Symbol:
CCL11
Name:
C-C motif chemokine ligand 11
RGD ID:
1351854
HGNC Page
HGNC:10610
Description:
Enables CCR3 chemokine receptor binding activity; chemokine activity; and protein dimerization activity. Involved in several processes, including eosinophil chemotaxis; positive regulation of GTPase activity; and positive regulation of actin filament polymerization. Located in extracellular region. Implicated in asthma; human immunodeficiency virus infectious disease; and hyperglycemia. Biomarker of several diseases, including cystic fibrosis; hyperglycemia; lung disease (multiple); nephrotic syndrome type 1; and ureteral obstruction.
Type:
protein-coding
RefSeq Status:
REVIEWED
Previously known as:
C-C motif chemokine 11; chemokine (C-C motif) ligand 11; eosinophil chemotactic protein; eotaxin; eotaxin-1; MGC22554; SCYA11; small inducible cytokine subfamily A (Cys-Cys), member 11 (eotaxin); small-inducible cytokine A11
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Species
Gene symbol and name
Data Source
Assertion derived from
less info ...
Orthologs 1
Mus musculus (house mouse):
Ccl11 (C-C motif chemokine ligand 11) HGNC
EggNOG, Ensembl, HGNC, HomoloGene, OMA, OrthoMCL, PhylomeDB, Treefam
Rattus norvegicus (Norway rat):
Ccl11 (C-C motif chemokine ligand 11) HGNC
EggNOG, Ensembl, HomoloGene, Inparanoid, NCBI, OMA, OrthoMCL, PhylomeDB, Treefam
Pan paniscus (bonobo/pygmy chimpanzee):
LOC100980531 (eotaxin) NCBI
Ortholog
Ictidomys tridecemlineatus (thirteen-lined ground squirrel):
LOC101968920 (eotaxin) NCBI
Ortholog
Sus scrofa (pig):
CCL11 (chemokine (C-C motif) ligand 11) HGNC
Ensembl, OrthoDB, Treefam
Chlorocebus sabaeus (green monkey):
CCL11 (C-C motif chemokine ligand 11) NCBI
Ortholog
Other homologs 2
Canis lupus familiaris (dog):
CCL8 (C-C motif chemokine ligand 8) HGNC
EggNOG, OrthoDB
Mus musculus (house mouse):
Ccl7 (C-C motif chemokine ligand 7) HGNC
OMA, OrthoDB
Sus scrofa (pig):
CCL8 (chemokine (C-C motif) ligand 8) HGNC
OMA, OrthoDB
Rattus norvegicus (Norway rat):
Ccl12 (C-C motif chemokine ligand 12) HGNC
OrthoDB
Mus musculus (house mouse):
Ccl12 (C-C motif chemokine ligand 12) HGNC
OrthoDB
Rattus norvegicus (Norway rat):
Ccl7 (C-C motif chemokine ligand 7) HGNC
OrthoDB
Mus musculus (house mouse):
Ccl8 (C-C motif chemokine ligand 8) HGNC
OrthoDB
Canis lupus familiaris (dog):
CCL2 (C-C motif chemokine ligand 2) HGNC
OrthoDB
Canis lupus familiaris (dog):
CCL7 (C-C motif chemokine ligand 7) HGNC
OrthoDB
Sus scrofa (pig):
CCL2 (chemokine (C-C motif) ligand 2) HGNC
OrthoDB
Rattus norvegicus (Norway rat):
Polr2g (RNA polymerase II subunit G) HGNC
OMA
Alliance orthologs 3
Rattus norvegicus (Norway rat):
Ccl11 (C-C motif chemokine ligand 11)
Alliance
DIOPT (HGNC|Hieranoid|InParanoid|OMA|PhylomeDB|SonicParanoid)
Mus musculus (house mouse):
Ccl11 (C-C motif chemokine ligand 11)
Alliance
DIOPT (HGNC|Hieranoid|InParanoid|OMA|OrthoInspector|PhylomeDB|SonicParanoid)
Danio rerio (zebrafish):
ccl35.1 (chemokine (C-C motif) ligand 35, duplicate 1)
Alliance
DIOPT (Ensembl Compara|OMA|PANTHER)
Danio rerio (zebrafish):
ccl35.2 (chemokine (C-C motif) ligand 35, duplicate 2)
Alliance
DIOPT (Ensembl Compara|OMA|PANTHER)
Allele / Splice:
See ClinVar data
Latest Assembly:
GRCh38 - Human Genome Assembly GRCh38
Position:
Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 17 34,285,742 - 34,288,334 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 17 34,285,742 - 34,288,334 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 17 32,612,761 - 32,615,353 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 17 29,636,800 - 29,639,312 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 17 29,636,799 - 29,639,312 NCBI Celera 17 29,522,500 - 29,525,011 (+) NCBI Celera Cytogenetic Map 17 q12 NCBI HuRef 17 28,797,991 - 28,800,502 (+) NCBI HuRef CHM1_1 17 32,676,549 - 32,679,061 (+) NCBI CHM1_1 T2T-CHM13v2.0 17 35,232,017 - 35,234,610 (+) NCBI T2T-CHM13v2.0
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
CCL11 Human 1,4-benzoquinone increases expression EXP 6480464 quinone results in increased expression of CCL11 protein CTD PMID:17572062 CCL11 Human 1-chloro-2,4-dinitrobenzene multiple interactions ISO Ccl11 (Mus musculus) 6480464 Plant Extracts inhibits the reaction [Dinitrochlorobenzene results in increased expression of CCL11 mRNA] and Prednisolone inhibits the reaction [Dinitrochlorobenzene results in increased expression of CCL11 mRNA] CTD PMID:23133493 CCL11 Human 1-chloro-2,4-dinitrobenzene increases expression ISO Ccl11 (Mus musculus) 6480464 Dinitrochlorobenzene results in increased expression of CCL11 mRNA CTD PMID:23133493 CCL11 Human 1-naphthyl isothiocyanate increases expression ISO Ccl11 (Rattus norvegicus) 6480464 1-Naphthylisothiocyanate results in increased expression of CCL11 mRNA CTD PMID:30723492 CCL11 Human 17alpha-ethynylestradiol affects expression ISO Ccl11 (Mus musculus) 6480464 Ethinyl Estradiol affects the expression of CCL11 mRNA CTD PMID:17555576 CCL11 Human 17alpha-ethynylestradiol increases expression ISO Ccl11 (Rattus norvegicus) 6480464 Ethinyl Estradiol results in increased expression of CCL11 mRNA CTD PMID:12655037 more ... CCL11 Human 17alpha-ethynylestradiol multiple interactions ISO Ccl11 (Mus musculus) 6480464 [Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of CCL11 mRNA CTD PMID:17942748 CCL11 Human 17alpha-ethynylestradiol increases expression ISO Ccl11 (Mus musculus) 6480464 Ethinyl Estradiol results in increased expression of CCL11 mRNA CTD PMID:17942748 CCL11 Human 17beta-estradiol affects expression ISO Ccl11 (Mus musculus) 6480464 Estradiol affects the expression of CCL11 mRNA CTD PMID:15598610 CCL11 Human 17beta-estradiol multiple interactions ISO Ccl11 (Rattus norvegicus) 6480464 [estradiol 3-benzoate co-treated with [Testosterone co-treated with Estradiol]] results in increased expression of CCL11 mRNA CTD PMID:32741896 CCL11 Human 17beta-estradiol increases expression ISO Ccl11 (Rattus norvegicus) 6480464 Estradiol results in increased expression of CCL11 mRNA CTD PMID:26945725 CCL11 Human 17beta-estradiol increases expression ISO Ccl11 (Mus musculus) 6480464 Estradiol results in increased expression of CCL11 mRNA CTD PMID:23144751 CCL11 Human 17beta-estradiol 3-benzoate multiple interactions ISO Ccl11 (Rattus norvegicus) 6480464 [estradiol 3-benzoate co-treated with [Testosterone co-treated with Estradiol]] results in increased expression of CCL11 mRNA CTD PMID:32741896 CCL11 Human 2,2',5,5'-tetrachlorobiphenyl decreases expression EXP 6480464 2 more ... CTD PMID:36804509 CCL11 Human 2,2',5,5'-tetrachlorobiphenyl increases expression EXP 6480464 2 more ... CTD PMID:36804509 CCL11 Human 2,3,7,8-tetrachlorodibenzodioxine multiple interactions ISO Ccl11 (Mus musculus) 6480464 [Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of CCL11 mRNA and Tetrachlorodibenzodioxin inhibits the reaction [Dextran Sulfate results in increased secretion of CCL11 protein] CTD PMID:17942748 and PMID:21858153 CCL11 Human 2,4-D increases expression ISO Ccl11 (Mus musculus) 6480464 2 and 4-Dichlorophenoxyacetic Acid results in increased expression of CCL11 protein CTD PMID:19467290 CCL11 Human 2,4-dibromophenyl 2,4,5-tribromophenyl ether affects expression ISO Ccl11 (Mus musculus) 6480464 2 more ... CTD PMID:38648751 CCL11 Human 3,3',4,4',5-pentachlorobiphenyl multiple interactions ISO Ccl11 (Rattus norvegicus) 6480464 [AHR gene mutant form affects the susceptibility to 3 more ... CTD PMID:34256052 CCL11 Human 3-chlorophenol increases expression EXP 6480464 3-chlorophenol results in increased expression of CCL11 mRNA CTD PMID:18486366 CCL11 Human 6-propyl-2-thiouracil increases expression ISO Ccl11 (Rattus norvegicus) 6480464 Propylthiouracil results in increased expression of CCL11 mRNA CTD PMID:24780913 CCL11 Human 9,10-phenanthroquinone increases expression ISO Ccl11 (Mus musculus) 6480464 9 and 10-phenanthrenequinone results in increased expression of CCL11 protein CTD PMID:15669044 CCL11 Human actinomycin D multiple interactions EXP 6480464 Dactinomycin inhibits the reaction [TNF protein results in increased expression of CCL11 mRNA] CTD PMID:15531761 CCL11 Human aluminium sulfate (anhydrous) multiple interactions ISO Ccl11 (Mus musculus) 6480464 [Ovalbumin co-treated with aluminum sulfate] results in increased secretion of CCL11 protein CTD PMID:27660012 CCL11 Human ammonium chloride affects expression ISO Ccl11 (Rattus norvegicus) 6480464 Ammonium Chloride affects the expression of CCL11 mRNA CTD PMID:16483693 CCL11 Human antirheumatic drug decreases expression EXP 6480464 Antirheumatic Agents results in decreased expression of CCL11 mRNA CTD PMID:24449571 CCL11 Human apocynin multiple interactions EXP 6480464 acetovanillone inhibits the reaction [TNF protein results in increased expression of CCL11 mRNA] CTD PMID:22414048 CCL11 Human arsenous acid increases expression ISO Ccl11 (Mus musculus) 6480464 Arsenic Trioxide results in increased expression of CCL11 protein CTD PMID:37166470 CCL11 Human asbestos increases expression EXP 6480464 Asbestos results in increased expression of CCL11 protein CTD PMID:25162674 CCL11 Human Azoxymethane multiple interactions ISO Ccl11 (Mus musculus) 6480464 [titanium dioxide co-treated with Azoxymethane co-treated with Dextran Sulfate] results in decreased expression of CCL11 mRNA CTD PMID:29950665 CCL11 Human Bardoxolone methyl multiple interactions ISO Ccl11 (Mus musculus) 6480464 bardoxolone methyl inhibits the reaction [Lipopolysaccharides results in increased expression of and results in increased secretion of CCL11 protein] CTD PMID:26918785 CCL11 Human barium sulfate increases expression ISO Ccl11 (Rattus norvegicus) 6480464 Barium Sulfate results in increased expression of CCL11 mRNA CTD PMID:29463257 CCL11 Human beclomethasone multiple interactions EXP 6480464 Beclomethasone inhibits the reaction [IL13 protein results in increased expression of CCL11 protein] CTD PMID:17988555 CCL11 Human benzalkonium chloride increases expression ISO Ccl11 (Mus musculus) 6480464 Benzalkonium Compounds results in increased expression of CCL11 protein CTD PMID:30517752 CCL11 Human benzene-1,2,4-triol affects expression EXP 6480464 hydroxyhydroquinone affects the expression of CCL11 protein CTD PMID:17572062 CCL11 Human benzene-1,2,4-triol increases expression EXP 6480464 hydroxyhydroquinone results in increased expression of CCL11 mRNA CTD PMID:39245080 CCL11 Human benzo[a]pyrene increases expression ISO Ccl11 (Mus musculus) 6480464 Benzo(a)pyrene results in increased expression of CCL11 mRNA CTD PMID:22228805 and PMID:23735875 CCL11 Human benzo[a]pyrene increases methylation EXP 6480464 Benzo(a)pyrene results in increased methylation of CCL11 exon CTD PMID:27901495 CCL11 Human benzo[a]pyrene affects methylation EXP 6480464 Benzo(a)pyrene affects the methylation of CCL11 promoter CTD PMID:27901495 CCL11 Human bexarotene decreases expression ISO Ccl11 (Rattus norvegicus) 6480464 bexarotene results in decreased expression of CCL11 mRNA CTD PMID:16648578 CCL11 Human bis(2-chloroethyl) sulfide increases expression EXP 6480464 Mustard Gas results in increased expression of CCL11 protein CTD PMID:17620002 CCL11 Human bisphenol A decreases expression ISO Ccl11 (Rattus norvegicus) 6480464 bisphenol A results in decreased expression of CCL11 mRNA CTD PMID:25181051 CCL11 Human bisphenol A multiple interactions ISO Ccl11 (Mus musculus) 6480464 [bisphenol A results in increased susceptibility to Ovalbumin] which results in increased expression of CCL11 mRNA more ... CTD PMID:29737898 more ... CCL11 Human bisphenol A decreases expression EXP 6480464 bisphenol A results in decreased expression of CCL11 mRNA CTD PMID:27685785 and PMID:28736254 CCL11 Human bisphenol AF decreases expression ISO Ccl11 (Mus musculus) 6480464 bisphenol AF results in decreased expression of CCL11 mRNA CTD PMID:36881955 CCL11 Human Bisphenol B decreases expression ISO Ccl11 (Mus musculus) 6480464 bisphenol B results in decreased expression of CCL11 mRNA CTD PMID:36881955 CCL11 Human bleomycin A2 increases expression ISO Ccl11 (Mus musculus) 6480464 Bleomycin results in increased expression of CCL11 mRNA and Bleomycin results in increased expression of CCL11 protein CTD PMID:16314464 CCL11 Human bleomycin A2 decreases expression ISO Ccl11 (Mus musculus) 6480464 Bleomycin results in decreased expression of CCL11 mRNA CTD PMID:29720568 CCL11 Human bleomycin A2 decreases response to substance ISO Ccl11 (Mus musculus) 6480464 CCL11 gene mutant form results in decreased susceptibility to Bleomycin CTD PMID:16314464 CCL11 Human bleomycin A2 multiple interactions ISO Ccl11 (Mus musculus) 6480464 CCL11 protein promotes the reaction [Bleomycin results in increased expression of CCL2 mRNA] and CCL11 protein promotes the reaction [Bleomycin results in increased expression of TGFB1 mRNA] CTD PMID:16314464 CCL11 Human Brevianamide A increases expression ISO Ccl11 (Mus musculus) 6480464 brevianamide A results in increased expression of CCL11 mRNA CTD PMID:19818335 CCL11 Human budesonide multiple interactions EXP 6480464 Budesonide inhibits the reaction [IL13 protein results in increased expression of CCL11 protein] CTD PMID:17988555 CCL11 Human cadmium dichloride multiple interactions EXP 6480464 Acetylcysteine inhibits the reaction [Cadmium Chloride results in decreased expression of CCL11 protein] CTD PMID:26138014 CCL11 Human cadmium dichloride decreases expression EXP 6480464 Cadmium Chloride results in decreased expression of CCL11 protein CTD PMID:26138014 CCL11 Human Calcimycin multiple interactions EXP 6480464 [Tetradecanoylphorbol Acetate co-treated with Calcimycin] results in increased expression of CCL11 mRNA more ... CTD PMID:12797483 and PMID:21331654 CCL11 Human calcium atom increases uptake EXP 6480464 CCL11 protein results in increased uptake of Calcium CTD PMID:10984371 CCL11 Human calcium(0) increases uptake EXP 6480464 CCL11 protein results in increased uptake of Calcium CTD PMID:10984371 CCL11 Human carbon nanotube increases expression ISO Ccl11 (Mus musculus) 6480464 Nanotubes more ... CTD PMID:25554681 and PMID:27106021 CCL11 Human carbon nanotube multiple interactions ISO Ccl11 (Mus musculus) 6480464 [Nanotubes more ... CTD PMID:37580758 CCL11 Human carbon nanotube increases secretion ISO Ccl11 (Mus musculus) 6480464 Nanotubes and Carbon results in increased secretion of CCL11 protein CTD PMID:19371758 CCL11 Human catechol increases expression EXP 6480464 catechol results in increased expression of CCL11 protein CTD PMID:17572062 CCL11 Human ceric oxide multiple interactions ISO Ccl11 (Mus musculus) 6480464 [Antigens more ... CTD PMID:29792201 CCL11 Human ceric oxide increases expression ISO Ccl11 (Rattus norvegicus) 6480464 ceric oxide results in increased expression of CCL11 mRNA CTD PMID:29463257 CCL11 Human CGP 52608 multiple interactions EXP 6480464 CGP 52608 promotes the reaction [RORA protein binds to CCL11 gene] CTD PMID:28238834 CCL11 Human chloroquine multiple interactions ISO Ccl11 (Mus musculus) 6480464 Chloroquine inhibits the reaction [lipopolysaccharide and Escherichia coli O111 B4 results in increased secretion of CCL11 protein] CTD PMID:22341560 CCL11 Human chloroquine decreases secretion EXP 6480464 Chloroquine results in decreased secretion of CCL11 protein CTD PMID:29772762 CCL11 Human choline multiple interactions ISO Ccl11 (Mus musculus) 6480464 [Dietary Fats co-treated with Choline deficiency] results in increased expression of CCL11 protein and PANX1 gene mutant form inhibits the reaction [[Dietary Fats co-treated with Choline deficiency] results in increased expression of CCL11 protein] CTD PMID:29246445 CCL11 Human chromium(6+) affects expression ISO Ccl11 (Mus musculus) 6480464 chromium hexavalent ion affects the expression of CCL11 mRNA CTD PMID:28472532 CCL11 Human clopidogrel increases expression ISO Ccl11 (Mus musculus) 6480464 clopidogrel results in increased expression of CCL11 mRNA CTD PMID:19155974 CCL11 Human copper atom decreases expression ISO Ccl11 (Rattus norvegicus) 6480464 Copper results in decreased expression of CCL11 mRNA CTD PMID:30556269 CCL11 Human copper(0) decreases expression ISO Ccl11 (Rattus norvegicus) 6480464 Copper results in decreased expression of CCL11 mRNA CTD PMID:30556269 CCL11 Human Cuprizon increases expression ISO Ccl11 (Rattus norvegicus) 6480464 Cuprizone results in increased expression of CCL11 mRNA CTD PMID:26577399 and PMID:27523638 CCL11 Human deoxynivalenol increases expression ISO Ccl11 (Mus musculus) 6480464 deoxynivalenol results in increased expression of CCL11 mRNA CTD PMID:22968694 CCL11 Human dexamethasone increases expression ISO Ccl11 (Mus musculus) 6480464 Dexamethasone results in increased expression of CCL11 mRNA CTD PMID:21041162 CCL11 Human dexamethasone multiple interactions ISO Ccl11 (Mus musculus) 6480464 Dexamethasone inhibits the reaction [Antigens and Dermatophagoides results in increased expression of CCL11 mRNA] CTD PMID:31751647 CCL11 Human dexamethasone multiple interactions EXP 6480464 Dexamethasone inhibits the reaction [Lipopolysaccharides results in increased expression of CCL11 protein] CTD PMID:27568862 CCL11 Human dextran sulfate multiple interactions ISO Ccl11 (Mus musculus) 6480464 [titanium dioxide co-treated with Azoxymethane co-treated with Dextran Sulfate] results in decreased expression of CCL11 mRNA more ... CTD PMID:21858153 more ... CCL11 Human dextran sulfate increases expression ISO Ccl11 (Mus musculus) 6480464 Dextran Sulfate results in increased expression of CCL11 mRNA CTD PMID:32033881 CCL11 Human dextran sulfate increases secretion ISO Ccl11 (Mus musculus) 6480464 Dextran Sulfate results in increased secretion of CCL11 protein CTD PMID:21858153 CCL11 Human diarsenic trioxide increases expression ISO Ccl11 (Mus musculus) 6480464 Arsenic Trioxide results in increased expression of CCL11 protein CTD PMID:37166470 CCL11 Human dichlorine increases expression ISO Ccl11 (Mus musculus) 6480464 Chlorine results in increased expression of CCL11 protein CTD PMID:23146759 CCL11 Human diethylstilbestrol increases expression ISO Ccl11 (Mus musculus) 6480464 Diethylstilbestrol results in increased expression of CCL11 mRNA CTD PMID:21041162 CCL11 Human diisononyl phthalate multiple interactions ISO Ccl11 (Mus musculus) 6480464 diisononyl phthalate inhibits the reaction [Antigens and Dermatophagoides results in increased expression of CCL11 protein] CTD PMID:20064775 CCL11 Human dimethylarsinic acid decreases expression ISO Ccl11 (Mus musculus) 6480464 Cacodylic Acid results in decreased expression of CCL11 mRNA CTD PMID:32052077 CCL11 Human dimethylarsinic acid decreases expression ISO Ccl11 (Rattus norvegicus) 6480464 Cacodylic Acid results in decreased expression of CCL11 mRNA CTD PMID:37567419 CCL11 Human dioxygen multiple interactions ISO Ccl11 (Mus musculus) 6480464 SCGB1A1 protein affects the reaction [Oxygen results in increased expression of CCL11 mRNA] CTD PMID:10027076 CCL11 Human dioxygen decreases expression ISO Ccl11 (Mus musculus) 6480464 Oxygen results in decreased expression of CCL11 mRNA CTD PMID:9555576 CCL11 Human dioxygen increases expression ISO Ccl11 (Mus musculus) 6480464 Oxygen results in increased expression of CCL11 mRNA CTD PMID:10027076 CCL11 Human diuron decreases expression ISO Ccl11 (Rattus norvegicus) 6480464 Diuron results in decreased expression of CCL11 mRNA CTD PMID:21551480 CCL11 Human doxorubicin decreases expression EXP 6480464 Doxorubicin results in decreased expression of CCL11 mRNA CTD PMID:29803840 CCL11 Human emamectin benzoate increases expression EXP 6480464 emamectin benzoate results in increased expression of CCL11 mRNA CTD PMID:36269090 CCL11 Human ethanol decreases expression EXP 6480464 Ethanol results in decreased expression of CCL11 protein CTD PMID:26733986 CCL11 Human ferric oxide increases expression ISO Ccl11 (Mus musculus) 6480464 ferric oxide analog results in increased expression of CCL11 protein CTD PMID:36935073 CCL11 Human ferric oxide multiple interactions ISO Ccl11 (Mus musculus) 6480464 ferric oxide results in increased expression of and results in increased secretion of CCL11 protein and RAG1 promotes the reaction [ferric oxide analog results in increased expression of CCL11 protein] CTD PMID:34982504 and PMID:36935073 CCL11 Human Fexofenadine hydrochloride multiple interactions EXP 6480464 fexofenadine inhibits the reaction [Lipopolysaccharides results in increased expression of CCL11 mRNA] more ... CTD PMID:15460210 CCL11 Human flutamide increases expression ISO Ccl11 (Mus musculus) 6480464 Flutamide results in increased expression of CCL11 mRNA CTD PMID:21735453 CCL11 Human fluticasone multiple interactions EXP 6480464 Fluticasone inhibits the reaction [RELA protein binds to CCL11 promoter] more ... CTD PMID:15531761 CCL11 Human Fulvic acid multiple interactions EXP 6480464 fulvic acid inhibits the reaction [[Tetradecanoylphorbol Acetate co-treated with Calcimycin] results in increased expression of CCL11 mRNA] CTD PMID:21331654 CCL11 Human fumaric acid multiple interactions ISO Ccl11 (Mus musculus) 6480464 fumaric acid inhibits the reaction [TNF protein results in increased expression of CCL11 mRNA] and fumaric acid inhibits the reaction [TNF protein results in increased expression of CCL11 protein] CTD PMID:23707484 CCL11 Human furan increases expression ISO Ccl11 (Rattus norvegicus) 6480464 furan results in increased expression of CCL11 mRNA CTD PMID:27387713 CCL11 Human genistein decreases expression ISO Ccl11 (Mus musculus) 6480464 Genistein results in decreased expression of CCL11 mRNA CTD PMID:32186404 CCL11 Human gentamycin decreases expression ISO Ccl11 (Rattus norvegicus) 6480464 Gentamicins results in decreased expression of CCL11 protein CTD PMID:25051504 CCL11 Human graphene oxide increases expression ISO Ccl11 (Mus musculus) 6480464 graphene oxide results in increased expression of CCL11 mRNA CTD PMID:33227293 CCL11 Human heparin multiple interactions ISO Ccl11 (Mus musculus) 6480464 Heparin inhibits the reaction [PLG protein affects the degradation of CCL11 protein] CTD PMID:17384413 CCL11 Human heparin affects binding ISO Ccl11 (Mus musculus) 6480464 Heparin binds to CCL11 protein CTD PMID:17384413 CCL11 Human hydroquinone increases expression EXP 6480464 hydroquinone results in increased expression of CCL11 protein CTD PMID:17572062 CCL11 Human indole-3-methanol multiple interactions ISO Ccl11 (Rattus norvegicus) 6480464 [indole-3-carbinol co-treated with Diethylnitrosamine co-treated with Acetylcysteine] results in decreased expression of CCL11 mRNA CTD PMID:22129741 CCL11 Human ionomycin multiple interactions EXP 6480464 [Ionomycin co-treated with Tetradecanoylphorbol Acetate] results in increased secretion of CCL11 protein more ... CTD PMID:17572062 and PMID:17685462 CCL11 Human lead(0) multiple interactions ISO Ccl11 (Mus musculus) 6480464 Lead results in increased expression of and results in increased secretion of CCL11 protein CTD PMID:28973681 CCL11 Human lipopolysaccharide increases expression EXP 6480464 Lipopolysaccharides results in increased expression of CCL11 mRNA and Lipopolysaccharides results in increased expression of CCL11 protein CTD PMID:15460210 and PMID:27568862 CCL11 Human lipopolysaccharide increases expression ISO Ccl11 (Rattus norvegicus) 6480464 Lipopolysaccharides results in increased expression of CCL11 protein CTD PMID:33727093 CCL11 Human lipopolysaccharide increases expression ISO Ccl11 (Mus musculus) 6480464 Lipopolysaccharides results in increased expression of CCL11 mRNA CTD PMID:10027076 CCL11 Human lipopolysaccharide multiple interactions ISO Ccl11 (Mus musculus) 6480464 2'-hydroxyflavanone inhibits the reaction [Lipopolysaccharides results in increased secretion of CCL11 protein] more ... CTD PMID:26918785 and PMID:32800949 CCL11 Human lipopolysaccharide multiple interactions EXP 6480464 coagulin-L inhibits the reaction [Lipopolysaccharides results in increased expression of CCL11 protein] more ... CTD PMID:15460210 and PMID:27568862 CCL11 Human lipopolysaccharide increases secretion ISO Ccl11 (Mus musculus) 6480464 Lipopolysaccharides results in increased secretion of CCL11 protein CTD PMID:32800949 CCL11 Human lipopolysaccharide increases secretion EXP 6480464 Lipopolysaccharides results in increased secretion of CCL11 protein CTD PMID:32800949 CCL11 Human LY294002 multiple interactions EXP 6480464 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one inhibits the reaction [CCL11 protein results in increased expression of ITGAM protein] CTD PMID:11980903 CCL11 Human mercury dichloride increases expression ISO Ccl11 (Mus musculus) 6480464 Mercuric Chloride results in increased expression of CCL11 protein CTD PMID:21984480 CCL11 Human mercury dichloride decreases expression ISO Ccl11 (Mus musculus) 6480464 Mercuric Chloride results in decreased expression of CCL11 protein CTD PMID:21984480 CCL11 Human metam multiple interactions ISO Ccl11 (Mus musculus) 6480464 methyldithiocarbamate inhibits the reaction [Poly I-C results in increased secretion of CCL11 protein] CTD PMID:24056979 CCL11 Human methimazole multiple interactions ISO Ccl11 (Mus musculus) 6480464 [Methimazole co-treated with Buthionine Sulfoximine] results in increased expression of CCL11 mRNA CTD PMID:22407903 and PMID:27421576 CCL11 Human methimazole increases expression ISO Ccl11 (Mus musculus) 6480464 Methimazole results in increased expression of CCL11 mRNA CTD PMID:26177832 CCL11 Human methotrexate decreases expression EXP 6480464 Methotrexate results in decreased expression of CCL11 mRNA CTD PMID:17400583 and PMID:24449571 CCL11 Human methylmercury chloride increases expression ISO Ccl11 (Mus musculus) 6480464 methylmercuric chloride results in increased expression of CCL11 mRNA CTD PMID:24213012 CCL11 Human methylmercury chloride increases expression ISO Ccl11 (Rattus norvegicus) 6480464 methylmercuric chloride results in increased expression of CCL11 mRNA CTD PMID:31378766 CCL11 Human microcystin-LR decreases expression ISO Ccl11 (Rattus norvegicus) 6480464 cyanoginosin LR results in decreased expression of CCL11 protein CTD PMID:34740672 CCL11 Human microcystin-LR multiple interactions ISO Ccl11 (Rattus norvegicus) 6480464 [Dietary Fats co-treated with Cholesterol and Dietary co-treated with cyanoginosin LR] results in decreased expression of CCL11 protein CTD PMID:34740672 CCL11 Human MK 571 multiple interactions ISO Ccl11 (Mus musculus) 6480464 verlukast inhibits the reaction [Ovalbumin results in increased expression of CCL11 mRNA] CTD PMID:12794006 CCL11 Human mycotoxin increases expression ISO Ccl11 (Mus musculus) 6480464 Mycotoxins results in increased expression of CCL11 mRNA CTD PMID:19818335 CCL11 Human N-acetyl-L-cysteine multiple interactions ISO Ccl11 (Rattus norvegicus) 6480464 [indole-3-carbinol co-treated with Diethylnitrosamine co-treated with Acetylcysteine] results in decreased expression of CCL11 mRNA CTD PMID:22129741 CCL11 Human N-acetyl-L-cysteine multiple interactions EXP 6480464 Acetylcysteine inhibits the reaction [Cadmium Chloride results in decreased expression of CCL11 protein] more ... CTD PMID:12576300 and PMID:26138014 CCL11 Human N-nitrosodiethylamine multiple interactions ISO Ccl11 (Rattus norvegicus) 6480464 [indole-3-carbinol co-treated with Diethylnitrosamine co-treated with Acetylcysteine] results in decreased expression of CCL11 mRNA CTD PMID:22129741 CCL11 Human neoechinulin A increases expression ISO Ccl11 (Mus musculus) 6480464 neoechinulin A results in increased expression of CCL11 mRNA CTD PMID:19818335 CCL11 Human nickel atom affects expression EXP 6480464 Nickel affects the expression of CCL11 mRNA CTD PMID:14575637 CCL11 Human nickel atom multiple interactions EXP 6480464 trichostatin A inhibits the reaction [Nickel affects the expression of CCL11 mRNA] CTD PMID:14575637 CCL11 Human nickel sulfate increases expression ISO Ccl11 (Mus musculus) 6480464 nickel sulfate results in increased expression of CCL11 mRNA CTD PMID:16166746 CCL11 Human nickel sulfate affects expression EXP 6480464 nickel sulfate affects the expression of CCL11 mRNA CTD PMID:18202158 CCL11 Human nickel sulfate decreases expression EXP 6480464 nickel sulfate results in decreased expression of CCL11 mRNA CTD PMID:18832182 CCL11 Human nitrogen dioxide increases expression ISO Ccl11 (Mus musculus) 6480464 Nitrogen Dioxide results in increased expression of CCL11 mRNA CTD PMID:10715624 CCL11 Human ozone increases secretion ISO Ccl11 (Mus musculus) 6480464 Ozone results in increased secretion of CCL11 protein CTD PMID:31626304 CCL11 Human ozone increases expression ISO Ccl11 (Mus musculus) 6480464 Ozone results in increased expression of CCL11 mRNA and Ozone results in increased expression of CCL11 protein CTD PMID:10027076 more ... CCL11 Human ozone multiple interactions ISO Ccl11 (Mus musculus) 6480464 [Air Pollutants results in increased abundance of Ozone] which results in increased expression of CCL11 mRNA more ... CTD PMID:10027076 more ... CCL11 Human ozone increases expression ISO Ccl11 (Rattus norvegicus) 6480464 Ozone results in increased expression of CCL11 mRNA and Ozone results in increased expression of CCL11 protein CTD PMID:9458816 CCL11 Human paracetamol decreases expression EXP 6480464 Acetaminophen results in decreased expression of CCL11 mRNA CTD PMID:26690555 CCL11 Human paraquat increases expression ISO Ccl11 (Rattus norvegicus) 6480464 Paraquat results in increased expression of CCL11 mRNA CTD PMID:32680482 CCL11 Human paraquat increases expression ISO Ccl11 (Mus musculus) 6480464 Paraquat results in increased expression of CCL11 mRNA and Paraquat results in increased expression of CCL11 protein CTD PMID:36108500 CCL11 Human phorbol 13-acetate 12-myristate multiple interactions EXP 6480464 [Ionomycin co-treated with Tetradecanoylphorbol Acetate] results in increased secretion of CCL11 protein more ... CTD PMID:17572062 more ... CCL11 Human phthalic anhydride increases expression ISO Ccl11 (Mus musculus) 6480464 phthalic anhydride results in increased expression of CCL11 protein CTD PMID:20219652 CCL11 Human pioglitazone multiple interactions ISO Ccl11 (Mus musculus) 6480464 pioglitazone inhibits the reaction [Toluene 2 and 4-Diisocyanate results in increased expression of CCL11 protein] CTD PMID:17015710 CCL11 Human pirinixic acid decreases expression ISO Ccl11 (Mus musculus) 6480464 pirinixic acid results in decreased expression of CCL11 mRNA CTD PMID:18249437 CCL11 Human poly(I:C) multiple interactions ISO Ccl11 (Mus musculus) 6480464 methyldithiocarbamate inhibits the reaction [Poly I-C results in increased secretion of CCL11 protein] CTD PMID:24056979 CCL11 Human poly(I:C) increases secretion ISO Ccl11 (Mus musculus) 6480464 Poly I-C results in increased secretion of CCL11 protein CTD PMID:24056979 CCL11 Human polymyxin B2 multiple interactions ISO Ccl11 (Mus musculus) 6480464 Polymyxin B inhibits the reaction [[Ovalbumin co-treated with Dust] results in increased expression of CCL11 protein] CTD PMID:26882889 CCL11 Human prednisolone multiple interactions ISO Ccl11 (Mus musculus) 6480464 Prednisolone inhibits the reaction [Dinitrochlorobenzene results in increased expression of CCL11 mRNA] CTD PMID:23133493 CCL11 Human prednisone decreases expression EXP 6480464 Prednisone results in decreased expression of CCL11 protein CTD PMID:15523430 CCL11 Human reactive oxygen species multiple interactions EXP 6480464 CCL11 protein promotes the reaction [Calcimycin affects the abundance of and affects the chemical synthesis of Reactive Oxygen Species] and IL5 protein promotes the reaction [CCL11 protein promotes the reaction [Calcimycin affects the abundance of and affects the chemical synthesis of Reactive Oxygen Species]] CTD PMID:12797483 CCL11 Human resveratrol decreases expression ISO Ccl11 (Mus musculus) 6480464 resveratrol results in decreased expression of CCL11 protein CTD PMID:17872969 CCL11 Human resveratrol decreases expression EXP 6480464 resveratrol results in decreased expression of CCL11 mRNA CTD PMID:22254182 CCL11 Human resveratrol multiple interactions EXP 6480464 [Plant Extracts co-treated with Resveratrol] results in decreased expression of CCL11 mRNA more ... CTD PMID:22254182 and PMID:23557933 CCL11 Human resveratrol decreases secretion EXP 6480464 resveratrol results in decreased secretion of CCL11 protein CTD PMID:22254182 CCL11 Human rotenone multiple interactions ISO Ccl11 (Mus musculus) 6480464 NLRP3 gene mutant form inhibits the reaction [Rotenone results in decreased secretion of CCL11 protein] CTD PMID:28903492 CCL11 Human S-butyl-DL-homocysteine (S,R)-sulfoximine multiple interactions ISO Ccl11 (Mus musculus) 6480464 [Methimazole co-treated with Buthionine Sulfoximine] results in increased expression of CCL11 mRNA CTD PMID:22407903 and PMID:27421576 CCL11 Human Salmeterol xinafoate multiple interactions EXP 6480464 Salmeterol Xinafoate inhibits the reaction [RELA protein binds to CCL11 promoter] more ... CTD PMID:15531761 CCL11 Human SB 203580 multiple interactions ISO Ccl11 (Mus musculus) 6480464 SB 203580 inhibits the reaction [TNF protein results in increased expression of CCL11 protein] CTD PMID:23707484 CCL11 Human serpentine asbestos increases secretion EXP 6480464 Asbestos and Serpentine results in increased secretion of CCL11 protein CTD PMID:23017228 CCL11 Human serpentine asbestos multiple interactions ISO Ccl11 (Mus musculus) 6480464 SPP1 gene mutant form promotes the reaction [Asbestos and Serpentine results in decreased expression of CCL11 protein] CTD PMID:21514415 CCL11 Human serpentine asbestos decreases expression ISO Ccl11 (Mus musculus) 6480464 Asbestos and Serpentine results in decreased expression of CCL11 protein CTD PMID:21514415 CCL11 Human sodium arsenite increases expression ISO Ccl11 (Mus musculus) 6480464 sodium arsenite results in increased expression of CCL11 mRNA CTD PMID:21911445 CCL11 Human sodium dichromate increases secretion EXP 6480464 sodium bichromate results in increased secretion of CCL11 protein CTD PMID:17685462 CCL11 Human sodium dichromate multiple interactions EXP 6480464 sodium bichromate inhibits the reaction [[Ionomycin co-treated with Tetradecanoylphorbol Acetate] results in increased secretion of CCL11 protein] CTD PMID:17685462 CCL11 Human sulforaphane multiple interactions ISO Ccl11 (Mus musculus) 6480464 [NFE2L2 protein affects the susceptibility to sulforaphane] which affects the expression of CCL11 mRNA CTD PMID:30529165 CCL11 Human synephrine multiple interactions ISO Ccl11 (Mus musculus) 6480464 Synephrine inhibits the reaction [IL4 protein results in increased expression of and results in increased secretion of CCL11 protein] and Synephrine inhibits the reaction [IL4 protein results in increased expression of CCL11 mRNA] CTD PMID:25111027 CCL11 Human synephrine multiple interactions EXP 6480464 Synephrine inhibits the reaction [IL4 protein results in increased expression of and results in increased secretion of CCL11 protein] CTD PMID:25111027 CCL11 Human syringin multiple interactions ISO Ccl11 (Mus musculus) 6480464 syringin inhibits the reaction [Ovalbumin results in increased expression of CCL11 protein] CTD PMID:33146439 CCL11 Human tacrolimus hydrate decreases expression EXP 6480464 Tacrolimus results in decreased expression of CCL11 mRNA CTD PMID:15948978 CCL11 Human tamoxifen affects expression ISO Ccl11 (Mus musculus) 6480464 Tamoxifen affects the expression of CCL11 mRNA CTD PMID:17555576 CCL11 Human testosterone multiple interactions ISO Ccl11 (Rattus norvegicus) 6480464 [estradiol 3-benzoate co-treated with [Testosterone co-treated with Estradiol]] results in increased expression of CCL11 mRNA CTD PMID:32741896 CCL11 Human tetraphene increases expression ISO Ccl11 (Mus musculus) 6480464 benz(a)anthracene results in increased expression of CCL11 mRNA CTD PMID:26377693 CCL11 Human titanium dioxide increases expression ISO Ccl11 (Mus musculus) 6480464 titanium dioxide results in increased expression of CCL11 mRNA CTD PMID:21259345 CCL11 Human titanium dioxide multiple interactions ISO Ccl11 (Mus musculus) 6480464 [titanium dioxide co-treated with Azoxymethane co-treated with Dextran Sulfate] results in decreased expression of CCL11 mRNA CTD PMID:29950665 CCL11 Human titanium dioxide decreases expression ISO Ccl11 (Rattus norvegicus) 6480464 titanium dioxide results in decreased expression of CCL11 mRNA CTD PMID:30012374 CCL11 Human TMC-120A decreases expression ISO Ccl11 (Mus musculus) 6480464 TMC 120A results in decreased expression of CCL11 mRNA CTD PMID:19818335 CCL11 Human toluene 2,4-diisocyanate increases expression ISO Ccl11 (Rattus norvegicus) 6480464 Toluene 2 and 4-Diisocyanate results in increased expression of CCL11 mRNA CTD PMID:15823807 CCL11 Human toluene 2,4-diisocyanate increases expression ISO Ccl11 (Mus musculus) 6480464 Toluene 2 and 4-Diisocyanate results in increased expression of CCL11 protein CTD PMID:17015710 and PMID:20219652 CCL11 Human toluene 2,4-diisocyanate multiple interactions ISO Ccl11 (Mus musculus) 6480464 BAY 11-7085 inhibits the reaction [Toluene 2 more ... CTD PMID:17015710 CCL11 Human tremolite asbestos increases expression ISO Ccl11 (Mus musculus) 6480464 tremolite results in increased expression of CCL11 mRNA CTD PMID:29279043 CCL11 Human trichostatin A multiple interactions EXP 6480464 trichostatin A inhibits the reaction [Nickel affects the expression of CCL11 mRNA] CTD PMID:14575637 CCL11 Human trimellitic anhydride decreases expression ISO Ccl11 (Mus musculus) 6480464 trimellitic anhydride results in decreased expression of CCL11 mRNA CTD PMID:19042947 CCL11 Human trimellitic anhydride increases expression ISO Ccl11 (Mus musculus) 6480464 trimellitic anhydride results in increased expression of CCL11 protein CTD PMID:20219652 CCL11 Human Triptolide increases expression ISO Ccl11 (Mus musculus) 6480464 triptolide results in increased expression of CCL11 mRNA CTD PMID:24949944 CCL11 Human Triptolide multiple interactions ISO Ccl11 (Mus musculus) 6480464 IL17A protein promotes the reaction [triptolide results in increased expression of CCL11 mRNA] CTD PMID:24949944 CCL11 Human troglitazone multiple interactions EXP 6480464 PPARA protein affects the reaction [troglitazone inhibits the reaction [TNF protein results in increased expression of CCL11 protein]] more ... CTD PMID:15531761 CCL11 Human troglitazone decreases activity EXP 6480464 troglitazone results in decreased activity of CCL11 protein CTD PMID:12644321 CCL11 Human valproic acid decreases expression ISO Ccl11 (Rattus norvegicus) 6480464 Valproic Acid results in decreased expression of CCL11 mRNA CTD PMID:35594946 CCL11 Human zileuton multiple interactions ISO Ccl11 (Mus musculus) 6480464 zileuton inhibits the reaction [Ovalbumin results in increased expression of CCL11 mRNA] CTD PMID:12794006 CCL11 Human zinc dichloride increases expression EXP 6480464 zinc chloride results in increased expression of CCL11 mRNA CTD PMID:19428942
Imported Annotations - KEGG (archival)
Imported Annotations - PID (archival)
acute kidney failure (ISO) allergic conjunctivitis (ISO) allergic disease (EXP) allergic rhinitis (ISO) asthma (EXP,IAGP,IEP,ISO) atopic dermatitis (EXP) brain ischemia (EXP) Bronchial Hyperreactivity (ISO) bronchiolitis (IEP,ISO) cataract (ISO) Chronic Bronchitis (IEP) chronic obstructive pulmonary disease (IEP) cystic fibrosis (IEP) Diabetic Nephropathies (IEP) drug allergy (EXP) endometriosis (EXP,ISO) Eosinophilia (IEP) Experimental Autoimmune Encephalomyelitis (ISO) Fibrosis (ISO) focal segmental glomerulosclerosis (ISO) human immunodeficiency virus infectious disease (EXP,IAGP,IEP) Human Influenza (ISO) hyperglycemia (IDA,IEP) Immediate Hypersensitivity (ISO) Inflammation (EXP) interstitial nephritis (IEP) Kidney Reperfusion Injury (ISO) mucopolysaccharidosis IV (IEP) Multiple Organ Failure (ISO) Nasal Polyps (IEP) nephrotic syndrome type 1 (IEP) Neurodevelopmental Disorders (IAGP) Picornaviridae Infections (ISO) pleurisy (ISO) pneumonia (EXP,ISO) Polyomavirus Infections (EXP) prostatitis (ISO) pulmonary emphysema (IEP) pulmonary eosinophilia (ISO) pulmonary fibrosis (EXP,IEP,ISO) Reperfusion Injury (ISO) respiratory allergy (EXP) respiratory syncytial virus infectious disease (ISO) Respiratory Tract Granuloma (ISO) rhinitis (IEP,ISO) Sepsis (ISO) Toxocara Canis Infection (Canine Roundworms) (ISO) type 1 diabetes mellitus (ISO) ureteral obstruction (IEP) viral pneumonia (IEP)
1,4-benzoquinone (EXP) 1-chloro-2,4-dinitrobenzene (ISO) 1-naphthyl isothiocyanate (ISO) 17alpha-ethynylestradiol (ISO) 17beta-estradiol (ISO) 17beta-estradiol 3-benzoate (ISO) 2,2',5,5'-tetrachlorobiphenyl (EXP) 2,3,7,8-tetrachlorodibenzodioxine (ISO) 2,4-D (ISO) 2,4-dibromophenyl 2,4,5-tribromophenyl ether (ISO) 3,3',4,4',5-pentachlorobiphenyl (ISO) 3-chlorophenol (EXP) 6-propyl-2-thiouracil (ISO) 9,10-phenanthroquinone (ISO) actinomycin D (EXP) aluminium sulfate (anhydrous) (ISO) ammonium chloride (ISO) antirheumatic drug (EXP) apocynin (EXP) arsenous acid (ISO) asbestos (EXP) Azoxymethane (ISO) Bardoxolone methyl (ISO) barium sulfate (ISO) beclomethasone (EXP) benzalkonium chloride (ISO) benzene-1,2,4-triol (EXP) benzo[a]pyrene (EXP,ISO) bexarotene (ISO) bis(2-chloroethyl) sulfide (EXP) bisphenol A (EXP,ISO) bisphenol AF (ISO) Bisphenol B (ISO) bleomycin A2 (ISO) Brevianamide A (ISO) budesonide (EXP) cadmium dichloride (EXP) Calcimycin (EXP) calcium atom (EXP) calcium(0) (EXP) carbon nanotube (ISO) catechol (EXP) ceric oxide (ISO) CGP 52608 (EXP) chloroquine (EXP,ISO) choline (ISO) chromium(6+) (ISO) clopidogrel (ISO) copper atom (ISO) copper(0) (ISO) Cuprizon (ISO) deoxynivalenol (ISO) dexamethasone (EXP,ISO) dextran sulfate (ISO) diarsenic trioxide (ISO) dichlorine (ISO) diethylstilbestrol (ISO) diisononyl phthalate (ISO) dimethylarsinic acid (ISO) dioxygen (ISO) diuron (ISO) doxorubicin (EXP) emamectin benzoate (EXP) ethanol (EXP) ferric oxide (ISO) Fexofenadine hydrochloride (EXP) flutamide (ISO) fluticasone (EXP) Fulvic acid (EXP) fumaric acid (ISO) furan (ISO) genistein (ISO) gentamycin (ISO) graphene oxide (ISO) heparin (ISO) hydroquinone (EXP) indole-3-methanol (ISO) ionomycin (EXP) lead(0) (ISO) lipopolysaccharide (EXP,ISO) LY294002 (EXP) mercury dichloride (ISO) metam (ISO) methimazole (ISO) methotrexate (EXP) methylmercury chloride (ISO) microcystin-LR (ISO) MK 571 (ISO) mycotoxin (ISO) N-acetyl-L-cysteine (EXP,ISO) N-nitrosodiethylamine (ISO) neoechinulin A (ISO) nickel atom (EXP) nickel sulfate (EXP,ISO) nitrogen dioxide (ISO) ozone (ISO) paracetamol (EXP) paraquat (ISO) phorbol 13-acetate 12-myristate (EXP) phthalic anhydride (ISO) pioglitazone (ISO) pirinixic acid (ISO) poly(I:C) (ISO) polymyxin B2 (ISO) prednisolone (ISO) prednisone (EXP) reactive oxygen species (EXP) resveratrol (EXP,ISO) rotenone (ISO) S-butyl-DL-homocysteine (S,R)-sulfoximine (ISO) Salmeterol xinafoate (EXP) SB 203580 (ISO) serpentine asbestos (EXP,ISO) sodium arsenite (ISO) sodium dichromate (EXP) sulforaphane (ISO) synephrine (EXP,ISO) syringin (ISO) tacrolimus hydrate (EXP) tamoxifen (ISO) testosterone (ISO) tetraphene (ISO) titanium dioxide (ISO) TMC-120A (ISO) toluene 2,4-diisocyanate (ISO) tremolite asbestos (ISO) trichostatin A (EXP) trimellitic anhydride (ISO) Triptolide (ISO) troglitazone (EXP) valproic acid (ISO) zileuton (ISO) zinc dichloride (EXP)
Biological Process
actin filament organization (IEA,ISO) antimicrobial humoral immune response mediated by antimicrobial peptide (IBA,IDA) branching involved in mammary gland duct morphogenesis (IEA) cell adhesion (TAS) chemokine-mediated signaling pathway (IBA,IDA) chemotaxis (IEA,TAS) chronic inflammatory response (IEA,ISO) cytoskeleton organization (IDA) eosinophil chemotaxis (IBA,IDA,IEA,ISO) ERK1 and ERK2 cascade (IEA,ISO) immune response (IEA) inflammatory response (IBA,IEA,TAS) intracellular calcium ion homeostasis (TAS) learning or memory (IEA,ISS) mammary duct terminal end bud growth (IEA) mast cell chemotaxis (IEA,ISO) negative regulation of neurogenesis (IEA,ISS) positive regulation of actin filament polymerization (IDA) positive regulation of angiogenesis (IEA) positive regulation of cell migration (IBA,IDA) positive regulation of endothelial cell proliferation (IDA) protein phosphorylation (TAS) regulation of cell shape (IDA) response to interleukin-13 (IEA,ISO) response to interleukin-4 (IEA,ISO) response to radiation (TAS) response to virus (TAS) signal transduction (TAS)
1.
Cytokine production increases and cytokine clearance decreases in mice with bilateral nephrectomy.
Andres-Hernando A, etal., Nephrol Dial Transplant. 2012 Dec;27(12):4339-47. doi: 10.1093/ndt/gfs256. Epub 2012 Jul 9.
2.
Eotaxin and CCR3 are up-regulated in exacerbations of chronic bronchitis.
Bocchino V, etal., Allergy. 2002 Jan;57(1):17-22.
3.
Eotaxin and capping protein in experimental vasculopathy.
Chen J, etal., Am J Pathol. 1998 Jul;153(1):81-90.
4.
The acute effect of clamped hyperglycemia on the urinary excretion of inflammatory cytokines/chemokines in uncomplicated type 1 diabetes: a pilot study.
Cherney DZ, etal., Diabetes Care. 2011 Jan;34(1):177-80. doi: 10.2337/dc10-1219. Epub 2010 Sep 14.
5.
The effect of aliskiren on urinary cytokine/chemokine responses to clamped hyperglycaemia in type 1 diabetes.
Cherney DZ, etal., Diabetologia. 2013 Jul 28.
6.
Intrinsic expression of Th2 cytokines in urothelium of congenital ureteropelvic junction obstruction.
Chiou YY, etal., Kidney Int. 2005 Feb;67(2):638-46.
7.
Cytokine-chemokine networks in experimental mycobacterial and schistosomal pulmonary granuloma formation.
Chiu BC, etal., Am J Respir Cell Mol Biol. 2003 Jul;29(1):106-16. Epub 2003 Jan 10.
8.
Eosinophil and T cell markers predict functional decline in COPD patients.
D'Armiento JM, etal., Respir Res. 2009 Nov 19;10:113.
9.
Relationship between eosinophilia and levels of chemokines (CCL5 and CCL11) and IL-5 in bronchoalveolar lavage fluid of patients with mustard gas-induced pulmonary fibrosis.
Emad A and Emad Y, J Clin Immunol. 2007 Nov;27(6):605-12. Epub 2007 Jul 10.
10.
Bacillus anthracis edema toxin causes extensive tissue lesions and rapid lethality in mice.
Firoved AM, etal., Am J Pathol. 2005 Nov;167(5):1309-20.
11.
T helper-2 immunity regulates bronchial hyperresponsiveness in eosinophil-associated gastrointestinal disease in mice.
Forbes E, etal., Gastroenterology. 2004 Jul;127(1):105-18.
12.
A central regulatory role for eosinophils and the eotaxin/CCR3 axis in chronic experimental allergic airway inflammation.
Fulkerson PC, etal., Proc Natl Acad Sci U S A. 2006 Oct 31;103(44):16418-23. Epub 2006 Oct 23.
13.
GOAs Human GO annotations
GOA_HUMAN data from the GO Consortium
14.
Eotaxin expression in Sephadex-induced lung injury in rats.
Guo RF, etal., Am J Pathol. 1999 Dec;155(6):2001-8.
15.
Regulatory effects of eotaxin on acute lung inflammatory injury.
Guo RF, etal., J Immunol. 2001 Apr 15;166(8):5208-18.
16.
mRNA differential display analysis of nephrotic kidney glomeruli.
Haltia A, etal., Exp Nephrol. 1999 Jan-Feb;7(1):52-8.
17.
Expression of proinflammatory genes during estrogen-induced inflammation of the rat prostate.
Harris MT, etal., Prostate. 2000 Jun 15;44(1):19-25.
18.
Role of Eotaxin-1 (CCL11) and CC chemokine receptor 3 (CCR3) in bleomycin-induced lung injury and fibrosis.
Huaux F, etal., Am J Pathol. 2005 Dec;167(6):1485-96.
19.
Quantitative expression levels of regulated on activation, normal T cell expressed and secreted and eotaxin transcripts in toluene diisocyanate-induced allergic rats.
Im GJ, etal., Acta Otolaryngol. 2005 Apr;125(4):370-7.
20.
Glucocorticosteroids inhibit mRNA expression for eotaxin, eotaxin-2, and monocyte-chemotactic protein-4 in human airway inflammation with eosinophilia.
Jahnsen FL, etal., J Immunol. 1999 Aug 1;163(3):1545-51.
21.
A role for CD44 in an antigen-induced murine model of pulmonary eosinophilia.
Katoh S, etal., J Clin Invest. 2003 May;111(10):1563-70.
22.
Eosinophil cationic protein and chemokines in nasopharyngeal secretions of infants with respiratory syncytial virus (RSV) bronchiolitis and non-RSV bronchiolitis.
Kim HH, etal., J Korean Med Sci. 2007 Feb;22(1):37-42.
23.
Platelet-activating factor drives eotaxin production in an allergic pleurisy in mice.
Klein A, etal., Br J Pharmacol. 2002 Mar;135(5):1213-8.
24.
HIV infection is associated with higher levels of monocyte chemoattractant protein-1 and eotaxin among people with recent hepatitis C virus infection.
Lamoury FM, etal., BMC Infect Dis. 2016 Jun 1;16:241. doi: 10.1186/s12879-016-1567-2.
25.
The migration of T cells in response to influenza virus is altered in neonatal mice.
Lines JL, etal., J Immunol. 2010 Sep 1;185(5):2980-8. Epub 2010 Jul 23.
26.
[The roles of interleukin-5 and eotaxin in signal transmission between lung and bone marrow of rat asthmatic models]
Liu CT, etal., Zhonghua Jie He He Hu Xi Za Zhi. 2006 Aug;29(8):558-62.
27.
Multiplex bead analysis of urinary cytokines of type 2 diabetic patients with normo- and microalbuminuria.
Liu J, etal., J Immunoassay Immunochem. 2010 Oct;31(4):279-89.
28.
Zinc suppressed the airway inflammation in asthmatic rats: effects of zinc on generation of eotaxin, MCP-1, IL-8, IL-4, and IFN-gamma.
Lu H, etal., Biol Trace Elem Res. 2012 Dec;150(1-3):314-21. doi: 10.1007/s12011-012-9493-7. Epub 2012 Aug 30.
29.
Immune profile and Epstein-Barr virus infection in acute interstitial nephritis: an immunohistochemical study in 78 patients.
Mansur A, etal., Nephron Clin Pract. 2011;119(4):c293-300. doi: 10.1159/000329671. Epub 2011 Sep 21.
30.
Biomarker analysis of Morquio syndrome: identification of disease state and drug responsive markers.
Martell L, etal., Orphanet J Rare Dis. 2011 Dec 16;6:84. doi: 10.1186/1750-1172-6-84.
31.
Differential cytokine mRNA expression in Dermatophagoides farinae allergen-sensitized and respiratory syncytial virus-infected mice.
Matsuse H, etal., Microbes Infect. 2000 Jun;2(7):753-9.
32.
Role of CCL11 in eosinophilic lung disease during respiratory syncytial virus infection.
Matthews SP, etal., J Virol. 2005 Feb;79(4):2050-7.
33.
Computed tomographic scan-diagnosed chronic obstructive pulmonary disease-emphysema: eotaxin-1 is associated with bronchodilator response and extent of emphysema.
Miller M, etal., J Allergy Clin Immunol. 2007 Nov;120(5):1118-25.
34.
Comparison of plasma eotaxin family level in aspirin-induced and aspirin-tolerant asthma patients.
Min JW, etal., Chest. 2005 Nov;128(5):3127-32.
35.
Production of granulomatous inflammation in lungs of rat pups and adults by Sephadex beads.
Miyake M, etal., Pediatr Res. 2004 Aug;56(2):205-11. Epub 2004 Jun 4.
36.
Rhinovirus infection of allergen-sensitized and -challenged mice induces eotaxin release from functionally polarized macrophages.
Nagarkar DR, etal., J Immunol. 2010 Aug 15;185(4):2525-35. Epub 2010 Jul 19.
37.
Genetic variants of CC chemokine genes in experimental autoimmune encephalomyelitis, multiple sclerosis and rheumatoid arthritis.
Ockinger J, etal., Genes Immun. 2010 Mar;11(2):142-54. Epub 2009 Oct 29.
38.
OMIM Disease Annotation Pipeline
OMIM Disease Annotation Pipeline
39.
Comparison of the cytokine and chemokine dynamics of the early inflammatory response in models of burn injury and infection.
Orman MA, etal., Cytokine. 2011 Sep;55(3):362-71. doi: 10.1016/j.cyto.2011.05.010. Epub 2011 Jun 8.
40.
Mast-cell activation augments the late phase reaction in experimental immune-mediated blepharoconjunctivitis.
Ozaki A, etal., Graefes Arch Clin Exp Ophthalmol. 2003 May;241(5):394-402. Epub 2003 Apr 4.
41.
Influence of murine Toxocara canis infection on plasma and bronchoalveolar lavage fluid eosinophil numbers and its correlation with cytokine levels.
Pecinali NR, etal., Vet Parasitol. 2005 Nov 25;134(1-2):121-30. Epub 2005 Sep 15.
42.
Invariant natural killer T cell agonist modulates experimental focal and segmental glomerulosclerosis.
Pereira RL, etal., PLoS One. 2012;7(3):e32454. doi: 10.1371/journal.pone.0032454. Epub 2012 Mar 12.
43.
KEGG Annotation Import Pipeline
Pipeline to import KEGG annotations from KEGG into RGD
44.
PID Annotation Import Pipeline
Pipeline to import Pathway Interaction Database annotations from NCI into RGD
45.
ClinVar Automated Import and Annotation Pipeline
RGD automated import pipeline for ClinVar variants, variant-to-disease annotations and gene-to-disease annotations
46.
Data Import for Chemical-Gene Interactions
RGD automated import pipeline for gene-chemical interactions
47.
RGD HPO Phenotype Annotation Pipeline
RGD automated import pipeline for human HPO-to-gene-to-disease annotations
48.
Targeted disruption of the chemokine eotaxin partially reduces antigen-induced tissue eosinophilia.
Rothenberg ME, etal., J Exp Med. 1997 Feb 17;185(4):785-90.
49.
Nasal lavage fluid concentrations of eotaxin-1 (CCL11) in naturally occurring allergic rhinitis: relationship to disease activity, nasal luminal eosinophil influx, and plasma protein exudation.
Salib RJ, etal., Clin Exp Allergy. 2005 Aug;35(8):995-1002.
50.
Modulation of eotaxin formation and eosinophil migration by selective inhibitors of phosphodiesterase type 4 isoenzyme.
Silva PM, etal., Br J Pharmacol. 2001 Sep;134(2):283-94.
51.
Innate and adaptive mediators in cystic fibrosis and allergic fungal rhinosinusitis.
Skinner ML, etal., Am J Rhinol. 2007 Sep-Oct;21(5):538-41.
52.
Granulocyte-macrophage colony-stimulating factor is required for bronchial eosinophilia in a murine model of allergic airway inflammation.
Su YC, etal., J Immunol. 2008 Feb 15;180(4):2600-7.
53.
Nicotine exposure exacerbates development of cataracts in a type 1 diabetic rat model.
Tirgan N, etal., Exp Diabetes Res. 2012;2012:349320. doi: 10.1155/2012/349320. Epub 2012 Sep 20.
54.
Cytokine and chemokine expression in a rat endometriosis is similar to that in human endometriosis.
Umezawa M, etal., Cytokine. 2008 Aug;43(2):105-9. Epub 2008 Jul 1.
55.
The polymorphisms of Eotaxin 1 and CCR3 genes influence on serum IgE, Eotaxin levels and mild asthmatic children in Taiwan.
Wang TN, etal., Allergy. 2007 Oct;62(10):1125-30.
56.
Influenza A virus infection inhibits the efficient recruitment of Th2 cells into the airways and the development of airway eosinophilia.
Wohlleben G, etal., J Immunol. 2003 May 1;170(9):4601-11.
57.
Effects of cryptoporus polysaccharide on rat allergic rhinitis associated with inhibiting eotaxin mRNA expression.
Xie QM, etal., J Ethnopharmacol. 2006 Oct 11;107(3):424-30. Epub 2006 Apr 18.
58.
Effect of Tong Qiao drops on the expression of eotaxin, IL-13 in the nasal mucosa of rats with allergic rhinitis.
Xu YY, etal., J Chin Med Assoc. 2012 Oct;75(10):524-9. doi: 10.1016/j.jcma.2012.07.003. Epub 2012 Oct 2.
59.
Eotaxin-1, -2, and -3 immunoreactivity and protein concentration in the nasal polyps of eosinophilic chronic rhinosinusitis patients.
Yao T, etal., Laryngoscope. 2009 Jun;119(6):1053-9.
60.
Functional consequences of inhibiting exocytosis of Weibel-Palade bodies in acute renal ischemia.
Yasuda K, etal., Am J Physiol Renal Physiol. 2012 Mar 15;302(6):F713-21. doi: 10.1152/ajprenal.00541.2011. Epub 2011 Dec 7.
61.
Eotaxin-1 in exhaled breath condensate of stable and unstable asthma patients.
Zietkowski Z, etal., Respir Res. 2010 Aug 12;11:110.
62.
Eotaxin/CCL11 levels correlate with myocardial fibrosis and mast cell density in native and transplanted rat hearts.
Zweifel M, etal., Transplant Proc. 2010 Sep;42(7):2763-6.
CCL11 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 17 34,285,742 - 34,288,334 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 17 34,285,742 - 34,288,334 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 17 32,612,761 - 32,615,353 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 17 29,636,800 - 29,639,312 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 17 29,636,799 - 29,639,312 NCBI Celera 17 29,522,500 - 29,525,011 (+) NCBI Celera Cytogenetic Map 17 q12 NCBI HuRef 17 28,797,991 - 28,800,502 (+) NCBI HuRef CHM1_1 17 32,676,549 - 32,679,061 (+) NCBI CHM1_1 T2T-CHM13v2.0 17 35,232,017 - 35,234,610 (+) NCBI T2T-CHM13v2.0
Ccl11 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 11 81,948,658 - 81,953,781 (+) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 11 81,948,649 - 81,953,781 (+) Ensembl GRCm39 Ensembl GRCm38 11 82,057,832 - 82,062,955 (+) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 11 82,057,823 - 82,062,955 (+) Ensembl GRCm38 mm10 GRCm38 MGSCv37 11 81,871,334 - 81,876,457 (+) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 11 81,874,117 - 81,879,148 (+) NCBI MGSCv36 mm8 Celera 11 91,671,281 - 91,676,404 (+) NCBI Celera Cytogenetic Map 11 C NCBI cM Map 11 49.84 NCBI
Ccl11 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 10 67,525,975 - 67,530,576 (+) NCBI GRCr8 mRatBN7.2 10 67,028,328 - 67,032,929 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 10 67,028,328 - 67,032,926 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 10 71,649,521 - 71,654,122 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 10 71,154,872 - 71,159,475 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 10 66,615,995 - 66,620,596 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 10 69,434,965 - 69,439,566 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 10 69,434,941 - 69,439,575 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 10 69,069,783 - 69,074,384 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 10 70,279,161 - 70,283,762 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 10 70,292,783 - 70,297,384 (+) NCBI Celera 10 65,975,844 - 65,980,445 (+) NCBI Celera Cytogenetic Map 10 q26 NCBI
LOC100980531 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 19 30,175,125 - 30,195,199 (-) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 17 32,056,452 - 32,076,467 (-) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 17 22,495,737 - 22,515,144 (-) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 17 22,806,311 - 22,808,330 (-) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 17 22,806,076 - 22,808,345 (-) Ensembl panpan1.1 panPan2 PanPan1.1 Ensembl 17 22,787,541 - 22,791,604 (-) Ensembl panpan1.1 panPan2
LOC101968920 Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024405602 37,957,463 - 37,971,024 (-) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936538 847,464 - 848,907 (-) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 Ensembl NW_004936538 835,859 - 837,710 (-) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936538 835,436 - 848,907 (-) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
CCL11 Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 12 40,779,173 - 40,782,893 (-) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 12 40,779,906 - 40,782,862 (-) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 12 42,424,321 - 42,427,185 (+) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
CCL11 Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 16 27,792,699 - 27,796,437 (+) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 16 27,794,033 - 27,796,460 (+) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666075 2,223,450 - 2,226,274 (-) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
.
Predicted Target Of
Count of predictions: 266 Count of miRNA genes: 240 Interacting mature miRNAs: 252 Transcripts: ENST00000305869 Prediction methods: Miranda, Rnahybrid Result types: miRGate_prediction
1298406 BP16_H Blood pressure QTL 16 (human) 0.0004 Blood pressure hypertension susceptibility 17 14778647 40778647 Human
RH75873
Human Assembly Chr Position (strand) Source JBrowse GRCh37 17 32,614,722 - 32,614,954 UniSTS GRCh37 Build 36 17 29,638,835 - 29,639,067 RGD NCBI36 Celera 17 29,524,535 - 29,524,766 RGD Cytogenetic Map 17 q21.1-q21.2 UniSTS HuRef 17 28,800,026 - 28,800,257 UniSTS
CCL11_2928
Human Assembly Chr Position (strand) Source JBrowse GRCh37 17 32,614,555 - 32,615,115 UniSTS GRCh37 Build 36 17 29,638,668 - 29,639,228 RGD NCBI36 Celera 17 29,524,368 - 29,524,927 RGD HuRef 17 28,799,859 - 28,800,418 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
entire extraembryonic component
819
2316
1348
1496
1565
1137
1565
2
412
640
339
885
4453
3997
8
1267
734
1294
968
75
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENST00000305869 ⟹ ENSP00000302234
Type:
CODING
Position:
Human Assembly Chr Position (strand) Source GRCh38.p14 Ensembl 17 34,285,742 - 34,288,334 (+) Ensembl
RefSeq Acc Id:
NM_002986 ⟹ NP_002977
RefSeq Status:
REVIEWED
Type:
CODING
Position:
Human Assembly Chr Position (strand) Source GRCh38 17 34,285,742 - 34,288,334 (+) NCBI GRCh37 17 32,612,687 - 32,615,199 (+) ENTREZGENE Build 36 17 29,636,800 - 29,639,312 (+) NCBI Archive HuRef 17 28,797,991 - 28,800,502 (+) ENTREZGENE CHM1_1 17 32,676,549 - 32,679,061 (+) NCBI T2T-CHM13v2.0 17 35,232,017 - 35,234,610 (+) NCBI
Sequence:
AGAGAGGCTGAGACCAACCCAGAAACCACCACCTCTCACGCCAAAGCTCACACCTTCAGCCTCCAACATGAAGGTCTCCGCAGCACTTCTGTGGCTGCTGCTCATAGCAGCTGCCTTCAGCCCCCAGG
hide sequence
RefSeq Acc Id:
NP_002977 ⟸ NM_002986
- Peptide Label:
precursor
- UniProtKB:
Q92490 (UniProtKB/Swiss-Prot), P50877 (UniProtKB/Swiss-Prot), Q92491 (UniProtKB/Swiss-Prot), P51671 (UniProtKB/Swiss-Prot), Q6I9T4 (UniProtKB/TrEMBL)
- Sequence:
MKVSAALLWLLLIAAAFSPQGLAGPASVPTTCCFNLANRKIPLQRLESYRRITSGKCPQKAVIFKTKLAKDICADPKKKWVQDSMKYLDQKSPTPKP
hide sequence
Ensembl Acc Id:
ENSP00000302234 ⟸ ENST00000305869
RGD ID: 7234587 Promoter ID: EPDNEW_H23039 Type: multiple initiation site Name: CCL11_1 Description: C-C motif chemokine ligand 11 SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Human Assembly Chr Position (strand) Source GRCh38 17 34,285,742 - 34,285,802 EPDNEW
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2016-03-07
CCL11
C-C motif chemokine ligand 11
CCL11
chemokine (C-C motif) ligand 11
Symbol and/or name change
5135510 APPROVED
