Symbol:
Ptger4
Name:
prostaglandin E receptor 4
RGD ID:
628641
Description:
Enables prostaglandin E receptor activity. Involved in several processes, including intracellular signaling cassette; regulation of cytokine production; and regulation of secretion. Located in neuron projection terminus; neuronal cell body; and nuclear membrane. Used to study acute kidney failure; cystitis; end stage renal disease; myocarditis; and osteoporosis. Biomarker of retinal ischemia and transient cerebral ischemia. Human ortholog(s) of this gene implicated in ankylosing spondylitis; arteriosclerosis; and ulcerative colitis. Orthologous to human PTGER4 (prostaglandin E receptor 4); INTERACTS WITH 17beta-estradiol; 2,3,7,8-tetrachlorodibenzodioxine; 2,3-bis(4-hydroxyphenyl)propionitrile.
Type:
protein-coding
RefSeq Status:
PROVISIONAL
Previously known as:
EP4; PGE receptor EP4 subtype; PGE receptor, EP4 subtype; PGE2 receptor EP4 subtype; prostaglandin E receptor 4 (subtype EP4); prostaglandin E2 receptor EP4 subtype; prostaglandin E2 receptor type 4; prostanoid EP4 receptor; Ptger; Ptgerep4
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Candidate Gene For:
Gdil2
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 2 56,061,699 - 56,074,594 (-) NCBI GRCr8 mRatBN7.2 2 54,330,563 - 54,347,451 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 2 54,335,424 - 54,346,670 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 2 61,442,386 - 61,453,021 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 2 59,501,061 - 59,511,697 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 2 54,511,378 - 54,522,007 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 2 54,951,625 - 54,966,470 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 2 54,952,821 - 54,963,448 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 2 73,974,390 - 73,987,294 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 2 54,423,280 - 54,433,907 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 2 54,351,507 - 54,362,753 (-) NCBI Celera 2 49,982,896 - 49,993,523 (-) NCBI Celera Cytogenetic Map 2 q16 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Ptger4 Rat (-)-demecolcine increases expression ISO PTGER4 (Homo sapiens) 6480464 Demecolcine results in increased expression of PTGER4 mRNA CTD PMID:23649840 Ptger4 Rat 17alpha-ethynylestradiol affects expression ISO Ptger4 (Mus musculus) 6480464 Ethinyl Estradiol affects the expression of PTGER4 mRNA CTD PMID:17555576 Ptger4 Rat 17alpha-ethynylestradiol multiple interactions ISO Ptger4 (Mus musculus) 6480464 [Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of PTGER4 mRNA CTD PMID:17942748 Ptger4 Rat 17alpha-ethynylestradiol increases expression ISO Ptger4 (Mus musculus) 6480464 Ethinyl Estradiol results in increased expression of PTGER4 mRNA CTD PMID:17942748 Ptger4 Rat 17beta-estradiol multiple interactions ISO PTGER4 (Homo sapiens) 6480464 [Estradiol co-treated with Tetrachlorodibenzodioxin] results in increased expression of PTGER4 mRNA more ... CTD PMID:19619570 more ... Ptger4 Rat 17beta-estradiol multiple interactions EXP 6480464 PTGER4 mutant form inhibits the reaction [Estradiol results in increased expression of PPP1R9B protein] CTD PMID:17408863 Ptger4 Rat 17beta-estradiol increases expression EXP 6480464 Estradiol results in increased expression of PTGER4 protein CTD PMID:22257560 Ptger4 Rat 17beta-estradiol decreases expression EXP 6480464 Estradiol results in decreased expression of PTGER4 mRNA CTD PMID:22257560 Ptger4 Rat 17beta-estradiol decreases expression ISO PTGER4 (Homo sapiens) 6480464 Estradiol results in decreased expression of PTGER4 mRNA CTD PMID:21185374 and PMID:31614463 Ptger4 Rat 17beta-estradiol increases expression ISO PTGER4 (Homo sapiens) 6480464 Estradiol results in increased expression of PTGER4 mRNA CTD PMID:19153601 and PMID:19619570 Ptger4 Rat 17beta-hydroxy-17-methylestra-4,9,11-trien-3-one increases expression ISO PTGER4 (Homo sapiens) 6480464 Metribolone results in increased expression of PTGER4 mRNA CTD PMID:17010675 Ptger4 Rat 17beta-hydroxy-5alpha-androstan-3-one increases expression ISO PTGER4 (Homo sapiens) 6480464 Dihydrotestosterone results in increased expression of PTGER4 mRNA CTD PMID:29581250 Ptger4 Rat 2,3,7,8-tetrachlorodibenzodioxine multiple interactions ISO PTGER4 (Homo sapiens) 6480464 [Estradiol co-treated with Tetrachlorodibenzodioxin] results in increased expression of PTGER4 mRNA CTD PMID:19619570 Ptger4 Rat 2,3,7,8-tetrachlorodibenzodioxine increases expression EXP 6480464 Tetrachlorodibenzodioxin results in increased expression of PTGER4 mRNA CTD PMID:32387183 Ptger4 Rat 2,3,7,8-tetrachlorodibenzodioxine increases expression ISO Ptger4 (Mus musculus) 6480464 Tetrachlorodibenzodioxin results in increased expression of PTGER4 mRNA CTD PMID:17942748 Ptger4 Rat 2,3,7,8-tetrachlorodibenzodioxine multiple interactions ISO Ptger4 (Mus musculus) 6480464 [Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of PTGER4 mRNA CTD PMID:17942748 Ptger4 Rat 2,3,7,8-tetrachlorodibenzodioxine increases expression ISO PTGER4 (Homo sapiens) 6480464 Tetrachlorodibenzodioxin results in increased expression of PTGER4 mRNA CTD PMID:19619570 Ptger4 Rat 2,3-bis(4-hydroxyphenyl)propionitrile decreases expression EXP 6480464 2 and 3-bis(4-hydroxyphenyl)-propionitrile results in decreased expression of PTGER4 mRNA CTD PMID:22257560 Ptger4 Rat 2,4,6-trinitrobenzenesulfonic acid decreases expression EXP 6480464 Trinitrobenzenesulfonic Acid results in decreased expression of PTGER4 mRNA CTD PMID:25526689 Ptger4 Rat 2,4-dinitrobenzenesulfonic acid decreases expression ISO Ptger4 (Mus musculus) 6480464 2 and 4-dinitrobenzenesulfonic acid results in decreased expression of PTGER4 mRNA CTD PMID:30116771 Ptger4 Rat 2,4-dinitrobenzenesulfonic acid multiple interactions ISO Ptger4 (Mus musculus) 6480464 [2 and 4-dinitrobenzenesulfonic acid co-treated with GR 159897] results in increased expression of PTGER4 mRNA CTD PMID:30116771 Ptger4 Rat 3',5'-cyclic AMP multiple interactions ISO PTGER4 (Homo sapiens) 6480464 [Dinoprostone results in increased activity of PTGER4 protein] which results in increased chemical synthesis of Cyclic AMP and nickel sulfate promotes the reaction [[Dinoprostone results in increased activity of PTGER4 protein] which results in increased chemical synthesis of Cyclic AMP] CTD PMID:23526216 Ptger4 Rat 3,3',4,4',5-pentachlorobiphenyl increases expression ISO PTGER4 (Homo sapiens) 6480464 3 more ... CTD PMID:35618242 Ptger4 Rat 3,4-dichloroaniline decreases expression ISO PTGER4 (Homo sapiens) 6480464 3 and 4-dichloroaniline results in decreased expression of PTGER4 mRNA CTD PMID:24172598 Ptger4 Rat 3-methylcholanthrene increases expression ISO Ptger4 (Mus musculus) 6480464 Methylcholanthrene results in increased expression of PTGER4 mRNA CTD PMID:25926378 Ptger4 Rat 4,4'-sulfonyldiphenol decreases expression ISO Ptger4 (Mus musculus) 6480464 bisphenol S results in decreased expression of PTGER4 mRNA CTD PMID:39298647 Ptger4 Rat 4-hydroxynon-2-enal decreases expression ISO Ptger4 (Mus musculus) 6480464 4-hydroxy-2-nonenal results in decreased expression of PTGER4 mRNA CTD PMID:19191707 Ptger4 Rat 4-hydroxyphenyl retinamide increases expression ISO Ptger4 (Mus musculus) 6480464 Fenretinide results in increased expression of PTGER4 mRNA CTD PMID:28973697 Ptger4 Rat 8-epi-prostaglandin E2 affects response to substance ISO Ptger4 (Mus musculus) 6480464 PTGER4 protein affects the susceptibility to 8-isoprostaglandin E2 CTD PMID:22565502 Ptger4 Rat acetamide increases expression EXP 6480464 acetamide results in increased expression of PTGER4 mRNA CTD PMID:31881176 Ptger4 Rat afimoxifene multiple interactions ISO PTGER4 (Homo sapiens) 6480464 GPER1 protein affects the reaction [afimoxifene results in increased expression of PTGER4 mRNA] CTD PMID:19153601 Ptger4 Rat afimoxifene increases expression ISO PTGER4 (Homo sapiens) 6480464 afimoxifene results in increased expression of PTGER4 mRNA CTD PMID:19153601 Ptger4 Rat aflatoxin B1 decreases methylation ISO PTGER4 (Homo sapiens) 6480464 Aflatoxin B1 results in decreased methylation of PTGER4 gene CTD PMID:27153756 Ptger4 Rat AH23848 multiple interactions ISO PTGER4 (Homo sapiens) 6480464 [6-isopropoxy-9-oxoxanthene-2-carboxylic acid co-treated with AH 23848] inhibits the reaction [PTGER4 protein binds to SRC protein] and AH 23848 binds to and results in decreased activity of PTGER4 protein CTD PMID:19407222 and PMID:30269738 Ptger4 Rat aldehydo-D-glucose increases expression EXP 6480464 Glucose results in increased expression of PTGER4 mRNA and Glucose results in increased expression of PTGER4 protein CTD PMID:12888618 Ptger4 Rat all-trans-retinoic acid multiple interactions ISO Ptger4 (Mus musculus) 6480464 [mono-(2-ethylhexyl)phthalate co-treated with Tretinoin] results in increased expression of PTGER4 mRNA CTD PMID:36189433 Ptger4 Rat alternariol multiple interactions ISO Ptger4 (Mus musculus) 6480464 L-161982 inhibits the reaction [alternariol results in increased expression of PTGER4 protein] CTD PMID:30503586 Ptger4 Rat alternariol increases expression ISO Ptger4 (Mus musculus) 6480464 alternariol results in increased expression of PTGER4 protein CTD PMID:30503586 Ptger4 Rat ammonium chloride affects expression EXP 6480464 Ammonium Chloride affects the expression of PTGER4 mRNA CTD PMID:16483693 Ptger4 Rat antirheumatic drug decreases expression ISO PTGER4 (Homo sapiens) 6480464 Antirheumatic Agents results in decreased expression of PTGER4 mRNA CTD PMID:24449571 Ptger4 Rat aristolochic acid A increases expression ISO PTGER4 (Homo sapiens) 6480464 aristolochic acid I results in increased expression of PTGER4 mRNA CTD PMID:33212167 Ptger4 Rat arsane multiple interactions ISO PTGER4 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in decreased expression of PTGER4 mRNA and [sodium arsenite results in increased abundance of Arsenic] which results in decreased expression of PTGER4 mRNA CTD PMID:39836092 Ptger4 Rat arsenic atom multiple interactions ISO PTGER4 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in decreased expression of PTGER4 mRNA and [sodium arsenite results in increased abundance of Arsenic] which results in decreased expression of PTGER4 mRNA CTD PMID:39836092 Ptger4 Rat Azoxymethane multiple interactions ISO Ptger4 (Mus musculus) 6480464 [titanium dioxide co-treated with Azoxymethane co-treated with Dextran Sulfate] results in decreased expression of PTGER4 mRNA CTD PMID:29950665 Ptger4 Rat bellidifolin decreases expression ISO PTGER4 (Homo sapiens) 6480464 bellidifolin results in decreased expression of PTGER4 mRNA CTD PMID:33299414 Ptger4 Rat benzo[a]pyrene decreases expression ISO PTGER4 (Homo sapiens) 6480464 Benzo(a)pyrene results in decreased expression of PTGER4 mRNA CTD PMID:22316170 Ptger4 Rat benzo[a]pyrene increases expression ISO PTGER4 (Homo sapiens) 6480464 Benzo(a)pyrene results in increased expression of PTGER4 mRNA CTD PMID:21714911 and PMID:32234424 Ptger4 Rat benzo[a]pyrene diol epoxide I affects expression ISO PTGER4 (Homo sapiens) 6480464 7 more ... CTD PMID:20382639 Ptger4 Rat benzo[a]pyrene diol epoxide I increases expression ISO Ptger4 (Mus musculus) 6480464 7 more ... CTD PMID:32115946 Ptger4 Rat benzo[a]pyrene diol epoxide I multiple interactions ISO Ptger4 (Mus musculus) 6480464 N-(2-cyclohexyloxy-4-nitrophenyl)methanesulfonamide inhibits the reaction [7 more ... CTD PMID:32115946 Ptger4 Rat bexarotene decreases expression ISO Ptger4 (Mus musculus) 6480464 bexarotene results in decreased expression of PTGER4 mRNA CTD PMID:17849452 Ptger4 Rat bis(2-ethylhexyl) phthalate decreases expression EXP 6480464 Diethylhexyl Phthalate results in decreased expression of PTGER4 mRNA and Diethylhexyl Phthalate results in decreased expression of PTGER4 protein CTD PMID:15620428 and PMID:36435455 Ptger4 Rat bisphenol A increases expression EXP 6480464 bisphenol A results in increased expression of PTGER4 mRNA CTD PMID:20096755 Ptger4 Rat bisphenol A increases expression ISO Ptger4 (Mus musculus) 6480464 bisphenol A results in increased expression of PTGER4 mRNA CTD PMID:32156529 Ptger4 Rat bisphenol A decreases expression ISO PTGER4 (Homo sapiens) 6480464 bisphenol A results in decreased expression of PTGER4 mRNA CTD PMID:29275510 Ptger4 Rat bisphenol A decreases expression EXP 6480464 bisphenol A results in decreased expression of PTGER4 mRNA CTD PMID:25181051 Ptger4 Rat bisphenol F increases expression ISO Ptger4 (Mus musculus) 6480464 bisphenol F results in increased expression of PTGER4 mRNA CTD PMID:38685157 Ptger4 Rat Botulinum toxin type A multiple interactions EXP 6480464 Botulinum Toxins and Type A inhibits the reaction [Cyclophosphamide results in increased expression of PTGER4 protein] CTD PMID:18514386 Ptger4 Rat butanal increases expression ISO PTGER4 (Homo sapiens) 6480464 butyraldehyde results in increased expression of PTGER4 mRNA CTD PMID:26079696 Ptger4 Rat cadmium atom affects expression ISO PTGER4 (Homo sapiens) 6480464 Cadmium affects the expression of PTGER4 mRNA CTD PMID:21120746 Ptger4 Rat cadmium dichloride increases expression EXP 6480464 Cadmium Chloride results in increased expression of PTGER4 mRNA CTD PMID:33453195 Ptger4 Rat calcitriol decreases expression ISO PTGER4 (Homo sapiens) 6480464 Calcitriol results in decreased expression of PTGER4 mRNA CTD PMID:16002434 Ptger4 Rat captan increases expression ISO Ptger4 (Mus musculus) 6480464 Captan results in increased expression of PTGER4 mRNA CTD PMID:31558096 Ptger4 Rat carbon nanotube increases expression ISO Ptger4 (Mus musculus) 6480464 Nanotubes more ... CTD PMID:25554681 Ptger4 Rat celecoxib multiple interactions EXP 6480464 [Celecoxib co-treated with Heymann Nephritis Antigenic Complex] affects the expression of PTGER4 mRNA CTD PMID:14636300 Ptger4 Rat choline multiple interactions ISO Ptger4 (Mus musculus) 6480464 [Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in increased expression of PTGER4 mRNA CTD PMID:20938992 Ptger4 Rat cisplatin increases expression ISO PTGER4 (Homo sapiens) 6480464 Cisplatin results in increased expression of PTGER4 mRNA CTD PMID:27594783 Ptger4 Rat cisplatin decreases expression ISO PTGER4 (Homo sapiens) 6480464 Cisplatin results in decreased expression of PTGER4 mRNA CTD PMID:27392435 Ptger4 Rat cobalt dichloride decreases expression ISO PTGER4 (Homo sapiens) 6480464 cobaltous chloride results in decreased expression of PTGER4 mRNA CTD PMID:19320972 Ptger4 Rat copper atom multiple interactions ISO PTGER4 (Homo sapiens) 6480464 [NSC 689534 binds to Copper] which results in decreased expression of PTGER4 mRNA CTD PMID:20971185 Ptger4 Rat copper(0) multiple interactions ISO PTGER4 (Homo sapiens) 6480464 [NSC 689534 binds to Copper] which results in decreased expression of PTGER4 mRNA CTD PMID:20971185 Ptger4 Rat cordycepin multiple interactions ISO PTGER4 (Homo sapiens) 6480464 cordycepin inhibits the reaction [Lipopolysaccharides results in increased expression of PTGER4 mRNA] CTD PMID:30269738 Ptger4 Rat crocidolite asbestos increases expression ISO PTGER4 (Homo sapiens) 6480464 Asbestos and Crocidolite results in increased expression of PTGER4 mRNA CTD PMID:25351596 Ptger4 Rat crotonaldehyde decreases expression ISO PTGER4 (Homo sapiens) 6480464 2-butenal results in decreased expression of PTGER4 mRNA CTD PMID:20471460 Ptger4 Rat Cryptotanshinone multiple interactions ISO PTGER4 (Homo sapiens) 6480464 cryptotanshinone inhibits the reaction [Dinoprostone results in increased expression of PTGER4 protein] CTD PMID:30208247 Ptger4 Rat cyclophosphamide multiple interactions EXP 6480464 Botulinum Toxins and Type A inhibits the reaction [Cyclophosphamide results in increased expression of PTGER4 protein] CTD PMID:18514386 Ptger4 Rat cyclophosphamide increases expression EXP 6480464 Cyclophosphamide results in increased expression of PTGER4 protein CTD PMID:18514386 and PMID:20346049 Ptger4 Rat D-glucose increases expression EXP 6480464 Glucose results in increased expression of PTGER4 mRNA and Glucose results in increased expression of PTGER4 protein CTD PMID:12888618 Ptger4 Rat D-mannitol decreases expression EXP 6480464 Mannitol results in decreased expression of PTGER4 mRNA CTD PMID:12888618 Ptger4 Rat dextran sulfate multiple interactions ISO Ptger4 (Mus musculus) 6480464 [titanium dioxide co-treated with Azoxymethane co-treated with Dextran Sulfate] results in decreased expression of PTGER4 mRNA CTD PMID:29950665 Ptger4 Rat dibutyl phthalate decreases expression EXP 6480464 Dibutyl Phthalate results in decreased expression of PTGER4 mRNA CTD PMID:15620428 Ptger4 Rat dibutyl phthalate increases expression EXP 6480464 Dibutyl Phthalate results in increased expression of PTGER4 mRNA CTD PMID:21266533 Ptger4 Rat Dicyclohexyl phthalate increases expression EXP 6480464 dicyclohexyl phthalate results in increased expression of PTGER4 mRNA CTD PMID:15620428 Ptger4 Rat dieldrin increases expression ISO PTGER4 (Homo sapiens) 6480464 Dieldrin results in increased expression of PTGER4 mRNA CTD PMID:31068361 Ptger4 Rat dioxygen decreases expression ISO PTGER4 (Homo sapiens) 6480464 Oxygen deficiency results in decreased expression of PTGER4 mRNA CTD PMID:26516004 Ptger4 Rat dioxygen multiple interactions ISO Ptger4 (Mus musculus) 6480464 [NFE2L2 protein affects the susceptibility to Oxygen] which affects the expression of PTGER4 mRNA CTD PMID:30529165 Ptger4 Rat disodium selenite increases expression ISO PTGER4 (Homo sapiens) 6480464 Sodium Selenite results in increased expression of PTGER4 mRNA CTD PMID:18175754 Ptger4 Rat diuron increases expression EXP 6480464 Diuron results in increased expression of PTGER4 mRNA CTD PMID:21551480 Ptger4 Rat diuron decreases expression ISO PTGER4 (Homo sapiens) 6480464 Diuron metabolite results in decreased expression of PTGER4 mRNA CTD PMID:24172598 Ptger4 Rat dorsomorphin multiple interactions ISO PTGER4 (Homo sapiens) 6480464 [NOG protein co-treated with mercuric bromide co-treated with dorsomorphin co-treated with 4-(5-benzo(1 more ... CTD PMID:27188386 Ptger4 Rat doxorubicin multiple interactions ISO Ptger4 (Mus musculus) 6480464 [Doxorubicin co-treated with PTGS2 protein] results in increased expression of PTGER4 mRNA and [Doxorubicin co-treated with PTGS2 protein] results in increased expression of PTGER4 protein CTD PMID:19643929 Ptger4 Rat doxorubicin decreases expression ISO PTGER4 (Homo sapiens) 6480464 Doxorubicin results in decreased expression of PTGER4 mRNA CTD PMID:29803840 Ptger4 Rat enzalutamide decreases expression ISO PTGER4 (Homo sapiens) 6480464 enzalutamide results in decreased expression of PTGER4 mRNA CTD PMID:29581250 Ptger4 Rat folic acid multiple interactions ISO Ptger4 (Mus musculus) 6480464 [Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in increased expression of PTGER4 mRNA CTD PMID:20938992 Ptger4 Rat folpet increases expression ISO Ptger4 (Mus musculus) 6480464 folpet results in increased expression of PTGER4 mRNA CTD PMID:31558096 Ptger4 Rat formaldehyde increases expression ISO PTGER4 (Homo sapiens) 6480464 Formaldehyde results in increased expression of PTGER4 mRNA CTD PMID:20655997 Ptger4 Rat fulvestrant multiple interactions ISO PTGER4 (Homo sapiens) 6480464 fulvestrant inhibits the reaction [resveratrol inhibits the reaction [TNF protein results in increased expression of PTGER4 mRNA]] CTD PMID:24771768 Ptger4 Rat furosemide multiple interactions ISO Ptger4 (Mus musculus) 6480464 PTGER4 protein affects the reaction [Furosemide results in increased expression of REN mRNA] and PTGER4 protein affects the reaction [Furosemide results in increased expression of REN protein] CTD PMID:15976003 Ptger4 Rat glucose increases expression EXP 6480464 Glucose results in increased expression of PTGER4 mRNA and Glucose results in increased expression of PTGER4 protein CTD PMID:12888618 Ptger4 Rat glyphosate decreases expression EXP 6480464 Glyphosate results in decreased expression of PTGER4 mRNA CTD PMID:38314887 Ptger4 Rat hydrazine decreases expression ISO Ptger4 (Mus musculus) 6480464 hydrazine results in decreased expression of PTGER4 mRNA CTD PMID:15282401 Ptger4 Rat iron dichloride decreases expression ISO PTGER4 (Homo sapiens) 6480464 ferrous chloride results in decreased expression of PTGER4 mRNA CTD PMID:35984750 Ptger4 Rat isoliquiritigenin decreases expression ISO PTGER4 (Homo sapiens) 6480464 isoliquiritigenin results in decreased expression of PTGER4 mRNA and isoliquiritigenin results in decreased expression of PTGER4 protein CTD PMID:25094029 Ptger4 Rat kenpaullone decreases expression EXP 6480464 kenpaullone results in decreased expression of PTGER4 mRNA CTD PMID:17993264 Ptger4 Rat ketorolac multiple interactions EXP 6480464 Ketorolac inhibits the reaction [IL1B protein results in increased expression of PTGER4 mRNA] CTD PMID:10800959 Ptger4 Rat L-methionine multiple interactions ISO Ptger4 (Mus musculus) 6480464 [Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in increased expression of PTGER4 mRNA CTD PMID:20938992 Ptger4 Rat lipopolysaccharide increases expression ISO PTGER4 (Homo sapiens) 6480464 Lipopolysaccharides results in increased expression of PTGER4 mRNA CTD PMID:30269738 and PMID:35811015 Ptger4 Rat lipopolysaccharide multiple interactions ISO PTGER4 (Homo sapiens) 6480464 [S-(1 more ... CTD PMID:30269738 and PMID:35811015 Ptger4 Rat manganese atom multiple interactions ISO PTGER4 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in decreased expression of PTGER4 mRNA CTD PMID:39836092 Ptger4 Rat manganese(0) multiple interactions ISO PTGER4 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in decreased expression of PTGER4 mRNA CTD PMID:39836092 Ptger4 Rat manganese(II) chloride multiple interactions ISO PTGER4 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in decreased expression of PTGER4 mRNA CTD PMID:39836092 Ptger4 Rat mercury dibromide increases expression ISO PTGER4 (Homo sapiens) 6480464 mercuric bromide results in increased expression of PTGER4 mRNA CTD PMID:26272509 Ptger4 Rat mercury dibromide multiple interactions ISO PTGER4 (Homo sapiens) 6480464 [NOG protein co-treated with mercuric bromide co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of PTGER4 mRNA CTD PMID:27188386 Ptger4 Rat methyl methanesulfonate decreases expression ISO PTGER4 (Homo sapiens) 6480464 Methyl Methanesulfonate results in decreased expression of PTGER4 mRNA CTD PMID:23649840 Ptger4 Rat methylisothiazolinone increases expression ISO PTGER4 (Homo sapiens) 6480464 2-methyl-4-isothiazolin-3-one results in increased expression of PTGER4 mRNA CTD PMID:31629900 Ptger4 Rat mifepristone increases expression EXP 6480464 Mifepristone results in increased expression of PTGER4 mRNA and Mifepristone results in increased expression of PTGER4 protein CTD PMID:19801535 Ptger4 Rat mono(2-ethylhexyl) phthalate decreases expression EXP 6480464 mono-(2-ethylhexyl)phthalate results in decreased expression of PTGER4 mRNA and mono-(2-ethylhexyl)phthalate results in decreased expression of PTGER4 protein CTD PMID:36889213 Ptger4 Rat mono(2-ethylhexyl) phthalate multiple interactions ISO Ptger4 (Mus musculus) 6480464 [mono-(2-ethylhexyl)phthalate co-treated with Tretinoin] results in increased expression of PTGER4 mRNA CTD PMID:36189433 Ptger4 Rat mono(2-ethylhexyl) phthalate multiple interactions EXP 6480464 PTGS2 protein inhibits the reaction [mono-(2-ethylhexyl)phthalate results in decreased expression of PTGER4 mRNA] and PTGS2 protein inhibits the reaction [mono-(2-ethylhexyl)phthalate results in decreased expression of PTGER4 protein] CTD PMID:36889213 Ptger4 Rat nickel atom increases expression ISO PTGER4 (Homo sapiens) 6480464 Nickel results in increased expression of PTGER4 mRNA CTD PMID:25583101 Ptger4 Rat nickel sulfate increases expression ISO PTGER4 (Homo sapiens) 6480464 nickel sulfate results in increased expression of PTGER4 mRNA CTD PMID:22714537 Ptger4 Rat nickel sulfate multiple interactions ISO PTGER4 (Homo sapiens) 6480464 [[Dinoprostone results in increased activity of PTGER4 protein] which results in increased susceptibility to nickel sulfate] which results in increased secretion of CXCL8 protein more ... CTD PMID:23526216 Ptger4 Rat niclosamide decreases expression ISO PTGER4 (Homo sapiens) 6480464 Niclosamide results in decreased expression of PTGER4 mRNA CTD PMID:36318118 Ptger4 Rat Nonylphenol decreases expression EXP 6480464 nonylphenol results in decreased expression of PTGER4 mRNA CTD PMID:15620428 Ptger4 Rat NS-398 multiple interactions EXP 6480464 N-(2-cyclohexyloxy-4-nitrophenyl)methanesulfonamide inhibits the reaction [Sulfur Dioxide results in increased expression of PTGER4 protein] CTD PMID:21873648 Ptger4 Rat NS-398 multiple interactions ISO Ptger4 (Mus musculus) 6480464 N-(2-cyclohexyloxy-4-nitrophenyl)methanesulfonamide inhibits the reaction [7 more ... CTD PMID:32115946 Ptger4 Rat ochratoxin A increases expression ISO PTGER4 (Homo sapiens) 6480464 ochratoxin A results in increased expression of PTGER4 mRNA CTD PMID:30559759 Ptger4 Rat okadaic acid increases expression ISO PTGER4 (Homo sapiens) 6480464 Okadaic Acid results in increased expression of PTGER4 mRNA CTD PMID:38832940 Ptger4 Rat Ono-AE1-329 multiple interactions ISO Ptger4 (Mus musculus) 6480464 PTGER4 protein affects the reaction [ONO-AE1-329 inhibits the reaction [Zymosan results in increased expression of TNF mRNA]] more ... CTD PMID:11301049 Ptger4 Rat oxidopamine increases expression ISO PTGER4 (Homo sapiens) 6480464 Oxidopamine results in increased expression of PTGER4 mRNA CTD PMID:31247335 Ptger4 Rat ozone multiple interactions ISO Ptger4 (Mus musculus) 6480464 [Air Pollutants results in increased abundance of Ozone] which results in increased expression of PTGER4 mRNA CTD PMID:34911549 Ptger4 Rat paclitaxel decreases expression EXP 6480464 Paclitaxel results in decreased expression of PTGER4 mRNA CTD PMID:15585946 Ptger4 Rat panobinostat increases expression ISO PTGER4 (Homo sapiens) 6480464 panobinostat results in increased expression of PTGER4 mRNA CTD PMID:26272509 Ptger4 Rat paracetamol increases expression ISO PTGER4 (Homo sapiens) 6480464 Acetaminophen results in increased expression of PTGER4 mRNA CTD PMID:26690555 Ptger4 Rat paracetamol increases expression EXP 6480464 Acetaminophen results in increased expression of PTGER4 mRNA CTD PMID:33387578 Ptger4 Rat perfluorooctane-1-sulfonic acid multiple interactions ISO Ptger4 (Mus musculus) 6480464 [perfluorooctane sulfonic acid co-treated with Pectins] results in decreased expression of PTGER4 mRNA CTD PMID:36331819 Ptger4 Rat phenylmercury acetate increases expression ISO PTGER4 (Homo sapiens) 6480464 Phenylmercuric Acetate results in increased expression of PTGER4 mRNA CTD PMID:26272509 Ptger4 Rat phenylmercury acetate multiple interactions ISO PTGER4 (Homo sapiens) 6480464 [NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of PTGER4 mRNA CTD PMID:27188386 Ptger4 Rat pirinixic acid decreases expression ISO Ptger4 (Mus musculus) 6480464 pirinixic acid results in decreased expression of PTGER4 mRNA CTD PMID:17426115 and PMID:20813756 Ptger4 Rat piroxicam decreases expression ISO PTGER4 (Homo sapiens) 6480464 Piroxicam results in decreased expression of PTGER4 mRNA CTD PMID:21858171 Ptger4 Rat pristane increases expression ISO Ptger4 (Mus musculus) 6480464 pristane results in increased expression of PTGER4 mRNA CTD PMID:15075356 Ptger4 Rat progesterone decreases expression EXP 6480464 Progesterone results in decreased expression of PTGER4 protein CTD PMID:19801535 Ptger4 Rat prostaglandin E2 multiple interactions ISO Ptger4 (Mus musculus) 6480464 Dinoprostone binds to and results in decreased activity of PTGER4 protein CTD PMID:12009843 Ptger4 Rat prostaglandin E2 increases expression ISO PTGER4 (Homo sapiens) 6480464 Dinoprostone results in increased expression of PTGER4 protein CTD PMID:30208247 Ptger4 Rat prostaglandin E2 multiple interactions EXP 6480464 PTGER4 mutant form inhibits the reaction [Dinoprostone results in increased expression of PPP1R9B protein] CTD PMID:17408863 Ptger4 Rat prostaglandin E2 increases expression EXP 6480464 Dinoprostone results in increased expression of PTGER4 mRNA CTD PMID:10800959 Ptger4 Rat prostaglandin E2 multiple interactions ISO PTGER4 (Homo sapiens) 6480464 [[Dinoprostone results in increased activity of PTGER4 protein] which results in increased susceptibility to nickel sulfate] which results in increased secretion of CXCL8 protein more ... CTD PMID:23526216 and PMID:30208247 Ptger4 Rat prostaglandin E2 increases activity ISO PTGER4 (Homo sapiens) 6480464 Dinoprostone results in increased activity of PTGER4 protein CTD PMID:23526216 Ptger4 Rat puromycin multiple interactions ISO Ptger4 (Mus musculus) 6480464 [Puromycin co-treated with PTGS2 protein] results in increased expression of PTGER4 mRNA and [Puromycin co-treated with PTGS2 protein] results in increased expression of PTGER4 protein CTD PMID:19643929 Ptger4 Rat Rebamipide increases expression EXP 6480464 rebamipide results in increased expression of PTGER4 mRNA CTD PMID:10882227 Ptger4 Rat resveratrol multiple interactions ISO PTGER4 (Homo sapiens) 6480464 fulvestrant inhibits the reaction [resveratrol inhibits the reaction [TNF protein results in increased expression of PTGER4 mRNA]] and resveratrol inhibits the reaction [TNF protein results in increased expression of PTGER4 mRNA] CTD PMID:24771768 Ptger4 Rat S-(1,2-dichlorovinyl)-L-cysteine multiple interactions ISO PTGER4 (Homo sapiens) 6480464 [S-(1 more ... CTD PMID:35811015 Ptger4 Rat SB 431542 multiple interactions ISO PTGER4 (Homo sapiens) 6480464 [NOG protein co-treated with mercuric bromide co-treated with dorsomorphin co-treated with 4-(5-benzo(1 more ... CTD PMID:27188386 Ptger4 Rat silicon dioxide increases expression ISO PTGER4 (Homo sapiens) 6480464 Silicon Dioxide results in increased expression of PTGER4 mRNA CTD PMID:25351596 Ptger4 Rat sodium arsenite increases stability ISO PTGER4 (Homo sapiens) 6480464 sodium arsenite results in increased stability of PTGER4 mRNA CTD PMID:25493608 Ptger4 Rat sodium arsenite multiple interactions ISO PTGER4 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in decreased expression of PTGER4 mRNA and [sodium arsenite results in increased abundance of Arsenic] which results in decreased expression of PTGER4 mRNA CTD PMID:39836092 Ptger4 Rat sodium arsenite increases expression ISO PTGER4 (Homo sapiens) 6480464 sodium arsenite results in increased expression of PTGER4 mRNA CTD PMID:29301061 Ptger4 Rat sodium arsenite decreases expression ISO Ptger4 (Mus musculus) 6480464 sodium arsenite results in decreased expression of PTGER4 mRNA CTD PMID:16014739 Ptger4 Rat sodium dichromate increases expression ISO Ptger4 (Mus musculus) 6480464 sodium bichromate results in increased expression of PTGER4 mRNA CTD PMID:31558096 Ptger4 Rat sodium hydrogensulfite multiple interactions EXP 6480464 [sodium bisulfite co-treated with sodium sulfite] results in increased expression of PTGER4 protein CTD PMID:21873648 Ptger4 Rat sodium sulfite multiple interactions EXP 6480464 [sodium bisulfite co-treated with sodium sulfite] results in increased expression of PTGER4 protein CTD PMID:21873648 Ptger4 Rat sulfur dioxide multiple interactions EXP 6480464 N-(2-cyclohexyloxy-4-nitrophenyl)methanesulfonamide inhibits the reaction [Sulfur Dioxide results in increased expression of PTGER4 protein] CTD PMID:21873648 Ptger4 Rat sulfur dioxide increases expression EXP 6480464 Sulfur Dioxide results in increased expression of PTGER4 protein CTD PMID:21873648 Ptger4 Rat tamoxifen affects expression ISO Ptger4 (Mus musculus) 6480464 Tamoxifen affects the expression of PTGER4 mRNA CTD PMID:17555576 Ptger4 Rat testosterone increases expression ISO PTGER4 (Homo sapiens) 6480464 Testosterone results in increased expression of PTGER4 mRNA CTD PMID:33359661 Ptger4 Rat tetrachloromethane affects expression ISO Ptger4 (Mus musculus) 6480464 Carbon Tetrachloride affects the expression of PTGER4 mRNA CTD PMID:17484886 Ptger4 Rat thioacetamide increases expression EXP 6480464 Thioacetamide results in increased expression of PTGER4 mRNA CTD PMID:34492290 Ptger4 Rat thiram increases expression ISO PTGER4 (Homo sapiens) 6480464 Thiram results in increased expression of PTGER4 mRNA CTD PMID:38568856 Ptger4 Rat titanium dioxide multiple interactions ISO Ptger4 (Mus musculus) 6480464 [titanium dioxide co-treated with Azoxymethane co-treated with Dextran Sulfate] results in decreased expression of PTGER4 mRNA CTD PMID:29950665 Ptger4 Rat titanium dioxide decreases methylation ISO Ptger4 (Mus musculus) 6480464 titanium dioxide results in decreased methylation of PTGER4 gene CTD PMID:35295148 Ptger4 Rat trichostatin A increases expression ISO PTGER4 (Homo sapiens) 6480464 trichostatin A results in increased expression of PTGER4 mRNA CTD PMID:24935251 Ptger4 Rat triclosan increases expression ISO PTGER4 (Homo sapiens) 6480464 Triclosan results in increased expression of PTGER4 mRNA CTD PMID:30510588 Ptger4 Rat triptonide decreases expression ISO Ptger4 (Mus musculus) 6480464 triptonide results in decreased expression of PTGER4 mRNA CTD PMID:33045310 Ptger4 Rat urethane decreases expression ISO PTGER4 (Homo sapiens) 6480464 Urethane results in decreased expression of PTGER4 mRNA CTD PMID:28818685 Ptger4 Rat valproic acid decreases expression ISO PTGER4 (Homo sapiens) 6480464 Valproic Acid results in decreased expression of PTGER4 mRNA CTD PMID:23179753 Ptger4 Rat valproic acid multiple interactions ISO PTGER4 (Homo sapiens) 6480464 [NOG protein co-treated with Valproic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of PTGER4 mRNA CTD PMID:27188386 Ptger4 Rat valproic acid increases expression ISO PTGER4 (Homo sapiens) 6480464 Valproic Acid results in increased expression of PTGER4 mRNA CTD PMID:23179753 more ... Ptger4 Rat vancomycin decreases expression ISO Ptger4 (Mus musculus) 6480464 Vancomycin results in decreased expression of PTGER4 mRNA CTD PMID:18930951 Ptger4 Rat vincristine increases expression ISO PTGER4 (Homo sapiens) 6480464 Vincristine results in increased expression of PTGER4 mRNA CTD PMID:23649840 Ptger4 Rat vinyl carbamate decreases expression ISO Ptger4 (Mus musculus) 6480464 vinyl carbamate results in decreased expression of PTGER4 mRNA CTD PMID:17849452 Ptger4 Rat zoledronic acid increases expression ISO PTGER4 (Homo sapiens) 6480464 zoledronic acid results in increased expression of PTGER4 mRNA CTD PMID:24714768
(-)-demecolcine (ISO) 17alpha-ethynylestradiol (ISO) 17beta-estradiol (EXP,ISO) 17beta-hydroxy-17-methylestra-4,9,11-trien-3-one (ISO) 17beta-hydroxy-5alpha-androstan-3-one (ISO) 2,3,7,8-tetrachlorodibenzodioxine (EXP,ISO) 2,3-bis(4-hydroxyphenyl)propionitrile (EXP) 2,4,6-trinitrobenzenesulfonic acid (EXP) 2,4-dinitrobenzenesulfonic acid (ISO) 3',5'-cyclic AMP (ISO) 3,3',4,4',5-pentachlorobiphenyl (ISO) 3,4-dichloroaniline (ISO) 3-methylcholanthrene (ISO) 4,4'-sulfonyldiphenol (ISO) 4-hydroxynon-2-enal (ISO) 4-hydroxyphenyl retinamide (ISO) 8-epi-prostaglandin E2 (ISO) acetamide (EXP) afimoxifene (ISO) aflatoxin B1 (ISO) AH23848 (ISO) aldehydo-D-glucose (EXP) all-trans-retinoic acid (ISO) alternariol (ISO) ammonium chloride (EXP) antirheumatic drug (ISO) aristolochic acid A (ISO) arsane (ISO) arsenic atom (ISO) Azoxymethane (ISO) bellidifolin (ISO) benzo[a]pyrene (ISO) benzo[a]pyrene diol epoxide I (ISO) bexarotene (ISO) bis(2-ethylhexyl) phthalate (EXP) bisphenol A (EXP,ISO) bisphenol F (ISO) Botulinum toxin type A (EXP) butanal (ISO) cadmium atom (ISO) cadmium dichloride (EXP) calcitriol (ISO) captan (ISO) carbon nanotube (ISO) celecoxib (EXP) choline (ISO) cisplatin (ISO) cobalt dichloride (ISO) copper atom (ISO) copper(0) (ISO) cordycepin (ISO) crocidolite asbestos (ISO) crotonaldehyde (ISO) Cryptotanshinone (ISO) cyclophosphamide (EXP) D-glucose (EXP) D-mannitol (EXP) dextran sulfate (ISO) dibutyl phthalate (EXP) Dicyclohexyl phthalate (EXP) dieldrin (ISO) dioxygen (ISO) disodium selenite (ISO) diuron (EXP,ISO) dorsomorphin (ISO) doxorubicin (ISO) enzalutamide (ISO) folic acid (ISO) folpet (ISO) formaldehyde (ISO) fulvestrant (ISO) furosemide (ISO) glucose (EXP) glyphosate (EXP) hydrazine (ISO) iron dichloride (ISO) isoliquiritigenin (ISO) kenpaullone (EXP) ketorolac (EXP) L-methionine (ISO) lipopolysaccharide (ISO) manganese atom (ISO) manganese(0) (ISO) manganese(II) chloride (ISO) mercury dibromide (ISO) methyl methanesulfonate (ISO) methylisothiazolinone (ISO) mifepristone (EXP) mono(2-ethylhexyl) phthalate (EXP,ISO) nickel atom (ISO) nickel sulfate (ISO) niclosamide (ISO) Nonylphenol (EXP) NS-398 (EXP,ISO) ochratoxin A (ISO) okadaic acid (ISO) Ono-AE1-329 (ISO) oxidopamine (ISO) ozone (ISO) paclitaxel (EXP) panobinostat (ISO) paracetamol (EXP,ISO) perfluorooctane-1-sulfonic acid (ISO) phenylmercury acetate (ISO) pirinixic acid (ISO) piroxicam (ISO) pristane (ISO) progesterone (EXP) prostaglandin E2 (EXP,ISO) puromycin (ISO) Rebamipide (EXP) resveratrol (ISO) S-(1,2-dichlorovinyl)-L-cysteine (ISO) SB 431542 (ISO) silicon dioxide (ISO) sodium arsenite (ISO) sodium dichromate (ISO) sodium hydrogensulfite (EXP) sodium sulfite (EXP) sulfur dioxide (EXP) tamoxifen (ISO) testosterone (ISO) tetrachloromethane (ISO) thioacetamide (EXP) thiram (ISO) titanium dioxide (ISO) trichostatin A (ISO) triclosan (ISO) triptonide (ISO) urethane (ISO) valproic acid (ISO) vancomycin (ISO) vincristine (ISO) vinyl carbamate (ISO) zoledronic acid (ISO)
Biological Process
adenylate cyclase-activating G protein-coupled receptor signaling pathway (IBA,ISO) adenylate cyclase-inhibiting G protein-coupled receptor signaling pathway (ISO) adenylate cyclase-modulating G protein-coupled receptor signaling pathway (ISO,ISS) bone development (IDA) cAMP biosynthetic process (IMP) cAMP/PKA signal transduction (IMP) cellular response to glucose stimulus (IEP) cellular response to interleukin-1 (IEP) cellular response to mechanical stimulus (ISO,ISS) cellular response to prostaglandin E stimulus (IBA,IEP,IMP) chemokinesis (IMP) ductus arteriosus closure (IMP) ERK1 and ERK2 cascade (IDA) female pregnancy (IEP) G protein-coupled receptor signaling pathway (IEA) immune response (ISO) inflammatory response (IBA) JNK cascade (IDA) maternal process involved in parturition (IEP) negative regulation of cytokine production (ISO,ISS) negative regulation of ductus arteriosus closure (IMP) negative regulation of endothelin production (IMP) negative regulation of eosinophil extravasation (ISO,ISS) negative regulation of inflammatory response (IBA,ISO,ISS) negative regulation of integrin activation (ISO,ISS) negative regulation of interleukin-1 alpha production (IMP) negative regulation of peptide secretion (IMP) negative regulation of small intestine smooth muscle contraction (IDA) negative regulation of tumor necrosis factor production (IMP) positive regulation of antral ovarian follicle growth (IMP) positive regulation of bone resorption (IMP) positive regulation of calcitonin secretion (IMP) positive regulation of cell adhesion (IMP) positive regulation of cell population proliferation (IMP) positive regulation of chemokinesis (IMP) positive regulation of circadian sleep/wake cycle, non-REM sleep (IMP) positive regulation of cytokine production (ISO,ISS) positive regulation of cytosolic calcium ion concentration (IBA) positive regulation of gene expression (IMP) positive regulation of hyaluronan biosynthetic process (IMP) positive regulation of inflammatory response (ISO,ISS) positive regulation of interleukin-10 production (IMP) positive regulation of interleukin-8 production (IMP) positive regulation of matrix metallopeptidase secretion (IMP) positive regulation of mucus secretion (IDA,IMP) positive regulation of neutrophil extravasation (IMP) positive regulation of ossification (IMP) positive regulation of osteoblast differentiation (IMP) positive regulation of ovarian follicle development (IMP) positive regulation of protein modification process (IMP) positive regulation of protein secretion (IMP) positive regulation of smooth muscle cell migration (IMP) positive regulation of substance P secretion (IMP) positive regulation of substance P secretion, neurotransmission (IMP) positive regulation of urine volume (IMP) positive regulation of wound healing (IMP) regulation of circadian sleep/wake cycle, wakefulness (IMP) regulation of ossification (ISO) regulation of stress fiber assembly (ISO,ISS) response to amino acid (IEP) response to interleukin-1 (IEP) response to lipopolysaccharide (ISO) response to mechanical stimulus (ISO) response to nematode (ISO) response to progesterone (IEP) response to prostaglandin E (IEP,ISO) response to salt (IEP) response to water-immersion restraint stress (IEP) response to xenobiotic stimulus (IEP) signal transduction (IEA) T-helper cell differentiation (ISO,ISS)
1.
Localization of functional prostaglandin E2 receptors EP3 and EP4 in the nuclear envelope.
Bhattacharya M, etal., J Biol Chem. 1999 May 28;274(22):15719-24.
2.
Discovery of highly selective EP4 receptor agonists that stimulate new bone formation and restore bone mass in ovariectomized rats.
Cameron KO, etal., Bioorg Med Chem Lett. 2006 Apr 1;16(7):1799-802. Epub 2006 Jan 26.
3.
Stimulation of EP4 receptor enhanced bone consolidation during distraction osteogenesis.
Chang F, etal., J Orthop Res. 2007 Feb;25(2):221-9.
4.
A novel antagonist of the prostaglandin E(2) EP(4) receptor inhibits Th1 differentiation and Th17 expansion and is orally active in arthritis models.
Chen Q, etal., Br J Pharmacol. 2010 May;160(2):292-310. doi: 10.1111/j.1476-5381.2010.00647.x.
5.
Expression and regulation of the rat prostaglandin E2 receptor type 4 (EP4) in pregnant cervical tissue.
Chien EK and Macgregor C, Am J Obstet Gynecol. 2003 Nov;189(5):1501-10.
6.
Expression of prostaglandin E2 receptor subtypes, EP2 and EP4, in the rat hippocampus after cerebral ischemia and ischemic tolerance.
Choi JS, etal., Cell Tissue Res. 2006 May;324(2):203-11. Epub 2006 Jan 26.
7.
Intravesical immune suppression by liposomal tacrolimus in cyclophosphamide-induced inflammatory cystitis.
Chuang YC, etal., Neurourol Urodyn. 2011 Mar;30(3):421-7. doi: 10.1002/nau.20981. Epub 2010 Sep 21.
8.
Association between prostaglandin E receptor subtype EP4 overexpression and unstable phenotype in atherosclerotic plaques in human.
Cipollone F, etal., Arterioscler Thromb Vasc Biol. 2005 Sep;25(9):1925-31. Epub 2005 Jul 14.
9.
MF498 [N-{[4-(5,9-Diethoxy-6-oxo-6,8-dihydro-7H-pyrrolo[3,4-g]quinolin-7-yl)-3-methylbe nzyl]sulfonyl}-2-(2-methoxyphenyl)acetamide], a selective E prostanoid receptor 4 antagonist, relieves joint inflammation and pain in rodent models of rheumatoid and osteoarthritis.
Clark P, etal., J Pharmacol Exp Ther. 2008 May;325(2):425-34. doi: 10.1124/jpet.107.134510. Epub 2008 Feb 20.
10.
Role of prostaglandin E2 receptor subtypes in ovarian follicle growth in the rat in vivo. Correlation with interleukin-8 and neutrophils.
El-Nefiawy N, etal., Histol Histopathol. 2005 Jul;20(3):825-31.
11.
Interaction between ERAP1 and HLA-B27 in ankylosing spondylitis implicates peptide handling in the mechanism for HLA-B27 in disease susceptibility.
Evans DM, etal., Nat Genet. 2011 Jul 10;43(8):761-7. doi: 10.1038/ng.873.
12.
Prostaglandin E2 activates Stat3 in neonatal rat ventricular cardiomyocytes: A role in cardiac hypertrophy.
Frias MA, etal., Cardiovasc Res. 2007 Jan 1;73(1):57-65. Epub 2006 Sep 27.
13.
Phylogenetic-based propagation of functional annotations within the Gene Ontology consortium.
Gaudet P, etal., Brief Bioinform. 2011 Sep;12(5):449-62. doi: 10.1093/bib/bbr042. Epub 2011 Aug 27.
14.
Rat ISS GO annotations from GOA human gene data--August 2006
GOA data from the GO Consortium
15.
Role of PGE-type receptor 4 in auditory function and noise-induced hearing loss in mice.
Hamaguchi K, etal., Neuropharmacology. 2012 Mar;62(4):1841-7. Epub 2011 Dec 16.
16.
Cyclooxygenase-2/prostaglandin E2 accelerates the healing of gastric ulcers via EP4 receptors.
Hatazawa R, etal., Am J Physiol Gastrointest Liver Physiol. 2007 Oct;293(4):G788-97. Epub 2007 Aug 2.
17.
EP4 agonist inhibits lipopolysaccharide-induced mucus secretion in airway epithelial cells.
Hattori R, etal., Ann Otol Rhinol Laryngol. 2008 Jan;117(1):51-8.
18.
Hormonal regulation of prostaglandin E2 receptors: localization and expression in rat cervical tissue.
Hinton AC, etal., Reprod Sci. 2010 Feb;17(2):136-46. doi: 10.1177/1933719109348068. Epub 2009 Oct 2.
19.
Improvement of cognitive function in Alzheimer's disease model mice by genetic and pharmacological inhibition of the EP(4) receptor.
Hoshino T, etal., J Neurochem. 2012 Mar;120(5):795-805. doi: 10.1111/j.1471-4159.2011.07567.x. Epub 2012 Jan 23.
20.
Differential regulation of renal prostaglandin receptor mRNAs by dietary salt intake in the rat.
Jensen BL, etal., Kidney Int. 1999 Aug;56(2):528-37.
21.
Comparison of prostaglandin E2 receptor subtype 4 agonist and sulfasalazine in mouse colitis prevention and treatment.
Jiang GL, etal., J Pharmacol Exp Ther. 2010 Dec;335(3):546-52. Epub 2010 Sep 10.
22.
Activation of EP4 receptors contributes to prostaglandin E2-mediated stimulation of renal sensory nerves.
Kopp UC, etal., Am J Physiol Renal Physiol. 2004 Dec;287(6):F1269-82. Epub 2004 Aug 3.
23.
16,16-Dimethyl prostaglandin E2 inhibits indomethacin-induced small intestinal lesions through EP3 and EP4 receptors.
Kunikata T, etal., Dig Dis Sci. 2002 Apr;47(4):894-904.
24.
Up-regulation of prostaglandin E receptor EP2 and EP4 subtypes in rat synovial tissues with adjuvant arthritis.
Kurihara Y, etal., Clin Exp Immunol. 2001 Feb;123(2):323-30.
25.
Investigation of multiple susceptibility loci for inflammatory bowel disease in an Italian cohort of patients.
Latiano A, etal., PLoS One. 2011;6(7):e22688. Epub 2011 Jul 27.
26.
A selective EP4 PGE2 receptor agonist alleviates disease in a new mouse model of X-linked nephrogenic diabetes insipidus.
Li JH, etal., J Clin Invest. 2009 Oct;119(10):3115-26. doi: 10.1172/JCI39680.
27.
Signaling via the prostaglandin E(2) receptor EP4 exerts neuronal and vascular protection in a mouse model of cerebral ischemia.
Liang X, etal., J Clin Invest. 2011 Nov;121(11):4362-71. doi: 10.1172/JCI46279. Epub 2011 Oct 3.
28.
Prostaglandin E2 EP4 receptor-selective agonist facilitates sternal healing after harvesting bilateral internal thoracic arteries in diabetic rats.
Marui A, etal., J Thorac Cardiovasc Surg. 2006 Mar;131(3):587-93.
29.
Rat ISS GO annotations from MGI mouse gene data--August 2006
MGD data from the GO Consortium
30.
EP2 and EP4 receptors differentially mediate MAPK pathways underlying anabolic actions of prostaglandin E2 on bone formation in rat calvaria cell cultures.
Minamizaki T, etal., Bone. 2009 Jun;44(6):1177-85. doi: 10.1016/j.bone.2009.02.010. Epub 2009 Feb 21.
31.
In vivo reopening of the neonatal ductus arteriosus by a prostanoid EP4-receptor agonist in the rat.
Momma K, etal., Prostaglandins Other Lipid Mediat. 2005 Dec;78(1-4):117-28. Epub 2005 Jun 8.
32.
Increased expression of cyclooxygenase-1 and -2 in the diabetic rat renal medulla.
Nasrallah R, etal., Am J Physiol Renal Physiol. 2003 Dec;285(6):F1068-77. Epub 2003 Jul 29.
33.
The anti-inflammatory mechanism of prostaglandin e2 receptor 4 activation in rat experimental autoimmune myocarditis.
Ngoc PB, etal., J Cardiovasc Pharmacol. 2011 Mar;57(3):365-72.
34.
Expression of the EP4 prostaglandin E2 receptor subtype with rat dextran sodium sulphate colitis: colitis suppression by a selective agonist, ONO-AE1-329.
Nitta M, etal., Scand J Immunol 2002 Jul;56(1):66-75.
35.
Relationship of EP(1-4) prostaglandin receptors with rat hypothalamic cell groups involved in lipopolysaccharide fever responses.
Oka T, etal., J Comp Neurol. 2000 Dec 4;428(1):20-32.
36.
Effects of the selective EP4 antagonist, CJ-023,423 on chronic inflammation and bone destruction in rat adjuvant-induced arthritis.
Okumura T, etal., J Pharm Pharmacol. 2008 Jun;60(6):723-30. doi: 10.1211/jpp.60.6.0007.
37.
Characterization of temporal and cell-specific changes in transcripts for prostaglandin E(2) receptors in pseudopregnant rat endometrium.
Papay KD and Kennedy TG, Biol Reprod. 2000 Jun;62(6):1515-25.
38.
GOA pipeline
RGD automated data pipeline
39.
ClinVar Automated Import and Annotation Pipeline
RGD automated import pipeline for ClinVar variants, variant-to-disease annotations and gene-to-disease annotations
40.
Data Import for Chemical-Gene Interactions
RGD automated import pipeline for gene-chemical interactions
41.
A prostaglandin E2 receptor subtype EP4 agonist attenuates cardiovascular depression in endotoxin shock by inhibiting inflammatory cytokines and nitric oxide production.
Sakamoto A, etal., Shock. 2004 Jul;22(1):76-81.
42.
Patent ductus arteriosus and neonatal death in prostaglandin receptor EP4-deficient mice.
Segi E, etal., Biochem Biophys Res Commun. 1998 May 8;246(1):7-12.
43.
Cyclooxygenase-2 in human and experimental ischemic proliferative retinopathy.
Sennlaub F, etal., Circulation. 2003 Jul 15;108(2):198-204. Epub 2003 Jun 23.
44.
A selective EP4 receptor antagonist abrogates the stimulation of osteoblast recruitment from bone marrow stromal cells by prostaglandin E2 in vivo and in vitro.
Shamir D, etal., Bone. 2004 Jan;34(1):157-62.
45.
Prostaglandin receptor subtypes, EP3C and EP4, mediate the prostaglandin E2-induced cAMP production and sensitization of sensory neurons.
Southall MD and Vasko MR, J Biol Chem. 2001 May 11;276(19):16083-91. Epub 2001 Feb 14.
46.
Role of prostaglandin E2 in the synthesis of the pro-inflammatory cytokine interleukin-6 in primary sensory neurons: an in vivo and in vitro study.
St-Jacques B and Ma W, J Neurochem. 2011 Sep;118(5):841-54. doi: 10.1111/j.1471-4159.2011.07230.x. Epub 2011 Mar 28.
47.
Effect of rebamipide on prostaglandin EP4 receptor gene expression in rat gastric mucosa.
Suetsugu H, etal., J Lab Clin Med. 2000 Jul;136(1):50-7.
48.
Effects of selective prostaglandin EP4 receptor antagonist on osteoclast formation and bone resorption in vitro.
Tomita M, etal., Bone 2002 Jan;30(1):159-63.
49.
PGE2 exerts its effect on the LPS-induced release of TNF-alpha, ET-1, IL-1alpha, IL-6 and IL-10 via the EP2 and EP4 receptor in rat liver macrophages.
Treffkorn L, etal., Prostaglandins Other Lipid Mediat. 2004 Oct;74(1-4):113-23.
50.
Role of EP2 and EP4 receptor-selective agonists of prostaglandin E(2) in acute and chronic kidney failure.
Vukicevic S, etal., Kidney Int. 2006 Sep;70(6):1099-106. Epub 2006 Jul 26.
51.
Expression of the prostaglandin E(2) (PGE(2)) receptor subtype EP(4) and its regulation by PGE(2) in osteoblastic cell lines and adult rat bone tissue.
Weinreb M, etal., Bone. 2001 Mar;28(3):275-81.
52.
Chronic activation of the prostaglandin receptor EP4 promotes hyaluronan-mediated neointimal formation in the ductus arteriosus.
Yokoyama U, etal., J Clin Invest. 2006 Nov;116(11):3026-34.
53.
Inhibition of EP4 Signaling Attenuates Aortic Aneurysm Formation.
Yokoyama U, etal., PLoS One. 2012;7(5):e36724. Epub 2012 May 3.
54.
Stimulation of bone formation and prevention of bone loss by prostaglandin E EP4 receptor activation.
Yoshida K, etal., Proc Natl Acad Sci U S A. 2002 Apr 2;99(7):4580-5. Epub 2002 Mar 26.
55.
Prostaglandin E (EP) receptor subtypes and sleep: promotion by EP4 and inhibition by EP1/EP2.
Yoshida Y, etal., Neuroreport. 2000 Jul 14;11(10):2127-31.
56.
Selective regulation of RNK-16 cell matrix metalloproteinases by the EP4 subtype of prostaglandin E2 receptor.
Zeng L, etal., Biochemistry. 1996 Jun 4;35(22):7159-64.
57.
A functional analysis of EP4 receptor-expressing neurons in mediating the action of prostaglandin E2 within specific nuclei of the brain in response to circulating interleukin-1beta.
Zhang J and Rivest S, J Neurochem. 2000 May;74(5):2134-45.
Ptger4 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 2 56,061,699 - 56,074,594 (-) NCBI GRCr8 mRatBN7.2 2 54,330,563 - 54,347,451 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 2 54,335,424 - 54,346,670 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 2 61,442,386 - 61,453,021 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 2 59,501,061 - 59,511,697 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 2 54,511,378 - 54,522,007 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 2 54,951,625 - 54,966,470 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 2 54,952,821 - 54,963,448 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 2 73,974,390 - 73,987,294 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 2 54,423,280 - 54,433,907 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 2 54,351,507 - 54,362,753 (-) NCBI Celera 2 49,982,896 - 49,993,523 (-) NCBI Celera Cytogenetic Map 2 q16 NCBI
PTGER4 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 5 40,679,915 - 40,746,800 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 5 40,679,915 - 40,693,735 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 5 40,680,017 - 40,693,837 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 5 40,715,789 - 40,729,594 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 5 40,715,788 - 40,729,592 NCBI Celera 5 40,568,598 - 40,582,403 (+) NCBI Celera Cytogenetic Map 5 p13.1 NCBI HuRef 5 40,632,020 - 40,645,825 (+) NCBI HuRef CHM1_1 5 40,681,992 - 40,695,797 (+) NCBI CHM1_1 T2T-CHM13v2.0 5 40,936,331 - 41,003,197 (+) NCBI T2T-CHM13v2.0
Ptger4 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 15 5,262,880 - 5,273,668 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 15 5,236,142 - 5,273,668 (-) Ensembl GRCm39 Ensembl GRCm38 15 5,233,399 - 5,244,187 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 15 5,206,661 - 5,244,187 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 15 5,183,404 - 5,193,831 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 15 5,181,080 - 5,191,046 (-) NCBI MGSCv36 mm8 Celera 15 5,082,719 - 5,093,146 (-) NCBI Celera Cytogenetic Map 15 A1 NCBI cM Map 15 1.99 NCBI
Ptger4 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955426 24,997,811 - 25,010,822 (+) Ensembl ChiLan1.0 ChiLan1.0 NW_004955426 24,997,811 - 25,010,822 (+) NCBI ChiLan1.0 ChiLan1.0
PTGER4 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 4 69,643,990 - 69,657,266 (-) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 5 67,797,598 - 67,810,852 (-) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 5 69,686,906 - 69,700,739 (-) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 5 74,731,470 - 74,745,121 (-) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 5 74,731,470 - 74,745,148 (-) Ensembl panpan1.1 panPan2
PTGER4 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 4 68,663,362 - 68,676,241 (-) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 4 68,663,364 - 68,676,358 (-) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 4 68,339,460 - 68,352,693 (-) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 4 69,169,559 - 69,182,795 (-) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 4 69,169,566 - 69,182,795 (-) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 4 68,929,030 - 68,942,269 (-) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 4 69,042,114 - 69,055,368 (-) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 4 69,581,192 - 69,594,491 (-) NCBI UU_Cfam_GSD_1.0
Ptger4 Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024407213 229,454,672 - 229,468,133 (+) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936518 1,903,725 - 1,916,746 (-) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936518 1,903,636 - 1,916,746 (-) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
PTGER4
PTGER4 Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 4 39,440,697 - 39,453,983 (+) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 4 39,440,276 - 39,454,004 (+) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666071 29,862,058 - 29,876,121 (+) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Ptger4
.
Assembly: mRatBN7.2 Assembly: Rnor_6.0
Predicted Target Of
Count of predictions: 41 Count of miRNA genes: 33 Interacting mature miRNAs: 41 Transcripts: ENSRNOT00000017886 Prediction methods: Miranda, Rnahybrid, Targetscan Result types: miRGate_prediction
10755430 Coatc6 Coat color QTL 6 0.02576 coat/hair pigmentation trait (VT:0010463) pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812) 2 11591100 56591100 Rat 2293671 Bss44 Bone structure and strength QTL 44 10.97 0.0001 lumbar vertebra morphology trait (VT:0010494) lumbar vertebra cortical cross-sectional area (CMO:0001690) 2 43162366 148478373 Rat 7387318 Stl32 Serum triglyceride level QTL 32 3.2 0.0003 blood triglyceride amount (VT:0002644) plasma triglyceride level (CMO:0000548) 2 22384627 67384627 Rat 10755436 Coatc8 Coat color QTL 8 0.02431 coat/hair pigmentation trait (VT:0010463) pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812) 2 35023117 80023117 Rat 1298074 Bp164 Blood pressure QTL 164 0.003 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 2 42804607 202447032 Rat 10755434 Coatc7 Coat color QTL 7 0.04794 coat/hair pigmentation trait (VT:0010463) pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812) 2 30648065 75648065 Rat 2293676 Bmd19 Bone mineral density QTL 19 10.7 0.0001 femur mineral mass (VT:0010011) total volumetric bone mineral density (CMO:0001728) 2 43162366 111362592 Rat 10755499 Bp389 Blood pressure QTL 389 2.61 arterial blood pressure trait (VT:2000000) diastolic blood pressure (CMO:0000005) 2 18960362 228801039 Rat 2293682 Bmd24 Bone mineral density QTL 24 8.9 0.0001 femur mineral mass (VT:0010011) compact volumetric bone mineral density (CMO:0001730) 2 43162366 111362592 Rat 1358917 Cm42 Cardiac mass QTL 42 2.82 heart mass (VT:0007028) heart weight to body weight ratio (CMO:0000074) 2 25413423 203928301 Rat 731167 Glom4 Glomerulus QTL 4 2.4 0.0082 kidney glomerulus morphology trait (VT:0005325) count of superficial glomeruli not directly contacting the kidney surface (CMO:0001002) 2 20304672 65304672 Rat 1358913 Cm41 Cardiac mass QTL 41 2.73 heart mass (VT:0007028) heart weight to body weight ratio (CMO:0000074) 2 25413423 203928301 Rat 152025242 Bw191 Body weight QTL 191 3.62 body mass (VT:0001259) 2 38573329 122609194 Rat 1302794 Stl27 Serum triglyceride level QTL 27 4.4 0.0001 blood triglyceride amount (VT:0002644) plasma triglyceride level (CMO:0000548) 2 25413423 143657569 Rat 61467 Bp14 Blood pressure QTL 14 2.2 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 2 43154682 202446871 Rat 10402051 Gdil2 Gastrointestinal dilation QTL 2 enteric ganglion morphology trait (VT:0001045) length of intestine affected by colonic aganglionosis to total length of colon ratio (CMO:0001836) 2 24903853 74786777 Rat 9590095 Sffal3 Serum free fatty acids level QTL 3 6.78 0.001 blood free fatty acid amount (VT:0001553) plasma free fatty acids level (CMO:0000546) 2 27157160 72157160 Rat 70174 BpQTLCluster2 Blood pressure QTL cluster 2 4.24 arterial blood pressure trait (VT:2000000) absolute change in mean arterial blood pressure (CMO:0000533) 2 40067944 102785628 Rat 1358901 Cm38 Cardiac mass QTL 38 2 heart mass (VT:0007028) heart weight to body weight ratio (CMO:0000074) 2 25413423 157142209 Rat 631208 Bw1 Body weight QTL1 5.09 mesenteric fat pad mass (VT:0010427) mesenteric fat pad weight to body weight ratio (CMO:0000654) 2 43171017 83575226 Rat 1358899 Kidm23 Kidney mass QTL 23 3.88 kidney mass (VT:0002707) both kidneys wet weight to body weight ratio (CMO:0000340) 2 25413423 157142209 Rat 1358908 Bw49 Body weight QTL 49 3.36 body mass (VT:0001259) body weight (CMO:0000012) 2 25413652 157142078 Rat 1300155 Bp174 Blood pressure QTL 174 4.09 arterial blood pressure trait (VT:2000000) absolute change in mean arterial blood pressure (CMO:0000533) 2 42804607 60653831 Rat 2293835 Kiddil5 Kidney dilation QTL 5 3.8 kidney pelvis morphology trait (VT:0004194) hydronephrosis severity score (CMO:0001208) 2 42804607 157142209 Rat 1358910 Kidm27 Kidney mass QTL 27 5.77 kidney mass (VT:0002707) both kidneys wet weight to body weight ratio (CMO:0000340) 2 25413423 157142209 Rat 61355 Bp36 Blood pressure QTL 36 2.9 blood pressure trait (VT:0000183) systolic blood pressure (CMO:0000004) 2 5873687 102844969 Rat 2300168 Bmd47 Bone mineral density QTL 47 6.6 0.0001 femur mineral mass (VT:0010011) bone mineral density (CMO:0001226) 2 20662448 65662448 Rat 1358911 Kidm28 Kidney mass QTL 28 5.42 kidney mass (VT:0002707) both kidneys wet weight to body weight ratio (CMO:0000340) 2 25413423 157142209 Rat 631266 Bp132 Blood pressure QTL 132 0.0005 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 2 46123260 202447032 Rat 1358904 Cm39 Cardiac mass QTL 39 2.26 heart mass (VT:0007028) heart weight to body weight ratio (CMO:0000074) 2 25413423 157142209 Rat 1354617 Bp240 Blood pressure QTL 240 4 arterial blood pressure trait (VT:2000000) diastolic blood pressure (CMO:0000005) 2 26917817 81754745 Rat 2293843 Kiddil6 Kidney dilation QTL 6 3.1 kidney pelvis morphology trait (VT:0004194) hydronephrosis severity score (CMO:0001208) 2 42804607 182042367 Rat 1357990 Ael1 Aortic elastin QTL 1 3.1 0.00091 aorta elastin amount (VT:0003905) aortic elastin 2 19076825 64076825 Rat 1358887 Bw50 Body weight QTL 50 2.39 body mass (VT:0001259) body weight (CMO:0000012) 2 25413652 157142078 Rat 12879863 Bp402 Blood pressure QTL 402 0.003 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 2 41125789 56532139 Rat 1354592 Rf50 Renal function QTL 50 3.5 urine output (VT:0003620) timed urine volume (CMO:0000260) 2 53822747 74786777 Rat 1298085 Bp165 Blood pressure QTL 165 0.0006 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 2 42804607 202447032 Rat 2290453 Scl55 Serum cholesterol level QTL 55 2.83 blood cholesterol amount (VT:0000180) plasma total cholesterol level (CMO:0000585) 2 26917817 136917119 Rat 152025206 Hrtrt23 Heart rate QTL 23 5.98 heart pumping trait (VT:2000009) 2 28484589 169504100 Rat 1358894 Kidm24 Kidney mass QTL 24 4.03 kidney mass (VT:0002707) both kidneys wet weight to body weight ratio (CMO:0000340) 2 25413423 157142209 Rat 731184 Mamtr4 Mammary tumor resistance QTL 4 0.0003 mammary gland integrity trait (VT:0010552) mammary tumor number (CMO:0000343) 2 16491740 61491740 Rat 152025204 Hrtrt22 Heart rate QTL 22 5.6 heart pumping trait (VT:2000009) 2 28484589 169504100 Rat 61371 Edpm1 Estrogen-dependent pituitary mass QTL 1 4 0.05 pituitary gland mass (VT:0010496) pituitary gland wet weight (CMO:0000853) 2 35134841 88029593 Rat 1354601 Slep1 Serum leptin concentration QTL 1 5.39 blood leptin amount (VT:0005667) serum leptin level (CMO:0000780) 2 43171017 184114403 Rat 1354603 Bp243 Blood pressure QTL 243 3.9 arterial blood pressure trait (VT:2000000) diastolic blood pressure (CMO:0000005) 2 26917817 127469484 Rat
SHGC-64757
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 2 54,345,526 - 54,345,700 (+) MAPPER mRatBN7.2 Rnor_6.0 2 54,962,918 - 54,963,091 NCBI Rnor6.0 Rnor_5.0 2 73,985,678 - 73,985,851 UniSTS Rnor5.0 RGSC_v3.4 2 54,433,377 - 54,433,550 UniSTS RGSC3.4 Celera 2 49,992,993 - 49,993,166 UniSTS Cytogenetic Map 2 q16 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
11
49
113
91
90
59
25
59
6
218
97
93
45
60
31
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000017886 ⟹ ENSRNOP00000017886
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 2 54,335,424 - 54,346,670 (-) Ensembl Rnor_6.0 Ensembl 2 54,952,821 - 54,963,448 (-) Ensembl
RefSeq Acc Id:
NM_032076 ⟹ NP_114465
RefSeq Status:
PROVISIONAL
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 2 56,062,895 - 56,073,522 (-) NCBI mRatBN7.2 2 54,335,429 - 54,346,057 (-) NCBI Rnor_6.0 2 54,952,821 - 54,963,448 (-) NCBI Rnor_5.0 2 73,974,390 - 73,987,294 (-) NCBI RGSC_v3.4 2 54,423,280 - 54,433,907 (-) RGD Celera 2 49,982,896 - 49,993,523 (-) RGD
Sequence:
ATGTCCATCCCCGGAGTCAACGCGTCCTTCTCCTCCACTCCGGAGAGGTTGAACAGCCCAGTGACCATTCCCGCAGTGATGTTTATCTTCGGGGTGGTGGGCAACCTGGTGGCCATCGTAGTATTGTG
hide sequence
RefSeq Acc Id:
XM_006231996 ⟹ XP_006232058
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 2 56,061,699 - 56,074,572 (-) NCBI mRatBN7.2 2 54,330,563 - 54,347,450 (-) NCBI Rnor_6.0 2 54,951,625 - 54,966,470 (-) NCBI Rnor_5.0 2 73,974,390 - 73,987,294 (-) NCBI
Sequence:
TCCTGGATCTCTGTCTCCCTCTCAACCAATCCCTTTTCCCTTCCCAACCAATCCCTTTCCAAGACTTATATCTAGTTTAGCCAAGGCCATCTGTATGAACTGAAACTATTTCCTGTAGCCTGAACTAC
hide sequence
RefSeq Acc Id:
XM_039103261 ⟹ XP_038959189
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 2 56,061,699 - 56,074,594 (-) NCBI mRatBN7.2 2 54,330,563 - 54,347,451 (-) NCBI
RefSeq Acc Id:
NP_114465 ⟸ NM_032076
- UniProtKB:
O08728 (UniProtKB/Swiss-Prot), P43114 (UniProtKB/Swiss-Prot), A0A0G2JSM6 (UniProtKB/TrEMBL), A6KGE5 (UniProtKB/TrEMBL)
- Sequence:
MSIPGVNASFSSTPERLNSPVTIPAVMFIFGVVGNLVAIVVLCKSRKEQKETTFYTLVCGLAVTDLLGTLLVSPVTIATYMKGQWPGDQALCDYSTFILLFFGLSGLSIICAMSIERYLAINHAYFYS
hide sequence
RefSeq Acc Id:
XP_006232058 ⟸ XM_006231996
- Peptide Label:
isoform X1
- UniProtKB:
O08728 (UniProtKB/Swiss-Prot), P43114 (UniProtKB/Swiss-Prot), A0A0G2JSM6 (UniProtKB/TrEMBL), A6KGE5 (UniProtKB/TrEMBL)
- Sequence:
MSIPGVNASFSSTPERLNSPVTIPAVMFIFGVVGNLVAIVVLCKSRKEQKETTFYTLVCGLAVTDLLGTLLVSPVTIATYMKGQWPGDQALCDYSTFILLFFGLSGLSIICAMSIERYLAINHAYFYS
hide sequence
Ensembl Acc Id:
ENSRNOP00000017886 ⟸ ENSRNOT00000017886
RefSeq Acc Id:
XP_038959189 ⟸ XM_039103261
- Peptide Label:
isoform X1
- UniProtKB:
P43114 (UniProtKB/Swiss-Prot), O08728 (UniProtKB/Swiss-Prot), A0A0G2JSM6 (UniProtKB/TrEMBL), A6KGE5 (UniProtKB/TrEMBL)
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2015-11-30
Ptger4
prostaglandin E receptor 4
Ptger4
prostaglandin E receptor 4 (subtype EP4)
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2010-04-23
Ptger4
prostaglandin E receptor 4 (subtype EP4)
Ptger4
prostaglandin E receptor 4
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2004-02-26
Ptger4
prostaglandin E receptor 4 (subtype EP4)
Symbol and Name status set to approved
625702 APPROVED
2003-02-27
Ptger4
prostaglandin E receptor 4 (subtype EP4)
Symbol and Name status set to provisional
70820 PROVISIONAL
Note Type
Note
Reference
gene_disease
intestinal mRNA expression increases in a dextran sodium sulfate-induced colitis model
727388
