRNA CTD PMID:26079696 CCL7 Human C.I. Natural Red 20 multiple interactions ISO Ccl7 (Mus musculus) 6480464 shikonin inhibits the reaction [Antigen-Antibody Complex results in increased expression of CCL7 mRNA] and shikonin inhibits the reaction [Calcimycin results in increased expression of CCL7 mRNA] CTD PMID:25451590 CCL7 Human C60 fullerene increases expression ISO Ccl7 (Rattus norvegicus) 6480464 fullerene C60 results in increased expression of CCL7 mRNA CTD PMID:19167457 and PMID:20471445 CCL7 Human Calcimycin increases expression ISO Ccl7 (Mus musculus) 6480464 Calcimycin results in increased expression of CCL7 mRNA CTD PMID:25451590 CCL7 Human Calcimycin multiple interactions ISO Ccl7 (Mus musculus) 6480464 shikonin inhibits the reaction [Calcimycin results in increased expression of CCL7 mRNA] CTD PMID:25451590 CCL7 Human calcium atom increases uptake EXP 6480464 CCL7 protein results in increased uptake of Calcium CTD PMID:10984371 CCL7 Human calcium atom multiple interactions EXP 6480464 Piperidines analog inhibits the reaction [CCL7 protein results in increased uptake of Calcium] CTD PMID:10843593 CCL7 Human calcium(0) increases uptake EXP 6480464 CCL7 protein results in increased uptake of Calcium CTD PMID:10984371 CCL7 Human calcium(0) multiple interactions EXP 6480464 Piperidines analog inhibits the reaction [CCL7 protein results in increased uptake of Calcium] CTD PMID:10843593 CCL7 Human cannabidiol decreases expression ISO Ccl7 (Mus musculus) 6480464 Cannabidiol results in decreased expression of CCL7 mRNA CTD PMID:21542829 CCL7 Human cannabidiol multiple interactions EXP 6480464 Cannabidiol inhibits the reaction [TNF protein results in increased expression of CCL7 mRNA] CTD PMID:31250491 CCL7 Human carbofuran increases expression ISO Ccl7 (Rattus norvegicus) 6480464 Carbofuran results in increased expression of CCL7 mRNA CTD PMID:20211217 CCL7 Human carbon nanotube increases expression ISO Ccl7 (Mus musculus) 6480464 Nanotubes more ... CTD PMID:25554681 CCL7 Human carbon nanotube increases expression EXP 6480464 Nanotubes and Carbon results in increased expression of CCL7 mRNA CTD PMID:29348435 CCL7 Human carbon nanotube increases expression ISO Ccl7 (Rattus norvegicus) 6480464 Nanotubes and Carbon results in increased expression of CCL7 mRNA CTD PMID:19836432 and PMID:24911292 CCL7 Human ceric oxide increases expression ISO Ccl7 (Rattus norvegicus) 6480464 ceric oxide results in increased expression of CCL7 mRNA CTD PMID:29463257 CCL7 Human CGP 52608 multiple interactions EXP 6480464 CGP 52608 promotes the reaction [RORA protein binds to CCL7 gene] CTD PMID:28238834 CCL7 Human chenodeoxycholic acid multiple interactions ISO Ccl7 (Mus musculus) 6480464 EGR1 promotes the reaction [Chenodeoxycholic Acid results in increased expression of CCL7 mRNA] CTD PMID:21224055 CCL7 Human chenodeoxycholic acid increases expression ISO Ccl7 (Mus musculus) 6480464 Chenodeoxycholic Acid results in increased expression of CCL7 mRNA CTD PMID:21224055 CCL7 Human chlorpyrifos decreases expression ISO Ccl7 (Mus musculus) 6480464 Chlorpyrifos results in decreased expression of CCL7 mRNA CTD PMID:37019170 CCL7 Human cholesterol multiple interactions ISO Ccl7 (Mus musculus) 6480464 [Cholesterol co-treated with 1 and 2-dioleoyloxy-3-(trimethylammonium)propane] results in increased expression of CCL7 mRNA CTD PMID:22129739 CCL7 Human choline multiple interactions ISO Ccl7 (Mus musculus) 6480464 [Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in increased expression of CCL7 mRNA CTD PMID:20938992 CCL7 Human cisplatin decreases expression ISO Ccl7 (Rattus norvegicus) 6480464 Cisplatin results in decreased expression of CCL7 mRNA CTD PMID:22023808 CCL7 Human cobalt atom multiple interactions ISO Ccl7 (Mus musculus) 6480464 [Zinc co-treated with Nickel co-treated with Cobalt co-treated with 1-Methyl-3-isobutylxanthine co-treated with Dexamethasone co-treated with INS1 protein] results in decreased expression of CCL7 mRNA and TNF protein promotes the reaction [[Zinc co-treated with Nickel co-treated with Cobalt co-treated with 1-Methyl-3-isobutylxanthine co-treated with Dexamethasone co-treated with INS1 protein] results in decreased expression of CCL7 mRNA] CTD PMID:23503329 CCL7 Human copper atom decreases expression ISO Ccl7 (Rattus norvegicus) 6480464 Copper results in decreased expression of CCL7 mRNA CTD PMID:30556269 CCL7 Human copper(0) decreases expression ISO Ccl7 (Rattus norvegicus) 6480464 Copper results in decreased expression of CCL7 mRNA CTD PMID:30556269 CCL7 Human cyclophosphamide increases expression ISO Ccl7 (Mus musculus) 6480464 Cyclophosphamide results in increased expression of CCL7 mRNA CTD PMID:15331540 and PMID:21041162 CCL7 Human cyclosporin A increases expression ISO Ccl7 (Mus musculus) 6480464 Cyclosporine results in increased expression of CCL7 mRNA CTD PMID:23958496 CCL7 Human cypermethrin multiple interactions ISO Ccl7 (Mus musculus) 6480464 cypermethrin promotes the reaction [Lipopolysaccharides results in increased expression of CCL7 mRNA] CTD PMID:29471534 CCL7 Human D-glucose multiple interactions ISO Ccl7 (Mus musculus) 6480464 [lard co-treated with Cholesterol and Dietary co-treated with Dietary Sucrose co-treated with Fructose co-treated with Glucose] results in increased expression of CCL7 mRNA CTD PMID:37567420 CCL7 Human deoxycholic acid increases expression ISO Ccl7 (Mus musculus) 6480464 Deoxycholic Acid results in increased expression of CCL7 mRNA CTD PMID:21224055 CCL7 Human deoxycholic acid multiple interactions ISO Ccl7 (Mus musculus) 6480464 EGR1 promotes the reaction [Deoxycholic Acid results in increased expression of CCL7 mRNA] CTD PMID:21224055 CCL7 Human deoxynivalenol multiple interactions ISO Ccl7 (Mus musculus) 6480464 Fatty Acids and Omega-3 inhibits the reaction [deoxynivalenol results in increased expression of CCL7 mRNA] CTD PMID:15681167 CCL7 Human deoxynivalenol increases expression ISO Ccl7 (Mus musculus) 6480464 deoxynivalenol results in increased expression of CCL7 mRNA CTD PMID:15371230 more ... CCL7 Human dexamethasone multiple interactions ISO Ccl7 (Mus musculus) 6480464 [Dexamethasone co-treated with Rosiglitazone co-treated with 1-Methyl-3-isobutylxanthine co-treated with INS1 protein] results in decreased expression of CCL7 mRNA more ... CTD PMID:16054899 and PMID:23503329 CCL7 Human dexamethasone decreases expression ISO Ccl7 (Mus musculus) 6480464 Dexamethasone results in decreased expression of CCL7 mRNA CTD PMID:22733784 CCL7 Human dextran sulfate increases expression ISO Ccl7 (Mus musculus) 6480464 Dextran Sulfate results in increased expression of CCL7 mRNA CTD PMID:19645018 and PMID:32033881 CCL7 Human dextran sulfate multiple interactions ISO Ccl7 (Mus musculus) 6480464 [titanium dioxide co-treated with Azoxymethane co-treated with Dextran Sulfate] results in decreased expression of CCL7 mRNA and Qingdai compound inhibits the reaction [Dextran Sulfate results in increased expression of CCL7 mRNA] CTD PMID:29950665 and PMID:32033881 CCL7 Human diarsenic trioxide multiple interactions EXP 6480464 [Arsenic Trioxide co-treated with Tretinoin] results in increased expression of CCL7 mRNA and [Arsenic Trioxide co-treated with Tretinoin] results in increased expression of CCL7 protein CTD PMID:19828696 CCL7 Human diarsenic trioxide increases expression ISO Ccl7 (Mus musculus) 6480464 Arsenic Trioxide results in increased expression of CCL7 protein CTD PMID:37166470 CCL7 Human diarsenic trioxide increases expression EXP 6480464 Arsenic Trioxide results in increased expression of CCL7 mRNA and Arsenic Trioxide results in increased expression of CCL7 protein CTD PMID:19828696 CCL7 Human dichlorine increases expression ISO Ccl7 (Mus musculus) 6480464 Chlorine results in increased expression of CCL7 mRNA CTD PMID:30189237 CCL7 Human dichromium trioxide increases secretion EXP 6480464 chromic oxide analog results in increased secretion of CCL7 protein CTD PMID:24885771 CCL7 Human diethyl malate affects expression ISO Ccl7 (Mus musculus) 6480464 diethyl malate affects the expression of CCL7 mRNA CTD PMID:24814887 CCL7 Human diethylstilbestrol decreases expression ISO Ccl7 (Rattus norvegicus) 6480464 Diethylstilbestrol results in decreased expression of CCL7 mRNA CTD PMID:21658437 CCL7 Human diethylstilbestrol increases expression ISO Ccl7 (Rattus norvegicus) 6480464 Diethylstilbestrol results in increased expression of CCL7 mRNA CTD PMID:17010207 CCL7 Human dioxygen multiple interactions ISO Ccl7 (Mus musculus) 6480464 [NFE2L2 protein affects the susceptibility to Oxygen] which affects the expression of CCL7 mRNA CTD PMID:30529165 CCL7 Human doxorubicin increases expression ISO Ccl7 (Rattus norvegicus) 6480464 Doxorubicin results in increased expression of CCL7 mRNA CTD PMID:20211217 CCL7 Human doxorubicin increases expression ISO Ccl7 (Mus musculus) 6480464 Doxorubicin results in increased expression of CCL7 mRNA CTD PMID:36227756 CCL7 Human doxorubicin decreases expression EXP 6480464 Doxorubicin results in decreased expression of CCL7 mRNA CTD PMID:29803840 CCL7 Human endosulfan decreases expression ISO Ccl7 (Rattus norvegicus) 6480464 Endosulfan results in decreased expression of CCL7 mRNA CTD PMID:29391264 CCL7 Human ethanol multiple interactions ISO Ccl7 (Mus musculus) 6480464 [Carbon Tetrachloride co-treated with Ethanol] results in increased expression of CCL7 mRNA CTD PMID:30517762 CCL7 Human fentanyl increases expression ISO Ccl7 (Rattus norvegicus) 6480464 Fentanyl results in increased expression of CCL7 mRNA CTD PMID:36032789 CCL7 Human fenvalerate increases expression ISO Ccl7 (Rattus norvegicus) 6480464 fenvalerate results in increased expression of CCL7 mRNA CTD PMID:30307764 CCL7 Human ferric oxide increases secretion EXP 6480464 ferric oxide results in increased secretion of CCL7 protein CTD PMID:24885771 CCL7 Human ferric oxide multiple interactions ISO Ccl7 (Mus musculus) 6480464 ferric oxide results in increased expression of and results in increased secretion of CCL7 protein and RAG1 inhibits the reaction [ferric oxide analog results in increased expression of CCL7 protein] CTD PMID:34982504 and PMID:36935073 CCL7 Human ferric oxide increases expression ISO Ccl7 (Rattus norvegicus) 6480464 ferric oxide analog results in increased expression of CCL7 mRNA CTD PMID:38615722 CCL7 Human flumequine multiple interactions ISO Ccl7 (Mus musculus) 6480464 [flumequine co-treated with 2-amino-3 more ... CTD PMID:23681119 CCL7 Human fluoranthene multiple interactions ISO Ccl7 (Mus musculus) 6480464 [1-methylanthracene co-treated with fluoranthene] results in increased expression of CCL7 mRNA and SB 203580 inhibits the reaction [[1-methylanthracene co-treated with fluoranthene] results in increased expression of CCL7 mRNA] CTD PMID:28329830 CCL7 Human folic acid multiple interactions ISO Ccl7 (Mus musculus) 6480464 [Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in increased expression of CCL7 mRNA CTD PMID:20938992 CCL7 Human folic acid increases expression ISO Ccl7 (Mus musculus) 6480464 Folic Acid results in increased expression of CCL7 mRNA CTD PMID:25629700 CCL7 Human fructose multiple interactions ISO Ccl7 (Mus musculus) 6480464 [lard co-treated with Cholesterol and Dietary co-treated with Dietary Sucrose co-treated with Fructose co-treated with Glucose] results in increased expression of CCL7 mRNA CTD PMID:37567420 CCL7 Human furan increases expression ISO Ccl7 (Rattus norvegicus) 6480464 furan results in increased expression of CCL7 mRNA CTD PMID:27387713 CCL7 Human Fusarenone X increases expression ISO Ccl7 (Mus musculus) 6480464 fusarenon-X results in increased expression of CCL7 mRNA CTD PMID:24793808 CCL7 Human gadodiamide hydrate increases expression ISO Ccl7 (Rattus norvegicus) 6480464 gadodiamide results in increased expression of CCL7 protein CTD PMID:20938346 CCL7 Human gentamycin decreases expression ISO Ccl7 (Rattus norvegicus) 6480464 Gentamicins results in decreased expression of CCL7 protein CTD PMID:25051504 CCL7 Human gentamycin increases expression ISO Ccl7 (Rattus norvegicus) 6480464 Gentamicins results in increased expression of CCL7 mRNA CTD PMID:33387578 CCL7 Human glucose multiple interactions ISO Ccl7 (Mus musculus) 6480464 [lard co-treated with Cholesterol and Dietary co-treated with Dietary Sucrose co-treated with Fructose co-treated with Glucose] results in increased expression of CCL7 mRNA CTD PMID:37567420 CCL7 Human gold atom multiple interactions ISO Ccl7 (Mus musculus) 6480464 [Gold co-treated with Silicon Dioxide] results in increased secretion of CCL7 protein CTD PMID:22155353 CCL7 Human gold atom increases secretion ISO Ccl7 (Mus musculus) 6480464 Gold results in increased secretion of CCL7 protein CTD PMID:22155353 CCL7 Human gold(0) multiple interactions ISO Ccl7 (Mus musculus) 6480464 [Gold co-treated with Silicon Dioxide] results in increased secretion of CCL7 protein CTD PMID:22155353 CCL7 Human gold(0) increases secretion ISO Ccl7 (Mus musculus) 6480464 Gold results in increased secretion of CCL7 protein CTD PMID:22155353 CCL7 Human graphene oxide increases expression ISO Ccl7 (Mus musculus) 6480464 graphene oxide results in increased expression of CCL7 mRNA CTD PMID:33227293 CCL7 Human GW 4064 increases expression ISO Ccl7 (Mus musculus) 6480464 GW 4064 results in increased expression of CCL7 mRNA CTD PMID:26655953 CCL7 Human hydrogen peroxide increases expression EXP 6480464 Hydrogen Peroxide results in increased expression of CCL7 mRNA CTD PMID:32949572 CCL7 Human hydrogen peroxide increases expression ISO Ccl7 (Mus musculus) 6480464 Hydrogen Peroxide results in increased expression of CCL7 mRNA CTD PMID:35123994 CCL7 Human iodixanol increases expression ISO Ccl7 (Mus musculus) 6480464 iodixanol results in increased expression of CCL7 protein CTD PMID:34774977 CCL7 Human isoprenaline increases expression ISO Ccl7 (Rattus norvegicus) 6480464 Isoproterenol results in increased expression of CCL7 mRNA CTD PMID:20211217 and PMID:24286936 CCL7 Human isoprenaline decreases expression EXP 6480464 Isoproterenol results in decreased expression of CCL7 mRNA CTD PMID:24286936 CCL7 Human L-methionine multiple interactions ISO Ccl7 (Mus musculus) 6480464 [Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in increased expression of CCL7 mRNA CTD PMID:20938992 CCL7 Human lipopolysaccharide increases secretion EXP 6480464 Lipopolysaccharides results in increased secretion of CCL7 protein CTD PMID:32800949 CCL7 Human lipopolysaccharide increases expression ISO Ccl7 (Mus musculus) 6480464 Lipopolysaccharides results in increased expression of CCL7 mRNA CTD PMID:22169119 more ... CCL7 Human lipopolysaccharide multiple interactions ISO Ccl7 (Mus musculus) 6480464 (+)-JQ1 compound inhibits the reaction [Lipopolysaccharides results in increased expression of CCL7 mRNA] more ... CTD PMID:22169119 more ... CCL7 Human lipopolysaccharide multiple interactions EXP 6480464 2'-hydroxyflavanone inhibits the reaction [Lipopolysaccharides results in increased secretion of CCL7 protein] more ... CTD PMID:18437699 more ... CCL7 Human malathion increases expression EXP 6480464 Malathion results in increased expression of CCL7 mRNA CTD PMID:37047231 CCL7 Human manganese atom increases expression EXP 6480464 Manganese results in increased expression of CCL7 mRNA CTD PMID:17175027 CCL7 Human manganese(0) increases expression EXP 6480464 Manganese results in increased expression of CCL7 mRNA CTD PMID:17175027 CCL7 Human manganese(II) chloride increases expression EXP 6480464 manganese chloride results in increased expression of CCL7 mRNA CTD PMID:17175027 CCL7 Human manganese(II) chloride increases expression ISO Ccl7 (Rattus norvegicus) 6480464 manganese chloride results in increased expression of CCL7 mRNA CTD PMID:28801915 CCL7 Human MeIQx multiple interactions ISO Ccl7 (Mus musculus) 6480464 [flumequine co-treated with 2-amino-3 more ... CTD PMID:23681119 CCL7 Human mercury atom multiple interactions ISO Ccl7 (Mus musculus) 6480464 [MT3 protein affects the susceptibility to Mercury] which affects the expression of CCL7 mRNA CTD PMID:30103553 CCL7 Human mercury(0) multiple interactions ISO Ccl7 (Mus musculus) 6480464 [MT3 protein affects the susceptibility to Mercury] which affects the expression of CCL7 mRNA CTD PMID:30103553 CCL7 Human metacetamol decreases expression ISO Ccl7 (Mus musculus) 6480464 3-hydroxyacetanilide results in decreased expression of CCL7 mRNA CTD PMID:18544908 CCL7 Human metformin multiple interactions ISO Ccl7 (Mus musculus) 6480464 Metformin inhibits the reaction [IL13 protein results in increased expression of CCL7 mRNA] CTD PMID:26497364 CCL7 Human methylmercury chloride increases expression ISO Ccl7 (Mus musculus) 6480464 methylmercuric chloride results in increased expression of CCL7 mRNA CTD PMID:24213012 and PMID:30103553 CCL7 Human methylmercury chloride increases expression ISO Ccl7 (Rattus norvegicus) 6480464 methylmercuric chloride results in increased expression of CCL7 mRNA CTD PMID:31378766 CCL7 Human microcystin-LR increases expression ISO Ccl7 (Mus musculus) 6480464 cyanoginosin LR results in increased expression of CCL7 mRNA CTD PMID:37342990 CCL7 Human Muraglitazar decreases expression ISO Ccl7 (Rattus norvegicus) 6480464 muraglitazar results in decreased expression of CCL7 mRNA CTD PMID:21515302 CCL7 Human mycophenolic acid decreases expression ISO Ccl7 (Mus musculus) 6480464 Mycophenolic Acid results in decreased expression of CCL7 mRNA CTD PMID:19818335 CCL7 Human mycotoxin decreases expression ISO Ccl7 (Mus musculus) 6480464 Mycotoxins results in decreased expression of CCL7 mRNA CTD PMID:19818335 CCL7 Human N-methyl-4-phenylpyridinium decreases expression ISO Ccl7 (Rattus norvegicus) 6480464 1-Methyl-4-phenylpyridinium results in decreased expression of CCL7 mRNA CTD PMID:28801915 CCL7 Human N-nitrosodimethylamine increases expression ISO Ccl7 (Rattus norvegicus) 6480464 Dimethylnitrosamine results in increased expression of CCL7 protein CTD PMID:17719030 CCL7 Human naphthalene increases expression ISO Ccl7 (Mus musculus) 6480464 naphthalene results in increased expression of CCL7 mRNA CTD PMID:18978301 CCL7 Human neocuproine multiple interactions ISO Ccl7 (Mus musculus) 6480464 neocuproine inhibits the reaction [lipopolysaccharide more ... CTD PMID:23604539 CCL7 Human neoechinulin A decreases expression ISO Ccl7 (Mus musculus) 6480464 neoechinulin A results in decreased expression of CCL7 mRNA CTD PMID:19818335 CCL7 Human nickel atom multiple interactions ISO Ccl7 (Mus musculus) 6480464 [Zinc co-treated with Nickel co-treated with Cobalt co-treated with 1-Methyl-3-isobutylxanthine co-treated with Dexamethasone co-treated with INS1 protein] results in decreased expression of CCL7 mRNA and TNF protein promotes the reaction [[Zinc co-treated with Nickel co-treated with Cobalt co-treated with 1-Methyl-3-isobutylxanthine co-treated with Dexamethasone co-treated with INS1 protein] results in decreased expression of CCL7 mRNA] CTD PMID:23503329 CCL7 Human nickel atom increases expression EXP 6480464 Nickel results in increased expression of CCL7 mRNA CTD PMID:24768652 and PMID:25583101 CCL7 Human nickel dichloride decreases secretion EXP 6480464 nickel chloride results in decreased secretion of CCL7 protein CTD PMID:18437699 CCL7 Human nickel dichloride multiple interactions EXP 6480464 [nickel chloride co-treated with Lipopolysaccharides] results in increased secretion of CCL7 protein more ... CTD PMID:18437699 and PMID:23090859 CCL7 Human nickel sulfate increases expression ISO Ccl7 (Mus musculus) 6480464 nickel sulfate results in increased expression of CCL7 mRNA CTD PMID:16166746 CCL7 Human oxaliplatin multiple interactions ISO Ccl7 (Rattus norvegicus) 6480464 [oxaliplatin co-treated with Topotecan] results in increased expression of CCL7 mRNA CTD PMID:25729387 CCL7 Human ozone increases response to substance ISO Ccl7 (Mus musculus) 6480464 CCL7 protein results in increased susceptibility to Ozone CTD PMID:11777981 CCL7 Human ozone multiple interactions ISO Ccl7 (Mus musculus) 6480464 [Air Pollutants results in increased abundance of [Ozone co-treated with Soot]] which results in increased expression of CCL7 mRNA more ... CTD PMID:25658374 more ... CCL7 Human ozone increases expression ISO Ccl7 (Mus musculus) 6480464 Ozone results in increased expression of CCL7 mRNA and Ozone results in increased expression of CCL7 protein CTD PMID:11777981 more ... CCL7 Human paracetamol multiple interactions ISO Ccl7 (Mus musculus) 6480464 CCR2 protein affects the reaction [Acetaminophen results in increased expression of CCL7 protein] and MAP3K5 protein affects the reaction [Acetaminophen results in increased expression of CCL7 mRNA] CTD PMID:11981759 and PMID:18700144 CCL7 Human paracetamol decreases expression ISO Ccl7 (Rattus norvegicus) 6480464 Acetaminophen results in decreased expression of CCL7 mRNA CTD PMID:33387578 CCL7 Human paracetamol affects expression ISO Ccl7 (Mus musculus) 6480464 Acetaminophen affects the expression of CCL7 mRNA CTD PMID:17562736 CCL7 Human paracetamol increases expression ISO Ccl7 (Mus musculus) 6480464 Acetaminophen results in increased expression of CCL7 mRNA and Acetaminophen results in increased expression of CCL7 protein CTD PMID:11981759 and PMID:18544908 CCL7 Human paraquat increases expression ISO Ccl7 (Rattus norvegicus) 6480464 Paraquat results in increased expression of CCL7 mRNA CTD PMID:32680482 CCL7 Human pentanal increases expression EXP 6480464 pentanal results in increased expression of CCL7 mRNA CTD PMID:26079696 CCL7 Human perfluorohexanesulfonic acid increases expression ISO Ccl7 (Mus musculus) 6480464 perfluorohexanesulfonic acid results in increased expression of CCL7 mRNA CTD PMID:37995155 CCL7 Human perfluorooctane-1-sulfonic acid decreases expression EXP 6480464 perfluorooctane sulfonic acid results in decreased expression of CCL7 mRNA CTD PMID:32219433 CCL7 Human perfluorooctane-1-sulfonic acid decreases secretion EXP 6480464 perfluorooctane sulfonic acid results in decreased secretion of CCL7 protein CTD PMID:32219433 CCL7 Human perfluorooctanoic acid multiple interactions ISO Ccl7 (Rattus norvegicus) 6480464 [Zeranol co-treated with perfluorooctanoic acid] results in increased expression of CCL7 mRNA CTD PMID:35163327 CCL7 Human perfluorooctanoic acid decreases expression EXP 6480464 perfluorooctanoic acid results in decreased expression of CCL7 mRNA CTD PMID:32219433 CCL7 Human perfluorooctanoic acid decreases secretion EXP 6480464 perfluorooctanoic acid results in decreased secretion of CCL7 protein CTD PMID:32219433 CCL7 Human perfluorooctanoic acid increases expression ISO Ccl7 (Rattus norvegicus) 6480464 perfluorooctanoic acid results in increased expression of CCL7 mRNA CTD PMID:35163327 CCL7 Human pioglitazone multiple interactions ISO Ccl7 (Mus musculus) 6480464 [N-nitroso-tris-chloroethylurea co-treated with pioglitazone] results in increased expression of CCL7 mRNA CTD PMID:27935865 CCL7 Human piperidines multiple interactions EXP 6480464 Piperidines analog inhibits the reaction [CCL7 protein results in increased uptake of Calcium] CTD PMID:10843593 CCL7 Human polymyxin B2 multiple interactions ISO Ccl7 (Mus musculus) 6480464 Polymyxin B inhibits the reaction [[Ovalbumin co-treated with Dust] results in increased expression of CCL7 protein] CTD PMID:26882889 CCL7 Human potassium dichromate increases expression ISO Ccl7 (Mus musculus) 6480464 Potassium Dichromate results in increased expression of CCL7 mRNA CTD PMID:23608068 CCL7 Human procyanidin B3 multiple interactions ISO Ccl7 (Mus musculus) 6480464 [procyanidin B3 co-treated with Eicosapentaenoic Acid] inhibits the reaction [Lipopolysaccharides results in increased expression of CCL7 mRNA] CTD PMID:22169119 CCL7 Human propanal increases expression EXP 6480464 propionaldehyde results in increased expression of CCL7 mRNA CTD PMID:26079696 CCL7 Human quartz increases expression ISO Ccl7 (Rattus norvegicus) 6480464 Quartz results in increased expression of CCL7 mRNA CTD PMID:19836432 and PMID:32976597 CCL7 Human quartz multiple interactions ISO Ccl7 (Rattus norvegicus) 6480464 Tobacco Smoke Pollution promotes the reaction [Quartz results in increased expression of CCL7 mRNA] CTD PMID:32976597 CCL7 Human resveratrol increases expression ISO Ccl7 (Mus musculus) 6480464 resveratrol results in increased expression of CCL7 mRNA CTD PMID:11588890 CCL7 Human S-(1,2-dichlorovinyl)-L-cysteine multiple interactions EXP 6480464 [S-(1 and 2-dichlorovinyl)cysteine affects the susceptibility to Lipopolysaccharides] which results in increased expression of CCL7 mRNA CTD PMID:35811015 CCL7 Human SB 203580 multiple interactions ISO Ccl7 (Mus musculus) 6480464 SB 203580 inhibits the reaction [[1-methylanthracene co-treated with fluoranthene] results in increased expression of CCL7 mRNA] CTD PMID:28329830 CCL7 Human Shikonin multiple interactions ISO Ccl7 (Mus musculus) 6480464 shikonin inhibits the reaction [Antigen-Antibody Complex results in increased expression of CCL7 mRNA] and shikonin inhibits the reaction [Calcimycin results in increased expression of CCL7 mRNA] CTD PMID:25451590 CCL7 Human silicon dioxide decreases expression EXP 6480464 Silicon Dioxide analog results in decreased expression of CCL7 mRNA CTD PMID:25895662 CCL7 Human silicon dioxide increases expression ISO Ccl7 (Mus musculus) 6480464 Silicon Dioxide results in increased expression of CCL7 mRNA CTD PMID:23221170 and PMID:29341224 CCL7 Human silicon dioxide multiple interactions ISO Ccl7 (Mus musculus) 6480464 [Gold co-treated with Silicon Dioxide] results in increased secretion of CCL7 protein CTD PMID:22155353 CCL7 Human silicon dioxide increases expression ISO Ccl7 (Rattus norvegicus) 6480464 Silicon Dioxide results in increased expression of CCL7 mRNA CTD PMID:22431001 CCL7 Human silver atom decreases expression ISO Ccl7 (Mus musculus) 6480464 Silver results in decreased expression of CCL7 mRNA CTD PMID:27131904 CCL7 Human silver(0) decreases expression ISO Ccl7 (Mus musculus) 6480464 Silver results in decreased expression of CCL7 mRNA CTD PMID:27131904 CCL7 Human sodium arsenite increases expression ISO Ccl7 (Mus musculus) 6480464 sodium arsenite results in increased expression of CCL7 mRNA CTD PMID:21911445 CCL7 Human sodium arsenite decreases expression ISO Ccl7 (Mus musculus) 6480464 sodium arsenite results in decreased expression of CCL7 mRNA CTD PMID:37682722 CCL7 Human sodium arsenite affects expression EXP 6480464 sodium arsenite affects the expression of CCL7 mRNA CTD PMID:34032870 CCL7 Human sodium arsenite increases expression EXP 6480464 sodium arsenite results in increased expression of CCL7 mRNA CTD PMID:28595984 CCL7 Human succimer multiple interactions ISO Ccl7 (Mus musculus) 6480464 [Succimer binds to Magnetite Nanoparticles] which results in increased expression of CCL7 mRNA and [Succimer co-treated with Magnetite Nanoparticles] results in increased expression of CCL7 mRNA CTD PMID:21641980 and PMID:26378955 CCL7 Human tacrolimus hydrate increases expression ISO Ccl7 (Mus musculus) 6480464 Tacrolimus results in increased expression of CCL7 mRNA CTD PMID:23958496 and PMID:29362864 CCL7 Human tamoxifen decreases expression ISO Ccl7 (Mus musculus) 6480464 Tamoxifen results in decreased expression of CCL7 mRNA CTD PMID:25123088 CCL7 Human taurocholic acid multiple interactions ISO Ccl7 (Mus musculus) 6480464 EGR1 promotes the reaction [Taurocholic Acid results in increased expression of CCL7 mRNA] CTD PMID:21224055 CCL7 Human taurocholic acid increases expression ISO Ccl7 (Mus musculus) 6480464 Taurocholic Acid results in increased expression of CCL7 mRNA CTD PMID:21224055 CCL7 Human testosterone decreases expression ISO Ccl7 (Mus musculus) 6480464 Testosterone results in decreased expression of CCL7 mRNA CTD PMID:19693291 CCL7 Human testosterone multiple interactions ISO Ccl7 (Rattus norvegicus) 6480464 [estradiol 3-benzoate co-treated with [Testosterone co-treated with Estradiol]] results in increased expression of CCL7 mRNA CTD PMID:32741896 CCL7 Human tetrachloromethane increases expression ISO Ccl7 (Mus musculus) 6480464 Carbon Tetrachloride results in increased expression of CCL7 mRNA CTD PMID:17484886 CCL7 Human tetrachloromethane increases expression ISO Ccl7 (Rattus norvegicus) 6480464 Carbon Tetrachloride results in increased expression of CCL7 mRNA CTD PMID:31150632 CCL7 Human tetrachloromethane multiple interactions ISO Ccl7 (Mus musculus) 6480464 [Carbon Tetrachloride co-treated with Ethanol] results in increased expression of CCL7 mRNA CTD PMID:30517762 CCL7 Human thioacetamide increases expression ISO Ccl7 (Rattus norvegicus) 6480464 Thioacetamide results in increased expression of CCL7 mRNA and Thioacetamide results in increased expression of CCL7 protein CTD PMID:25051504 and PMID:34492290 CCL7 Human titanium dioxide increases expression ISO Ccl7 (Mus musculus) 6480464 titanium dioxide results in increased expression of CCL7 mRNA CTD PMID:19464567 more ... CCL7 Human titanium dioxide multiple interactions ISO Ccl7 (Mus musculus) 6480464 [titanium dioxide co-treated with Azoxymethane co-treated with Dextran Sulfate] results in decreased expression of CCL7 mRNA CTD PMID:29950665 CCL7 Human titanium dioxide increases expression ISO Ccl7 (Rattus norvegicus) 6480464 titanium dioxide results in increased expression of CCL7 mRNA CTD PMID:30012374 CCL7 Human titanium dioxide decreases expression ISO Ccl7 (Mus musculus) 6480464 titanium dioxide results in decreased expression of CCL7 mRNA CTD PMID:29264374 CCL7 Human TMC-120A decreases expression ISO Ccl7 (Mus musculus) 6480464 TMC 120A results in decreased expression of CCL7 mRNA CTD PMID:19818335 CCL7 Human toluene 2,4-diisocyanate increases expression ISO Ccl7 (Mus musculus) 6480464 Toluene 2 and 4-Diisocyanate results in increased expression of CCL7 mRNA CTD PMID:19647056 and PMID:21404309 CCL7 Human topotecan increases expression ISO Ccl7 (Rattus norvegicus) 6480464 Topotecan results in increased expression of CCL7 mRNA CTD PMID:25729387 CCL7 Human topotecan multiple interactions ISO Ccl7 (Rattus norvegicus) 6480464 [oxaliplatin co-treated with Topotecan] results in increased expression of CCL7 mRNA CTD PMID:25729387 CCL7 Human tributylstannane decreases expression ISO Ccl7 (Rattus norvegicus) 6480464 tributyltin results in decreased expression of CCL7 mRNA CTD PMID:21683754 CCL7 Human trichloroethene increases expression ISO Ccl7 (Rattus norvegicus) 6480464 Trichloroethylene results in increased expression of CCL7 mRNA CTD PMID:33387578 CCL7 Human trimellitic anhydride increases expression ISO Ccl7 (Rattus norvegicus) 6480464 trimellitic anhydride results in increased expression of CCL7 mRNA CTD PMID:21893156 CCL7 Human troglitazone decreases expression ISO Ccl7 (Rattus norvegicus) 6480464 troglitazone results in decreased expression of CCL7 mRNA CTD PMID:21515302 CCL7 Human valproic acid decreases methylation EXP 6480464 Valproic Acid results in decreased methylation of CCL7 gene CTD PMID:29154799 CCL7 Human XL147 multiple interactions ISO Ccl7 (Mus musculus) 6480464 [N-nitroso-tris-chloroethylurea co-treated with XL147] results in increased expression of CCL7 mRNA CTD PMID:27935865 CCL7 Human zinc atom multiple interactions ISO Ccl7 (Mus musculus) 6480464 [Zinc co-treated with Nickel co-treated with Cobalt co-treated with 1-Methyl-3-isobutylxanthine co-treated with Dexamethasone co-treated with INS1 protein] results in decreased expression of CCL7 mRNA and TNF protein promotes the reaction [[Zinc co-treated with Nickel co-treated with Cobalt co-treated with 1-Methyl-3-isobutylxanthine co-treated with Dexamethasone co-treated with INS1 protein] results in decreased expression of CCL7 mRNA] CTD PMID:23503329 CCL7 Human zinc(0) multiple interactions ISO Ccl7 (Mus musculus) 6480464 [Zinc co-treated with Nickel co-treated with Cobalt co-treated with 1-Methyl-3-isobutylxanthine co-treated with Dexamethasone co-treated with INS1 protein] results in decreased expression of CCL7 mRNA and TNF protein promotes the reaction [[Zinc co-treated with Nickel co-treated with Cobalt co-treated with 1-Methyl-3-isobutylxanthine co-treated with Dexamethasone co-treated with INS1 protein] results in decreased expression of CCL7 mRNA] CTD PMID:23503329
1,2-dimethylhydrazine (ISO) 1,4-phenylenediamine (EXP) 1-chloro-2,4-dinitrobenzene (ISO) 15-acetyldeoxynivalenol (ISO) 17alpha-ethynylestradiol (ISO) 17beta-estradiol (ISO) 17beta-estradiol 3-benzoate (ISO) 2,2',4,4',5,5'-hexachlorobiphenyl (EXP) 2,2',4,4'-Tetrabromodiphenyl ether (EXP,ISO) 2,2',5,5'-tetrachlorobiphenyl (EXP) 2,3,7,8-tetrachlorodibenzodioxine (EXP,ISO) 2,4,6-trinitrobenzenesulfonic acid (ISO) 2,4-dibromophenyl 2,4,5-tribromophenyl ether (ISO) 2,4-dinitrobenzenesulfonic acid (ISO) 2-acetamidofluorene (ISO) 2-amino-2-deoxy-D-glucopyranose (ISO) 3'-amino-3'-deoxy-N(6),N(6)-dimethyladenosine (ISO) 3-acetyldeoxynivalenol (ISO) 3-isobutyl-1-methyl-7H-xanthine (ISO) 3-methylcholanthrene (ISO) 4,4'-sulfonyldiphenol (ISO) 4-(ethoxymethylene)-2-phenyloxazol-5-one (ISO) 4-hydroxynon-2-enal (ISO) 4-hydroxyphenyl retinamide (ISO) 4-nitroquinoline N-oxide (ISO) AB-Fubinaca (ISO) abexinostat (EXP) acetamide (ISO) Aeol 10150 (ISO) aflatoxin B1 (EXP,ISO) aldehydo-D-glucosamine (ISO) aldehydo-D-glucose (ISO) all-trans-retinoic acid (EXP) alpha-amanitin (ISO) alpha-Zearalanol (ISO) aluminium atom (ISO) aluminium(0) (ISO) ammonium chloride (ISO) amphibole asbestos (ISO) apocynin (EXP) arsane (EXP,ISO) arsenic atom (EXP,ISO) arsenous acid (EXP,ISO) asperentin (ISO) astemizole (ISO) atrazine (EXP) Azoxymethane (ISO) barium sulfate (ISO) benzalkonium chloride (ISO) benzo[a]pyrene (EXP,ISO) beta-D-glucosamine (ISO) bis(2-chloroethyl) sulfide (EXP,ISO) bisphenol A (EXP,ISO) bisphenol F (ISO) bleomycin A2 (ISO) Brevianamide A (ISO) bromobenzene (ISO) butanal (EXP) C.I. Natural Red 20 (ISO) C60 fullerene (ISO) Calcimycin (ISO) calcium atom (EXP) calcium(0) (EXP) cannabidiol (EXP,ISO) carbofuran (ISO) carbon nanotube (EXP,ISO) ceric oxide (ISO) CGP 52608 (EXP) chenodeoxycholic acid (ISO) chlorpyrifos (ISO) cholesterol (ISO) choline (ISO) cisplatin (ISO) cobalt atom (ISO) copper atom (ISO) copper(0) (ISO) cyclophosphamide (ISO) cyclosporin A (ISO) cypermethrin (ISO) D-glucose (ISO) deoxycholic acid (ISO) deoxynivalenol (ISO) dexamethasone (ISO) dextran sulfate (ISO) diarsenic trioxide (EXP,ISO) dichlorine (ISO) dichromium trioxide (EXP) diethyl malate (ISO) diethylstilbestrol (ISO) dioxygen (ISO) doxorubicin (EXP,ISO) endosulfan (ISO) ethanol (ISO) fentanyl (ISO) fenvalerate (ISO) ferric oxide (EXP,ISO) flumequine (ISO) fluoranthene (ISO) folic acid (ISO) fructose (ISO) furan (ISO) Fusarenone X (ISO) gadodiamide hydrate (ISO) gentamycin (ISO) glucose (ISO) gold atom (ISO) gold(0) (ISO) graphene oxide (ISO) GW 4064 (ISO) hydrogen peroxide (EXP,ISO) iodixanol (ISO) isoprenaline (EXP,ISO) L-methionine (ISO) lipopolysaccharide (EXP,ISO) malathion (EXP) manganese atom (EXP) manganese(0) (EXP) manganese(II) chloride (EXP,ISO) MeIQx (ISO) mercury atom (ISO) mercury(0) (ISO) metacetamol (ISO) metformin (ISO) methylmercury chloride (ISO) microcystin-LR (ISO) Muraglitazar (ISO) mycophenolic acid (ISO) mycotoxin (ISO) N-methyl-4-phenylpyridinium (ISO) N-nitrosodimethylamine (ISO) naphthalene (ISO) neocuproine (ISO) neoechinulin A (ISO) nickel atom (EXP,ISO) nickel dichloride (EXP) nickel sulfate (ISO) oxaliplatin (ISO) ozone (ISO) paracetamol (ISO) paraquat (ISO) pentanal (EXP) perfluorohexanesulfonic acid (ISO) perfluorooctane-1-sulfonic acid (EXP) perfluorooctanoic acid (EXP,ISO) pioglitazone (ISO) piperidines (EXP) polymyxin B2 (ISO) potassium dichromate (ISO) procyanidin B3 (ISO) propanal (EXP) quartz (ISO) resveratrol (ISO) S-(1,2-dichlorovinyl)-L-cysteine (EXP) SB 203580 (ISO) Shikonin (ISO) silicon dioxide (EXP,ISO) silver atom (ISO) silver(0) (ISO) sodium arsenite (EXP,ISO) succimer (ISO) tacrolimus hydrate (ISO) tamoxifen (ISO) taurocholic acid (ISO) testosterone (ISO) tetrachloromethane (ISO) thioacetamide (ISO) titanium dioxide (ISO) TMC-120A (ISO) toluene 2,4-diisocyanate (ISO) topotecan (ISO) tributylstannane (ISO) trichloroethene (ISO) trimellitic anhydride (ISO) troglitazone (ISO) valproic acid (EXP) XL147 (ISO) zinc atom (ISO) zinc(0) (ISO)
1.
Chemokines in the limbal form of vernal keratoconjunctivitis.
Abu El-Asrar AM, etal., Br J Ophthalmol. 2000 Dec;84(12):1360-6.
2.
Antigen-induced differential gene expression in lymphocytes and gene expression profile in synovium prior to the onset of arthritis.
Adarichev VA, etal., Autoimmunity. 2006 Dec;39(8):663-73.
3.
Monocyte chemotactic protein (MCP3) promoter polymorphism is associated with atopic asthma in the Indian population.
Batra J, etal., J Allergy Clin Immunol. 2011 Mar 8.
4.
IL-1beta disrupts postnatal lung morphogenesis in the mouse.
Bry K, etal., Am J Respir Cell Mol Biol. 2007 Jan;36(1):32-42. Epub 2006 Aug 3.
5.
Enhanced monocyte chemoattractant protein-3/CC chemokine ligand-7 in usual interstitial pneumonia.
Choi ES, etal., Am J Respir Crit Care Med. 2004 Sep 1;170(5):508-15. Epub 2004 Jun 10.
6.
Monocyte chemotactic protein-3: possible involvement in apical periodontitis chemotaxis.
Dezerega A, etal., Int Endod J. 2010 Oct;43(10):902-8. doi: 10.1111/j.1365-2591.2010.01764.x. Epub 2010 Jul 15.
7.
Chemokine monocyte chemoattractant protein-3 in progressive periodontal lesions in patients with chronic periodontitis.
Dezerega A, etal., J Periodontol. 2010 Feb;81(2):267-76.
8.
Allergen challenge induces Ifng dependent GTPases in the lungs as part of a Th1 transcriptome response in a murine model of allergic asthma.
Dharajiya N, etal., PLoS One. 2009 Dec 21;4(12):e8172.
9.
Chemokine expression by small sputum macrophages in COPD.
Frankenberger M, etal., Mol Med. 2011;17(7-8):762-70. doi: 10.2119/molmed.2010.00202. Epub 2011 Feb 9.
10.
GOAs Human GO annotations
GOA_HUMAN data from the GO Consortium
11.
Intelectin is required for IL-13-induced monocyte chemotactic protein-1 and -3 expression in lung epithelial cells and promotes allergic airway inflammation.
Gu N, etal., Am J Physiol Lung Cell Mol Physiol. 2010 Mar;298(3):L290-6. Epub 2009 Dec 4.
12.
CC chemokine and CC chemokine receptor profiles in visceral and subcutaneous adipose tissue are altered in human obesity.
Huber J, etal., J Clin Endocrinol Metab. 2008 Aug;93(8):3215-21. Epub 2008 May 20.
13.
Fibrogenic and redox-related but not proinflammatory genes are upregulated in Lewis rat model of chronic silicosis.
Langley RJ, etal., J Toxicol Environ Health A. 2011;74(19):1261-79.
14.
Chemokine induction by all-trans retinoic acid and arsenic trioxide in acute promyelocytic leukemia: triggering the differentiation syndrome.
Luesink M, etal., Blood. 2009 Dec 24;114(27):5512-21. Epub 2009 Oct 14.
15.
MCP-1, MCP-2 and MCP-3 expression in multiple sclerosis lesions: an immunohistochemical and in situ hybridization study.
McManus C, etal., J Neuroimmunol. 1998 Jun 1;86(1):20-9.
16.
Bronchial and bronchiolar fibrosis in rats exposed to 2,3-pentanedione vapors: implications for bronchiolitis obliterans in humans.
Morgan DL, etal., Toxicol Pathol. 2012 Apr;40(3):448-65. Epub 2012 Jan 3.
17.
Gelatinase B, PECAM-1 and MCP-3 gene polymorphisms in Belgian multiple sclerosis.
Nelissen I, etal., J Neurol Sci. 2002 Aug 15;200(1-2):43-8.
18.
Effective methylprednisolone dose in experimental crescentic glomerulonephritis.
Ou ZL, etal., Am J Kidney Dis. 2001 Feb;37(2):411-7.
19.
Transient and sequential expression of chemokine mRNA in glomeruli in puromycin aminonucleoside nephrosis.
Ou ZL, etal., Nephron. 2000 Jul;85(3):254-7.
20.
Elevated expression of platelet-derived chemokines in patients with antiphospholipid syndrome.
Patsouras MD, etal., J Autoimmun. 2015 Dec;65:30-7. doi: 10.1016/j.jaut.2015.08.001. Epub 2015 Aug 15.
21.
Biomarkers of acute respiratory allergen exposure: screening for sensitization potential.
Pucheu-Haston CM, etal., Toxicol Appl Pharmacol. 2010 Apr 15;244(2):144-55. Epub 2010 Jan 4.
22.
Data Import for Chemical-Gene Interactions
RGD automated import pipeline for gene-chemical interactions
23.
Study of plasma protein C and inflammatory pathways: biomarkers for dimethylnitrosamine-induced liver fibrosis in rats.
Saha JK, etal., Eur J Pharmacol. 2007 Dec 1;575(1-3):158-67. Epub 2007 Aug 2.
24.
Role of monocyte chemotactic protein-3 and -4 in children with virus exacerbation of asthma.
Santiago J, etal., Eur Respir J. 2008 Nov;32(5):1243-9. Epub 2008 Jun 25.
25.
Hepatic interferon regulatory factor 8 expression mediates liver ischemia/reperfusion injury in mice.
Shi G, etal., Biochem Pharmacol. 2021 Oct;192:114728. doi: 10.1016/j.bcp.2021.114728. Epub 2021 Aug 13.
26.
The involvement of pro-inflammatory cytokines in nephrogenic systemic fibrosis - a mechanistic hypothesis based on preclinical results from a rat model treated with gadodiamide.
Steger-Hartmann T, etal., Exp Toxicol Pathol. 2009 Nov;61(6):537-52. Epub 2009 Jan 7.
27.
Increased expression of IP-10, IL-8, MCP-1, and MCP-3 in ulcerative colitis.
Uguccioni M, etal., Am J Pathol. 1999 Aug;155(2):331-6.
28.
Strain-specific requirement for eosinophils in the recruitment of T cells to the lung during the development of allergic asthma.
Walsh ER, etal., J Exp Med. 2008 Jun 9;205(6):1285-92. Epub 2008 May 19.
29.
Reduced degradation of the chemokine MCP-3 by matrix metalloproteinase-2 exacerbates myocardial inflammation in experimental viral cardiomyopathy.
Westermann D, etal., Circulation. 2011 Nov 8;124(19):2082-93. Epub 2011 Oct 10.
30.
Monocyte chemotactic protein expression in allergy and non-allergy-associated chronic sinusitis.
Wright ED, etal., J Otolaryngol. 1998 Oct;27(5):281-7.
31.
Plasma IP-10 and MCP-3 levels are highly associated with disease severity and predict the progression of COVID-19.
Yang Y, etal., J Allergy Clin Immunol. 2020 Apr 29. pii: S0091-6749(20)30576-5. doi: 10.1016/j.jaci.2020.04.027.
32.
Activation of microglia and chemokines in light-induced retinal degeneration.
Zhang C, etal., Mol Vis. 2005 Oct 27;11:887-95.
33.
Complementary DNA microarray analysis of chemokines and their receptors in allergic rhinitis.
Zhang RX, etal., J Investig Allergol Clin Immunol. 2007;17(5):329-36.
34.
Heightened Innate Immune Responses in the Respiratory Tract of COVID-19 Patients.
Zhou Z, etal., Cell Host Microbe. 2020 Jun 10;27(6):883-890.e2. doi: 10.1016/j.chom.2020.04.017. Epub 2020 May 4.
CCL7 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 17 34,270,221 - 34,272,242 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 17 34,270,221 - 34,272,242 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 17 32,597,240 - 32,599,261 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 17 29,621,353 - 29,623,369 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 17 29,621,352 - 29,623,368 NCBI Celera 17 29,507,053 - 29,509,069 (+) NCBI Celera Cytogenetic Map 17 q12 NCBI HuRef 17 28,782,528 - 28,784,554 (+) NCBI HuRef CHM1_1 17 32,661,096 - 32,663,122 (+) NCBI CHM1_1 T2T-CHM13v2.0 17 35,216,497 - 35,218,518 (+) NCBI T2T-CHM13v2.0
Ccl7 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 11 81,936,538 - 81,938,351 (+) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 11 81,936,538 - 81,938,351 (+) Ensembl GRCm39 Ensembl GRCm38 11 82,045,712 - 82,047,525 (+) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 11 82,045,712 - 82,047,525 (+) Ensembl GRCm38 mm10 GRCm38 MGSCv37 11 81,859,214 - 81,861,027 (+) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 11 81,861,909 - 81,863,720 (+) NCBI MGSCv36 mm8 Celera 11 91,659,161 - 91,660,974 (+) NCBI Celera Cytogenetic Map 11 C NCBI cM Map 11 49.83 NCBI
Ccl7 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 10 67,514,095 - 67,515,945 (+) NCBI GRCr8 mRatBN7.2 10 67,016,446 - 67,018,296 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 10 67,016,446 - 67,018,303 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 10 71,637,651 - 71,639,501 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 10 71,143,000 - 71,144,850 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 10 66,604,125 - 66,605,975 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 10 69,423,083 - 69,424,933 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 10 69,423,086 - 69,424,979 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 10 69,058,109 - 69,059,959 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 10 70,267,281 - 70,269,131 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 10 70,280,903 - 70,282,754 (+) NCBI Celera 10 65,963,980 - 65,965,830 (+) NCBI Celera Cytogenetic Map 10 q26 NCBI
CCL7 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 9 38,994,638 - 38,996,103 (-) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 9 38,993,911 - 39,010,483 (-) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 9 38,217,925 - 38,219,390 (-) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 9 39,808,818 - 39,810,283 (-) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 9 39,808,231 - 39,824,636 (-) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 9 38,595,171 - 38,596,636 (-) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 9 38,875,478 - 38,879,658 (-) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 9 38,963,214 - 38,964,679 (-) NCBI UU_Cfam_GSD_1.0
CCL7
.
Predicted Target Of
Count of predictions: 713 Count of miRNA genes: 202 Interacting mature miRNAs: 216 Transcripts: ENST00000200307, ENST00000378569, ENST00000394627, ENST00000394630 Prediction methods: Miranda, Rnahybrid, Targetscan Result types: miRGate_prediction
1298406 BP16_H Blood pressure QTL 16 (human) 0.0004 Blood pressure hypertension susceptibility 17 14778647 40778647 Human
GDB:607772
Human Assembly Chr Position (strand) Source JBrowse GRCh37 17 32,597,319 - 32,597,613 UniSTS GRCh37 Build 36 17 29,621,432 - 29,621,726 RGD NCBI36 Celera 17 29,507,132 - 29,507,426 RGD Cytogenetic Map 17 q11.2-q12 UniSTS HuRef 17 28,782,612 - 28,782,906 UniSTS
PMC115222P3
Human Assembly Chr Position (strand) Source JBrowse GRCh37 17 32,598,235 - 32,598,778 UniSTS GRCh37 Build 36 17 29,622,348 - 29,622,891 RGD NCBI36 Celera 17 29,508,048 - 29,508,591 RGD Cytogenetic Map 17 q11.2-q12 UniSTS HuRef 17 28,783,528 - 28,784,071 UniSTS
D17S2013
Human Assembly Chr Position (strand) Source JBrowse GRCh37 17 32,599,123 - 32,599,236 UniSTS GRCh37 Build 36 17 29,623,236 - 29,623,349 RGD NCBI36 Celera 17 29,508,936 - 29,509,049 RGD Cytogenetic Map 17 q11.2-q12 UniSTS HuRef 17 28,784,416 - 28,784,529 UniSTS GeneMap99-GB4 RH Map 17 289.14 UniSTS Whitehead-RH Map 17 307.0 UniSTS Whitehead-YAC Contig Map 17 UniSTS
CCL7_3334
Human Assembly Chr Position (strand) Source JBrowse GRCh37 17 32,598,720 - 32,599,304 UniSTS GRCh37 Build 36 17 29,622,833 - 29,623,417 RGD NCBI36 Celera 17 29,508,533 - 29,509,117 RGD HuRef 17 28,784,013 - 28,784,597 UniSTS
UniSTS:480900
Human Assembly Chr Position (strand) Source JBrowse GRCh37 17 32,597,260 - 32,598,871 UniSTS GRCh37 Celera 17 29,507,073 - 29,508,684 UniSTS HuRef 17 28,782,553 - 28,784,164 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
entire extraembryonic component
757
963
600
909
946
747
1212
3
210
391
141
829
2592
2608
20
480
458
661
911
72
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENST00000378569 ⟹ ENSP00000367832
Type:
CODING
Position:
Human Assembly Chr Position (strand) Source GRCh38.p14 Ensembl 17 34,270,221 - 34,272,242 (+) Ensembl
Ensembl Acc Id:
ENST00000394627 ⟹ ENSP00000378124
Type:
CODING
Position:
Human Assembly Chr Position (strand) Source GRCh38.p14 Ensembl 17 34,270,224 - 34,272,078 (+) Ensembl
Ensembl Acc Id:
ENST00000394630 ⟹ ENSP00000378126
Type:
CODING
Position:
Human Assembly Chr Position (strand) Source GRCh38.p14 Ensembl 17 34,270,224 - 34,272,240 (+) Ensembl
RefSeq Acc Id:
NM_006273 ⟹ NP_006264
RefSeq Status:
REVIEWED
Type:
CODING
Position:
Human Assembly Chr Position (strand) Source GRCh38 17 34,270,221 - 34,272,242 (+) NCBI GRCh37 17 32,597,235 - 32,599,261 (+) NCBI Build 36 17 29,621,353 - 29,623,369 (+) NCBI Archive HuRef 17 28,782,528 - 28,784,554 (+) NCBI CHM1_1 17 32,661,096 - 32,663,122 (+) NCBI T2T-CHM13v2.0 17 35,216,497 - 35,218,518 (+) NCBI
Sequence:
AGCAGAGGGGCTGAGACCAAACCAGAAACCTCCAATTCTCATGTGGAAGCCCATGCCCTCACCCTCCAACATGAAAGCCTCTGCAGCACTTCTGTGTCTGCTGCTCACAGCAGCTGCTTTCAGCCCCC
hide sequence
RefSeq Acc Id:
NP_006264 ⟸ NM_006273
- Peptide Label:
precursor
- UniProtKB:
Q569J6 (UniProtKB/Swiss-Prot), P80098 (UniProtKB/Swiss-Prot)
- Sequence:
MKASAALLCLLLTAAAFSPQGLAQPVGINTSTTCCYRFINKKIPKQRLESYRRTTSSHCPREAVIFKTKLDKEICADPTQKWVQDFMKHLDKKTQTPKL
hide sequence
Ensembl Acc Id:
ENSP00000367832 ⟸ ENST00000378569
Ensembl Acc Id:
ENSP00000378124 ⟸ ENST00000394627
Ensembl Acc Id:
ENSP00000378126 ⟸ ENST00000394630
RGD ID: 7234585 Promoter ID: EPDNEW_H23038 Type: multiple initiation site Name: CCL7_1 Description: C-C motif chemokine ligand 7 SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing.; Paired-end sequencing. Position: Human Assembly Chr Position (strand) Source GRCh38 17 34,270,221 - 34,270,281 EPDNEW
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2016-03-07
CCL7
C-C motif chemokine ligand 7
CCL7
chemokine (C-C motif) ligand 7
Symbol and/or name change
5135510 APPROVED
