CNGB3 (cyclic nucleotide gated channel subunit beta 3) - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Gene: CNGB3 (cyclic nucleotide gated channel subunit beta 3) Homo sapiens
Analyze
Symbol: CNGB3
Name: cyclic nucleotide gated channel subunit beta 3
RGD ID: 1352344
HGNC Page HGNC:2153
Description: Enables cGMP binding activity and intracellular cGMP-activated cation channel activity. Involved in monoatomic cation transport. Part of transmembrane transporter complex. Implicated in achromatopsia 3 and color blindness.
Type: protein-coding
RefSeq Status: REVIEWED
Previously known as: ACHM1; ACHM3; achromatopsia (rod monochromacy) 1; CNG channel beta-3; cone photoreceptor cGMP-gated cation channel beta-subunit; cyclic nucleotide gated channel beta 3; cyclic nucleotide-gated cation channel beta-3; cyclic nucleotide-gated cation channel modulatory subunit; cyclic nucleotide-gated channel beta-3; RMCH; RMCH1
RGD Orthologs
Mouse
Rat
Chinchilla
Bonobo
Dog
Squirrel
Pig
Green Monkey
Naked Mole-Rat
Alliance Genes
More Info more info ...
Allele / Splice: See ClinVar data
Latest Assembly: GRCh38 - Human Genome Assembly GRCh38
Position:
Human AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
GRCh38886,574,179 - 86,743,634 (-)NCBIGRCh38GRCh38hg38GRCh38
GRCh38.p13 Ensembl886,553,977 - 86,743,675 (-)EnsemblGRCh38hg38GRCh38
GRCh37887,586,407 - 87,755,862 (-)NCBIGRCh37GRCh37hg19GRCh37
Build 36887,655,277 - 87,825,017 (-)NCBINCBI36Build 36hg18NCBI36
Build 34887,655,278 - 87,825,017NCBI
Celera883,780,714 - 83,950,463 (-)NCBICelera
Cytogenetic Map8q21.3NCBI
HuRef882,795,582 - 82,965,151 (-)NCBIHuRef
CHM1_1887,627,665 - 87,797,926 (-)NCBICHM1_1
T2T-CHM13v2.0887,694,425 - 87,863,851 (-)NCBIT2T-CHM13v2.0
JBrowse: View Region in Genome Browser (JBrowse)
Model


Disease Annotations     Click to see Annotation Detail View

Gene-Chemical Interaction Annotations     Click to see Annotation Detail View
Molecular Pathway Annotations     Click to see Annotation Detail View
Phenotype Annotations     Click to see Annotation Detail View
References

References - curated
# Reference Title Reference Citation
1. Calcium signalling remodelling and disease. Berridge MJ Biochem Soc Trans. 2012 Apr;40(2):297-309. doi: 10.1042/BST20110766.
2. Long-term and age-dependent restoration of visual function in a mouse model of CNGB3-associated achromatopsia following gene therapy. Carvalho LS, etal., Hum Mol Genet. 2011 Aug 15;20(16):3161-75. doi: 10.1093/hmg/ddr218. Epub 2011 May 15.
3. GOAs Human GO annotations GOA_HUMAN data from the GO Consortium
4. Cyclic nucleotide-gated ion channels. Kaupp UB and Seifert R, Physiol Rev. 2002 Jul;82(3):769-824.
5. Mutations in the CNGB3 gene encoding the beta-subunit of the cone photoreceptor cGMP-gated channel are responsible for achromatopsia (ACHM3) linked to chromosome 8q21. Kohl S, etal., Hum Mol Genet. 2000 Sep 1;9(14):2107-16.
6. OMIM Disease Annotation Pipeline OMIM Disease Annotation Pipeline
7. ClinVar Automated Import and Annotation Pipeline RGD automated import pipeline for ClinVar variants, variant-to-disease annotations and gene-to-disease annotations
8. Data Import for Chemical-Gene Interactions RGD automated import pipeline for gene-chemical interactions
9. RGD HPO Phenotype Annotation Pipeline RGD automated import pipeline for human HPO-to-gene-to-disease annotations
10. Achromatopsia: the CNGB3 p.T383fsX mutation results from a founder effect and is responsible for the visual phenotype in the original report of uniparental disomy 14. Wiszniewski W, etal., Hum Genet. 2007 May;121(3-4):433-9. Epub 2007 Jan 31.
Additional References at PubMed
PMID:1347967   PMID:10330355   PMID:10888875   PMID:12477932   PMID:12730238   PMID:12815043   PMID:14757870   PMID:15134637   PMID:15161866   PMID:15223812   PMID:15657609   PMID:15712225  
PMID:16319819   PMID:16379026   PMID:16382102   PMID:17018579   PMID:17286855   PMID:17651254   PMID:17652762   PMID:19592100   PMID:19767295   PMID:20079539   PMID:20301591   PMID:20378608  
PMID:20379614   PMID:20454696   PMID:20801516   PMID:21267001   PMID:21873635   PMID:23362848   PMID:23805033   PMID:23940504   PMID:24164424   PMID:24664743   PMID:24676353   PMID:25558176  
PMID:25798074   PMID:27479814   PMID:28145975   PMID:28795510   PMID:28929832   PMID:29020838   PMID:31544997   PMID:31862882   PMID:32151571   PMID:32397729   PMID:33560291   PMID:34449556  
PMID:34703197  


Genomics

Comparative Map Data
CNGB3
(Homo sapiens - human)
Human AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
GRCh38886,574,179 - 86,743,634 (-)NCBIGRCh38GRCh38hg38GRCh38
GRCh38.p13 Ensembl886,553,977 - 86,743,675 (-)EnsemblGRCh38hg38GRCh38
GRCh37887,586,407 - 87,755,862 (-)NCBIGRCh37GRCh37hg19GRCh37
Build 36887,655,277 - 87,825,017 (-)NCBINCBI36Build 36hg18NCBI36
Build 34887,655,278 - 87,825,017NCBI
Celera883,780,714 - 83,950,463 (-)NCBICelera
Cytogenetic Map8q21.3NCBI
HuRef882,795,582 - 82,965,151 (-)NCBIHuRef
CHM1_1887,627,665 - 87,797,926 (-)NCBICHM1_1
T2T-CHM13v2.0887,694,425 - 87,863,851 (-)NCBIT2T-CHM13v2.0
Cngb3
(Mus musculus - house mouse)
Mouse AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
GRCm39419,280,850 - 19,510,623 (+)NCBIGRCm39GRCm39mm39
GRCm39 Ensembl419,280,850 - 19,510,623 (+)EnsemblGRCm39 Ensembl
GRCm38419,280,850 - 19,510,623 (+)NCBIGRCm38GRCm38mm10GRCm38
GRCm38.p6 Ensembl419,280,850 - 19,510,623 (+)EnsemblGRCm38mm10GRCm38
MGSCv37419,207,997 - 19,437,770 (+)NCBIGRCm37MGSCv37mm9NCBIm37
MGSCv36419,207,997 - 19,437,770 (+)NCBIMGSCv36mm8
Celera419,042,770 - 19,272,553 (+)NCBICelera
Cytogenetic Map4A3NCBI
Cngb3
(Rattus norvegicus - Norway rat)
Rat AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
mRatBN7.2532,746,988 - 32,995,121 (+)NCBImRatBN7.2mRatBN7.2
mRatBN7.2 Ensembl532,746,988 - 32,995,121 (+)EnsemblmRatBN7.2 Ensembl
UTH_Rnor_SHR_Utx534,860,111 - 35,109,275 (+)NCBIRnor_SHR
UTH_Rnor_SHRSP_BbbUtx_1.0536,452,691 - 36,701,842 (+)NCBIRnor_SHRSP
UTH_Rnor_WKY_Bbb_1.0536,391,804 - 36,640,963 (+)NCBIRnor_WKY
Rnor_6.0533,097,353 - 33,507,467 (+)NCBIRnor6.0Rnor_6.0rn6Rnor6.0
Rnor_6.0 Ensembl533,097,654 - 33,507,467 (+)EnsemblRnor6.0rn6Rnor6.0
Rnor_5.0537,757,561 - 38,027,396 (+)NCBIRnor5.0Rnor_5.0rn5Rnor5.0
Rnor_5.0538,090,335 - 38,161,871 (+)NCBIRnor5.0Rnor_5.0rn5Rnor5.0
RGSC_v3.4533,867,639 - 34,136,940 (+)NCBIRGSC3.4RGSC_v3.4rn4RGSC3.4
Celera531,864,644 - 32,091,469 (+)NCBICelera
Cytogenetic Map5q13NCBI
Cngb3
(Chinchilla lanigera - long-tailed chinchilla)
Chinchilla AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
ChiLan1.0 EnsemblNW_0049554174,168,766 - 4,300,437 (-)EnsemblChiLan1.0
ChiLan1.0NW_0049554174,164,328 - 4,288,516 (-)NCBIChiLan1.0ChiLan1.0
CNGB3
(Pan paniscus - bonobo/pygmy chimpanzee)
Bonobo AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
PanPan1.1885,238,043 - 85,407,023 (-)NCBIpanpan1.1PanPan1.1panPan2
PanPan1.1 Ensembl885,238,043 - 85,407,059 (-)Ensemblpanpan1.1panPan2
Mhudiblu_PPA_v0883,269,589 - 83,439,999 (-)NCBIMhudiblu_PPA_v0Mhudiblu_PPA_v0panPan3
CNGB3
(Canis lupus familiaris - dog)
Dog AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
CanFam3.12932,744,946 - 32,992,715 (-)NCBICanFam3.1CanFam3.1canFam3CanFam3.1
CanFam3.1 Ensembl2932,749,389 - 32,893,077 (-)EnsemblCanFam3.1canFam3CanFam3.1
Dog10K_Boxer_Tasha2932,904,962 - 33,048,456 (-)NCBIDog10K_Boxer_Tasha
ROS_Cfam_1.02932,900,394 - 33,163,070 (-)NCBIROS_Cfam_1.0
ROS_Cfam_1.0 Ensembl2932,904,840 - 33,048,604 (-)EnsemblROS_Cfam_1.0 Ensembl
UMICH_Zoey_3.12932,947,981 - 33,091,326 (-)NCBIUMICH_Zoey_3.1
UNSW_CanFamBas_1.02932,973,137 - 33,116,009 (-)NCBIUNSW_CanFamBas_1.0
UU_Cfam_GSD_1.02933,393,790 - 33,536,962 (-)NCBIUU_Cfam_GSD_1.0
Cngb3
(Ictidomys tridecemlineatus - thirteen-lined ground squirrel)
Squirrel AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
HiC_Itri_2NW_02440530346,487,382 - 46,625,809 (+)NCBIHiC_Itri_2
SpeTri2.0 EnsemblNW_0049365441,166,508 - 1,305,457 (-)EnsemblSpeTri2.0
SpeTri2.0NW_0049365441,166,896 - 1,305,339 (-)NCBISpeTri2.0SpeTri2.0SpeTri2.0
CNGB3
(Sus scrofa - pig)
Pig AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
Sscrofa11.1 Ensembl450,112,927 - 50,263,222 (+)EnsemblSscrofa11.1susScr11Sscrofa11.1
Sscrofa11.1450,112,927 - 50,263,264 (+)NCBISscrofa11.1Sscrofa11.1susScr11Sscrofa11.1
Sscrofa10.2455,027,871 - 55,179,235 (+)NCBISscrofa10.2Sscrofa10.2susScr3
CNGB3
(Chlorocebus sabaeus - green monkey)
Green Monkey AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
ChlSab1.1881,757,567 - 81,911,256 (-)NCBIChlSab1.1ChlSab1.1chlSab2
ChlSab1.1 Ensembl881,759,642 - 81,909,760 (-)EnsemblChlSab1.1ChlSab1.1 EnsemblchlSab2
Vero_WHO_p1.0NW_02366603959,040,485 - 59,192,743 (+)NCBIVero_WHO_p1.0Vero_WHO_p1.0
Cngb3
(Heterocephalus glaber - naked mole-rat)
Naked Mole-rat AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
HetGla_female_1.0 EnsemblNW_0046247445,042,494 - 5,207,818 (+)EnsemblHetGla_female_1.0HetGla_female_1.0 EnsemblhetGla2
HetGla 1.0NW_0046247445,059,957 - 5,209,144 (+)NCBIHetGla_female_1.0HetGla 1.0hetGla2

Variants

.
Variants in CNGB3
648 total Variants

Clinical Variants
Name Type Condition(s) Position(s) Clinical significance
NM_019098.5(CNGB3):c.1304C>T (p.Ser435Phe) single nucleotide variant Achromatopsia 3 [RCV000005532]|not provided [RCV001243215] Chr8:86632768 [GRCh38]
Chr8:87644996 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.607C>T (p.Arg203Ter) single nucleotide variant Achromatopsia 3 [RCV000005533]|Achromatopsia [RCV001272489]|Retinal dystrophy [RCV001074242]|not provided [RCV001068378] Chr8:86668055 [GRCh38]
Chr8:87680283 [GRCh37]
Chr8:8q21.3
pathogenic|likely pathogenic|conflicting interpretations of pathogenicity|conflicting data from submitters
CNGB3, 1-BP INS, 492T single nucleotide variant Achromatopsia 3 [RCV000005534] Chr8:8q21-q22 pathogenic
CNGB3, 8-BP DEL, NT819 deletion Achromatopsia 3 [RCV000005537] Chr8:8q21-q22 pathogenic
NM_019098.5(CNGB3):c.1405T>G (p.Tyr469Asp) single nucleotide variant Achromatopsia 3 [RCV000497748]|Achromatopsia [RCV001276134]|Severe early-childhood-onset retinal dystrophy [RCV000005538]|not provided [RCV000881356]|not specified [RCV000378015] Chr8:86628994 [GRCh38]
Chr8:87641222 [GRCh37]
Chr8:8q21.3
pathogenic|likely pathogenic|benign|likely benign|uncertain significance
NM_019098.5(CNGB3):c.1898A>G (p.Asp633Gly) single nucleotide variant Achromatopsia 3 [RCV001164343]|Severe early-childhood-onset retinal dystrophy [RCV001164344]|not provided [RCV000727616] Chr8:86579136 [GRCh38]
Chr8:87591364 [GRCh37]
Chr8:8q21.3
conflicting interpretations of pathogenicity|uncertain significance
NM_019098.4(CNGB3):c.1208G>A single nucleotide variant Abnormality of the eye [RCV000501136]|Achromatopsia 3 [RCV000174144]|Achromatopsia [RCV000597492]|Retinitis pigmentosa [RCV000678546]|Severe early-childhood-onset retinal dystrophy [RCV001164460]|not provided [RCV000132679]|not specified [RCV000435881] Chr8:86632864 [GRCh38]
Chr8:87645092 [GRCh37]
Chr8:8q21.3
pathogenic|likely pathogenic|benign|likely benign|conflicting interpretations of pathogenicity|uncertain significance
NM_019098.5(CNGB3):c.1148del (p.Thr383fs) deletion Abnormality of the eye [RCV000504797]|Achromatopsia 3 [RCV000005535]|Achromatopsia [RCV000328174]|CNGB3-Related Disorders [RCV000778111]|Cone-rod dystrophy [RCV000787571]|Leber congenital amaurosis [RCV000505026]|Retinal dystrophy [RCV000504902]|Retinitis pigmentosa [RCV000787822]|Stargardt Disease, Recessive [RCV000273066]|not provided [RCV000081978] Chr8:86643781 [GRCh38]
Chr8:87656009 [GRCh37]
Chr8:8q21.3
pathogenic|likely pathogenic|uncertain significance
GRCh38/hg38 8p23.3-q24.3(chr8:241530-145049449)x3 copy number gain See cases [RCV000051206] Chr8:241530..145049449 [GRCh38]
Chr8:191530..146274835 [GRCh37]
Chr8:181530..146245639 [NCBI36]
Chr8:8p23.3-q24.3
pathogenic
GRCh38/hg38 8q21.2-22.1(chr8:85835757-93610142)x3 copy number gain Developmental Delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000053676]|Developmental delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000053676]|See cases [RCV000053676] Chr8:85835757..93610142 [GRCh38]
Chr8:86847986..94622370 [GRCh37]
Chr8:86917086..94691546 [NCBI36]
Chr8:8q21.2-22.1
pathogenic
GRCh38/hg38 8p23.3-q24.3(chr8:241530-145054634)x3 copy number gain See cases [RCV000053602] Chr8:241530..145054634 [GRCh38]
Chr8:191530..146280020 [GRCh37]
Chr8:181530..146250824 [NCBI36]
Chr8:8p23.3-q24.3
pathogenic
GRCh38/hg38 8p23.3-q24.3(chr8:244417-145054775)x3 copy number gain Developmental Delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000053604]|Developmental delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000053604]|See cases [RCV000053604] Chr8:244417..145054775 [GRCh38]
Chr8:194417..146280161 [GRCh37]
Chr8:184417..146250965 [NCBI36]
Chr8:8p23.3-q24.3
pathogenic
GRCh38/hg38 8q21.13-21.3(chr8:77765431-91839285)x1 copy number loss See cases [RCV000054261] Chr8:77765431..91839285 [GRCh38]
Chr8:78677666..92851513 [GRCh37]
Chr8:78840221..92920689 [NCBI36]
Chr8:8q21.13-21.3
pathogenic
GRCh38/hg38 8q21.13-22.1(chr8:78672463-95366868)x1 copy number loss See cases [RCV000054262] Chr8:78672463..95366868 [GRCh38]
Chr8:79584698..96379096 [GRCh37]
Chr8:79747253..96448272 [NCBI36]
Chr8:8q21.13-22.1
pathogenic
NM_019098.5(CNGB3):c.2365G>A (p.Ala789Thr) single nucleotide variant not provided [RCV003078387] Chr8:86575869 [GRCh38]
Chr8:87588097 [GRCh37]
Chr8:87657213 [NCBI36]
Chr8:8q21.3
uncertain significance|not provided
NM_019098.5(CNGB3):c.1700G>A (p.Gly567Glu) single nucleotide variant Achromatopsia [RCV000787573] Chr8:86604174 [GRCh38]
Chr8:87616402 [GRCh37]
Chr8:87685518 [NCBI36]
Chr8:8q21.3
likely pathogenic|not provided
NM_019098.4(CNGB3):c.1172G>A (p.Gly391Glu) single nucleotide variant Malignant melanoma [RCV000068433] Chr8:86643757 [GRCh38]
Chr8:87655985 [GRCh37]
Chr8:87725101 [NCBI36]
Chr8:8q21.3
not provided
NM_019098.4(CNGB3):c.1162G>A (p.Asp388Asn) single nucleotide variant Malignant melanoma [RCV000068434] Chr8:86643767 [GRCh38]
Chr8:87655995 [GRCh37]
Chr8:87725111 [NCBI36]
Chr8:8q21.3
not provided
NM_019098.4(CNGB3):c.1062T>C (p.Ile354=) single nucleotide variant Malignant melanoma [RCV000068435] Chr8:86643867 [GRCh38]
Chr8:87656095 [GRCh37]
Chr8:87725211 [NCBI36]
Chr8:8q21.3
not provided
NM_019098.4(CNGB3):c.1060A>T (p.Ile354Phe) single nucleotide variant Malignant melanoma [RCV000068436] Chr8:86643869 [GRCh38]
Chr8:87656097 [GRCh37]
Chr8:87725213 [NCBI36]
Chr8:8q21.3
not provided
NM_019098.4(CNGB3):c.961C>T (p.Pro321Ser) single nucleotide variant Malignant melanoma [RCV000068437] Chr8:86647830 [GRCh38]
Chr8:87660058 [GRCh37]
Chr8:87729174 [NCBI36]
Chr8:8q21.3
not provided
NM_019098.5(CNGB3):c.384C>T (p.Ala128=) single nucleotide variant not provided [RCV000086970] Chr8:86671053 [GRCh38]
Chr8:87683281 [GRCh37]
Chr8:8q21.3
likely benign|not provided
NM_019098.5(CNGB3):c.80A>G (p.Asn27Ser) single nucleotide variant Achromatopsia 3 [RCV000388205]|Achromatopsia [RCV001826781]|Severe early-childhood-onset retinal dystrophy [RCV000331894]|not provided [RCV000086971]|not specified [RCV000242664] Chr8:86743548 [GRCh38]
Chr8:87755776 [GRCh37]
Chr8:8q21.3
benign|likely benign|uncertain significance|not provided
NM_019098.5(CNGB3):c.892A>C (p.Thr298Pro) single nucleotide variant Achromatopsia 3 [RCV000988077]|Achromatopsia [RCV001831882]|Severe early-childhood-onset retinal dystrophy [RCV000373837]|not provided [RCV001522472]|not specified [RCV000081979] Chr8:86654023 [GRCh38]
Chr8:87666251 [GRCh37]
Chr8:8q21.3
benign
NM_019098.5(CNGB3):c.424A>G (p.Arg142Gly) single nucleotide variant not provided [RCV001348209] Chr8:86671013 [GRCh38]
Chr8:87683241 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.212-14dup duplication not provided [RCV001394525] Chr8:86726662..86726663 [GRCh38]
Chr8:87738890..87738891 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.2086C>T (p.Arg696Ter) single nucleotide variant Achromatopsia 3 [RCV000576598]|not provided [RCV000893388] Chr8:86578706 [GRCh38]
Chr8:87590934 [GRCh37]
Chr8:8q21.3
pathogenic|likely pathogenic|likely benign
NM_019098.5(CNGB3):c.1607T>C (p.Met536Thr) single nucleotide variant Achromatopsia [RCV001826880]|not provided [RCV000174786] Chr8:86611643 [GRCh38]
Chr8:87623871 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.1688T>C (p.Ile563Thr) single nucleotide variant not provided [RCV000174940] Chr8:86604186 [GRCh38]
Chr8:87616414 [GRCh37]
Chr8:8q21.3
uncertain significance
GRCh38/hg38 8q21.3-24.23(chr8:86300584-137022587)x3 copy number gain See cases [RCV000135621] Chr8:86300584..137022587 [GRCh38]
Chr8:87312813..138034830 [GRCh37]
Chr8:87381929..138104012 [NCBI36]
Chr8:8q21.3-24.23
pathogenic|likely pathogenic
GRCh38/hg38 8q13.1-22.1(chr8:66171669-93505509)x3 copy number gain See cases [RCV000137050] Chr8:66171669..93505509 [GRCh38]
Chr8:67083904..94517737 [GRCh37]
Chr8:67246458..94586913 [NCBI36]
Chr8:8q13.1-22.1
pathogenic
GRCh38/hg38 8q21.3(chr8:86734484-87280161)x1 copy number loss See cases [RCV000137440] Chr8:86734484..87280161 [GRCh38]
Chr8:87746712..88292389 [GRCh37]
Chr8:87815828..88361505 [NCBI36]
Chr8:8q21.3
pathogenic|likely pathogenic|conflicting data from submitters
GRCh38/hg38 8p23.3-q24.3(chr8:241605-145054781)x3 copy number gain See cases [RCV000138643] Chr8:241605..145054781 [GRCh38]
Chr8:191605..146280167 [GRCh37]
Chr8:181605..146250971 [NCBI36]
Chr8:8p23.3-q24.3
pathogenic
GRCh38/hg38 8q21.13-24.3(chr8:77480050-145068712)x3 copy number gain See cases [RCV000139036] Chr8:77480050..145068712 [GRCh38]
Chr8:78392286..146294098 [GRCh37]
Chr8:78554841..146264902 [NCBI36]
Chr8:8q21.13-24.3
pathogenic
GRCh38/hg38 8q11.1-24.3(chr8:46031340-139285494)x3 copy number gain See cases [RCV000139539] Chr8:46031340..139285494 [GRCh38]
Chr8:46942962..140297737 [GRCh37]
Chr8:47062127..140366919 [NCBI36]
Chr8:8q11.1-24.3
pathogenic
GRCh38/hg38 8p23.3-q24.3(chr8:208048-145070385)x3 copy number gain See cases [RCV000141808] Chr8:208048..145070385 [GRCh38]
Chr8:158048..146295771 [GRCh37]
Chr8:148048..146266575 [NCBI36]
Chr8:8p23.3-q24.3
pathogenic
GRCh38/hg38 8p21.3-q24.3(chr8:21291522-145070385)x3 copy number gain See cases [RCV000142021] Chr8:21291522..145070385 [GRCh38]
Chr8:21149033..146295771 [GRCh37]
Chr8:21193313..146266575 [NCBI36]
Chr8:8p21.3-q24.3
pathogenic
GRCh38/hg38 8p23.3-q24.3(chr8:226452-145068712)x3 copy number gain See cases [RCV000142858] Chr8:226452..145068712 [GRCh38]
Chr8:176452..146294098 [GRCh37]
Chr8:166452..146264902 [NCBI36]
Chr8:8p23.3-q24.3
pathogenic
GRCh38/hg38 8q21.13-24.3(chr8:78614077-145054634)x3 copy number gain See cases [RCV000142597] Chr8:78614077..145054634 [GRCh38]
Chr8:79526312..146280020 [GRCh37]
Chr8:79688867..146250824 [NCBI36]
Chr8:8q21.13-24.3
pathogenic
GRCh38/hg38 8q21.2-21.3(chr8:83721453-87866414)x3 copy number gain See cases [RCV000143246] Chr8:83721453..87866414 [GRCh38]
Chr8:84633688..88878642 [GRCh37]
Chr8:84796243..88947758 [NCBI36]
Chr8:8q21.2-21.3
uncertain significance
GRCh38/hg38 8p23.3-q24.3(chr8:241530-145054634)x3 copy number gain See cases [RCV000148092] Chr8:241530..145054634 [GRCh38]
Chr8:191530..146280020 [GRCh37]
Chr8:181530..146250824 [NCBI36]
Chr8:8p23.3-q24.3
pathogenic
GRCh38/hg38 8q21.2-24.3(chr8:85765999-145070385)x3 copy number gain See cases [RCV000143659] Chr8:85765999..145070385 [GRCh38]
Chr8:86778228..146295771 [GRCh37]
Chr8:86863079..146266575 [NCBI36]
Chr8:8q21.2-24.3
pathogenic
NM_019098.5(CNGB3):c.2264A>G (p.Glu755Gly) single nucleotide variant Achromatopsia 3 [RCV000367023]|Achromatopsia [RCV001275879]|Severe early-childhood-onset retinal dystrophy [RCV000331014]|not provided [RCV001522470]|not specified [RCV000153049] Chr8:86575970 [GRCh38]
Chr8:87588198 [GRCh37]
Chr8:8q21.3
benign|likely benign
NM_019098.5(CNGB3):c.2214A>G (p.Glu738=) single nucleotide variant Achromatopsia 3 [RCV000381879]|Achromatopsia [RCV001275880]|Severe early-childhood-onset retinal dystrophy [RCV000287491]|not provided [RCV001522471]|not specified [RCV000153053] Chr8:86576020 [GRCh38]
Chr8:87588248 [GRCh37]
Chr8:8q21.3
benign|likely benign
NM_019098.5(CNGB3):c.2415A>C (p.Glu805Asp) single nucleotide variant Achromatopsia 3 [RCV001160703]|Achromatopsia [RCV001276120]|Severe early-childhood-onset retinal dystrophy [RCV001160702]|not provided [RCV000885622]|not specified [RCV000245417] Chr8:86575819 [GRCh38]
Chr8:87588047 [GRCh37]
Chr8:8q21.3
benign|likely benign|conflicting interpretations of pathogenicity|uncertain significance
NM_019098.5(CNGB3):c.644-1G>C single nucleotide variant Achromatopsia 3 [RCV000169108]|Achromatopsia 3 [RCV001535671]|Achromatopsia [RCV001002980]|not provided [RCV000814009] Chr8:86667134 [GRCh38]
Chr8:87679362 [GRCh37]
Chr8:8q21.3
pathogenic|likely pathogenic|conflicting interpretations of pathogenicity|not provided
NM_019098.5(CNGB3):c.391C>T (p.Gln131Ter) single nucleotide variant Achromatopsia 3 [RCV000169161]|Achromatopsia [RCV001826865]|not provided [RCV001204119] Chr8:86671046 [GRCh38]
Chr8:87683274 [GRCh37]
Chr8:8q21.3
pathogenic|likely pathogenic|conflicting interpretations of pathogenicity
NM_019098.5(CNGB3):c.991-3T>G single nucleotide variant Achromatopsia 3 [RCV000169173]|Leber congenital amaurosis [RCV000678548]|Retinal dystrophy [RCV001074271]|not provided [RCV001036288] Chr8:86644689 [GRCh38]
Chr8:87656917 [GRCh37]
Chr8:8q21.3
pathogenic|likely pathogenic
NM_019098.5(CNGB3):c.112C>T (p.Gln38Ter) single nucleotide variant Achromatopsia 3 [RCV000169174]|Achromatopsia [RCV000596854]|not provided [RCV001380986] Chr8:86743516 [GRCh38]
Chr8:87755744 [GRCh37]
Chr8:8q21.3
pathogenic|likely pathogenic|conflicting interpretations of pathogenicity
NM_019098.5(CNGB3):c.646C>T (p.Arg216Ter) single nucleotide variant Achromatopsia 3 [RCV000169194]|Achromatopsia [RCV001831988]|not provided [RCV001380985] Chr8:86667131 [GRCh38]
Chr8:87679359 [GRCh37]
Chr8:8q21.3
pathogenic|likely pathogenic|conflicting interpretations of pathogenicity
NM_019098.5(CNGB3):c.1006G>T (p.Glu336Ter) single nucleotide variant Achromatopsia 3 [RCV000169343]|Achromatopsia [RCV000761286]|Retinal dystrophy [RCV001074313]|not provided [RCV000809121] Chr8:86644671 [GRCh38]
Chr8:87656899 [GRCh37]
Chr8:8q21.3
pathogenic|likely pathogenic|conflicting interpretations of pathogenicity
NM_019098.5(CNGB3):c.1578+1G>A single nucleotide variant Achromatopsia 3 [RCV000169421]|Achromatopsia [RCV000592120]|not provided [RCV000724126] Chr8:86625982 [GRCh38]
Chr8:87638210 [GRCh37]
Chr8:8q21.3
pathogenic|likely pathogenic|conflicting interpretations of pathogenicity
NM_019098.5(CNGB3):c.1119G>A (p.Trp373Ter) single nucleotide variant Achromatopsia 3 [RCV000169624]|Retinal dystrophy [RCV001074476]|not provided [RCV000255345] Chr8:86643810 [GRCh38]
Chr8:87656038 [GRCh37]
Chr8:8q21.3
pathogenic|likely pathogenic|conflicting interpretations of pathogenicity
NM_019098.5(CNGB3):c.539C>T (p.Pro180Leu) single nucleotide variant not provided [RCV000178974] Chr8:86668123 [GRCh38]
Chr8:87680351 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.670C>T (p.Leu224Phe) single nucleotide variant Achromatopsia 3 [RCV000265676]|Severe early-childhood-onset retinal dystrophy [RCV000302120]|not provided [RCV000312509] Chr8:86667107 [GRCh38]
Chr8:87679335 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.1672G>T (p.Gly558Cys) single nucleotide variant Achromatopsia 3 [RCV000670529]|Achromatopsia [RCV001272481]|Retinitis pigmentosa [RCV000678547]|not provided [RCV001058379] Chr8:86604202 [GRCh38]
Chr8:87616430 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.1179-38T>C single nucleotide variant Achromatopsia 3 [RCV001543742]|not provided [RCV001725152]|not specified [RCV000249378] Chr8:86632931 [GRCh38]
Chr8:87645159 [GRCh37]
Chr8:8q21.3
benign
NM_019098.5(CNGB3):c.1356G>A (p.Gln452=) single nucleotide variant Achromatopsia 3 [RCV000276714]|Achromatopsia [RCV001833278]|Severe early-childhood-onset retinal dystrophy [RCV000370896]|not provided [RCV001510372]|not specified [RCV000254349] Chr8:86629043 [GRCh38]
Chr8:87641271 [GRCh37]
Chr8:8q21.3
benign|likely benign
NM_019098.5(CNGB3):c.2115T>C (p.Asn705=) single nucleotide variant not provided [RCV001494624] Chr8:86576119 [GRCh38]
Chr8:87588347 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.1397T>C (p.Met466Thr) single nucleotide variant Achromatopsia 3 [RCV000498988]|Achromatopsia [RCV001272738]|Severe early-childhood-onset retinal dystrophy [RCV001162414]|not provided [RCV000961874]|not specified [RCV000244737] Chr8:86629002 [GRCh38]
Chr8:87641230 [GRCh37]
Chr8:8q21.3
benign|uncertain significance
NM_019098.5(CNGB3):c.354G>T (p.Pro118=) single nucleotide variant Achromatopsia 3 [RCV001161027]|Achromatopsia [RCV001272491]|Severe early-childhood-onset retinal dystrophy [RCV001161026]|not provided [RCV000961891]|not specified [RCV000242350] Chr8:86671083 [GRCh38]
Chr8:87683311 [GRCh37]
Chr8:8q21.3
benign|likely benign
NM_019098.5(CNGB3):c.608G>A (p.Arg203Gln) single nucleotide variant Achromatopsia 3 [RCV000372970]|Achromatopsia [RCV001833280]|Severe early-childhood-onset retinal dystrophy [RCV000316050]|not provided [RCV001522474]|not specified [RCV000247338] Chr8:86668054 [GRCh38]
Chr8:87680282 [GRCh37]
Chr8:8q21.3
benign|likely benign
NM_019098.5(CNGB3):c.211+13T>G single nucleotide variant Achromatopsia 3 [RCV000357426]|Severe early-childhood-onset retinal dystrophy [RCV000274434]|not provided [RCV001513345]|not specified [RCV000245103] Chr8:86739642 [GRCh38]
Chr8:87751870 [GRCh37]
Chr8:8q21.3
benign|likely benign
NM_019098.5(CNGB3):c.853-45T>C single nucleotide variant not specified [RCV000247639] Chr8:86654107 [GRCh38]
Chr8:87666335 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.919A>G (p.Ile307Val) single nucleotide variant Achromatopsia 3 [RCV000286399]|Achromatopsia [RCV001272487]|Severe early-childhood-onset retinal dystrophy [RCV000376272]|not provided [RCV001510548]|not specified [RCV000242961] Chr8:86647872 [GRCh38]
Chr8:87660100 [GRCh37]
Chr8:8q21.3
benign|likely benign
NM_019098.5(CNGB3):c.1781+10A>T single nucleotide variant Achromatopsia 3 [RCV000284921]|Achromatopsia [RCV001833279]|Severe early-childhood-onset retinal dystrophy [RCV000339899]|not provided [RCV001516848]|not specified [RCV000248063] Chr8:86604083 [GRCh38]
Chr8:87616311 [GRCh37]
Chr8:8q21.3
benign|likely benign
NM_019098.5(CNGB3):c.339-10dup duplication Achromatopsia [RCV000287714]|Stargardt Disease, Recessive [RCV000344776]|not provided [RCV000961892]|not specified [RCV000250380] Chr8:86671107..86671108 [GRCh38]
Chr8:87683335..87683336 [GRCh37]
Chr8:8q21.3
benign|likely benign|uncertain significance
NM_019098.5(CNGB3):c.1439G>A (p.Arg480Gln) single nucleotide variant Achromatopsia [RCV001276132]|not provided [RCV000766832]|not specified [RCV000522020] Chr8:86628960 [GRCh38]
Chr8:87641188 [GRCh37]
Chr8:8q21.3
likely benign|conflicting interpretations of pathogenicity|uncertain significance
NM_019098.5(CNGB3):c.2103+23C>G single nucleotide variant not provided [RCV001689890]|not specified [RCV000253030] Chr8:86578666 [GRCh38]
Chr8:87590894 [GRCh37]
Chr8:8q21.3
benign
NM_019098.5(CNGB3):c.702T>G (p.Cys234Trp) single nucleotide variant Achromatopsia 3 [RCV000988079]|Achromatopsia [RCV001833281]|Severe early-childhood-onset retinal dystrophy [RCV000364988]|not provided [RCV001522473]|not specified [RCV000250693] Chr8:86667075 [GRCh38]
Chr8:87679303 [GRCh37]
Chr8:8q21.3
benign
NM_019098.5(CNGB3):c.624C>T (p.Asn208=) single nucleotide variant Achromatopsia 3 [RCV000267952]|Severe early-childhood-onset retinal dystrophy [RCV000361581]|not provided [RCV000927857] Chr8:86668038 [GRCh38]
Chr8:87680266 [GRCh37]
Chr8:8q21.3
likely benign|uncertain significance
NM_019098.5(CNGB3):c.1531G>A (p.Ala511Thr) single nucleotide variant Achromatopsia 3 [RCV000301489]|Achromatopsia [RCV001276129]|Severe early-childhood-onset retinal dystrophy [RCV000356262]|not provided [RCV000931567] Chr8:86626030 [GRCh38]
Chr8:87638258 [GRCh37]
Chr8:8q21.3
likely benign|uncertain significance
NM_019098.5(CNGB3):c.*1459C>T single nucleotide variant Achromatopsia 3 [RCV000268759]|Severe early-childhood-onset retinal dystrophy [RCV000363365] Chr8:86574345 [GRCh38]
Chr8:87586573 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.*621G>A single nucleotide variant Achromatopsia 3 [RCV000372583]|Severe early-childhood-onset retinal dystrophy [RCV000322621] Chr8:86575183 [GRCh38]
Chr8:87587411 [GRCh37]
Chr8:8q21.3
likely benign|uncertain significance
NM_019098.5(CNGB3):c.913G>A (p.Ala305Thr) single nucleotide variant Achromatopsia 3 [RCV000322833]|Achromatopsia [RCV001272747]|Severe early-childhood-onset retinal dystrophy [RCV000372778]|not provided [RCV000762528] Chr8:86647878 [GRCh38]
Chr8:87660106 [GRCh37]
Chr8:8q21.3
conflicting interpretations of pathogenicity|uncertain significance
NM_019098.5(CNGB3):c.738C>T (p.Thr246=) single nucleotide variant Achromatopsia 3 [RCV000345096]|Severe early-childhood-onset retinal dystrophy [RCV000390143]|not provided [RCV001489377] Chr8:86667039 [GRCh38]
Chr8:87679267 [GRCh37]
Chr8:8q21.3
likely benign|uncertain significance
NM_019098.5(CNGB3):c.1714C>G (p.Leu572Val) single nucleotide variant Achromatopsia 3 [RCV000394996]|Severe early-childhood-onset retinal dystrophy [RCV000286042] Chr8:86604160 [GRCh38]
Chr8:87616388 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.*735A>G single nucleotide variant Achromatopsia 3 [RCV000271226]|Severe early-childhood-onset retinal dystrophy [RCV000302975] Chr8:86575069 [GRCh38]
Chr8:87587297 [GRCh37]
Chr8:8q21.3
benign|likely benign
NM_019098.5(CNGB3):c.*293T>C single nucleotide variant Achromatopsia 3 [RCV000389094]|Severe early-childhood-onset retinal dystrophy [RCV000348561] Chr8:86575511 [GRCh38]
Chr8:87587739 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.*51C>T single nucleotide variant Achromatopsia 3 [RCV000305713]|Severe early-childhood-onset retinal dystrophy [RCV000360498] Chr8:86575753 [GRCh38]
Chr8:87587981 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.212-3T>C single nucleotide variant Achromatopsia 3 [RCV000306056]|Achromatopsia [RCV001272755]|Severe early-childhood-onset retinal dystrophy [RCV000353793]|not provided [RCV000897140] Chr8:86726660 [GRCh38]
Chr8:87738888 [GRCh37]
Chr8:8q21.3
benign|likely benign|uncertain significance
NM_019098.5(CNGB3):c.*778T>C single nucleotide variant Achromatopsia 3 [RCV000307150]|Severe early-childhood-onset retinal dystrophy [RCV000366427] Chr8:86575026 [GRCh38]
Chr8:87587254 [GRCh37]
Chr8:8q21.3
benign|likely benign
NM_019098.5(CNGB3):c.1815T>G (p.Thr605=) single nucleotide variant Achromatopsia 3 [RCV000328479]|Achromatopsia [RCV001828363]|Severe early-childhood-onset retinal dystrophy [RCV000383096]|not provided [RCV000980205] Chr8:86579219 [GRCh38]
Chr8:87591447 [GRCh37]
Chr8:8q21.3
pathogenic|benign|likely benign|uncertain significance
NM_019098.5(CNGB3):c.*1371G>T single nucleotide variant Achromatopsia 3 [RCV000378267]|Severe early-childhood-onset retinal dystrophy [RCV000328305] Chr8:86574433 [GRCh38]
Chr8:87586661 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.494-11T>C single nucleotide variant Achromatopsia 3 [RCV000389093]|Severe early-childhood-onset retinal dystrophy [RCV000350722]|not provided [RCV001499322] Chr8:86668179 [GRCh38]
Chr8:87680407 [GRCh37]
Chr8:8q21.3
benign|likely benign
NM_019098.4(CNGB3):c.-32T>C single nucleotide variant Achromatopsia 3 [RCV000290745]|Severe early-childhood-onset retinal dystrophy [RCV000382884] Chr8:86743659 [GRCh38]
Chr8:87755887 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.4(CNGB3):c.-36T>G single nucleotide variant Achromatopsia 3 [RCV000376943]|Severe early-childhood-onset retinal dystrophy [RCV000329394]|not provided [RCV001653741] Chr8:86743663 [GRCh38]
Chr8:87755891 [GRCh37]
Chr8:8q21.3
benign|likely benign
NM_019098.5(CNGB3):c.331C>G (p.Pro111Ala) single nucleotide variant Achromatopsia 3 [RCV000397541]|Severe early-childhood-onset retinal dystrophy [RCV000309960]|not provided [RCV001090383] Chr8:86726538 [GRCh38]
Chr8:87738766 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.*125G>C single nucleotide variant Achromatopsia 3 [RCV000310278]|Severe early-childhood-onset retinal dystrophy [RCV000398127] Chr8:86575679 [GRCh38]
Chr8:87587907 [GRCh37]
Chr8:8q21.3
likely benign|uncertain significance
NM_019098.5(CNGB3):c.*389A>C single nucleotide variant Achromatopsia 3 [RCV000259273]|Severe early-childhood-onset retinal dystrophy [RCV000319178] Chr8:86575415 [GRCh38]
Chr8:87587643 [GRCh37]
Chr8:8q21.3
benign|likely benign
NM_019098.5(CNGB3):c.2248C>T (p.Pro750Ser) single nucleotide variant Achromatopsia 3 [RCV000277134]|Severe early-childhood-onset retinal dystrophy [RCV000332145]|not provided [RCV001239882] Chr8:86575986 [GRCh38]
Chr8:87588214 [GRCh37]
Chr8:8q21.3
likely benign|uncertain significance
NM_019098.5(CNGB3):c.*1470G>C single nucleotide variant Achromatopsia 3 [RCV000313249]|Severe early-childhood-onset retinal dystrophy [RCV000276887] Chr8:86574334 [GRCh38]
Chr8:87586562 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.*379T>G single nucleotide variant Achromatopsia 3 [RCV000374155]|Severe early-childhood-onset retinal dystrophy [RCV000293703] Chr8:86575425 [GRCh38]
Chr8:87587653 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.1498A>G (p.Lys500Glu) single nucleotide variant Achromatopsia 3 [RCV000398277]|Severe early-childhood-onset retinal dystrophy [RCV000311516] Chr8:86626063 [GRCh38]
Chr8:87638291 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.4(CNGB3):c.*1638G>A single nucleotide variant Achromatopsia 3 [RCV000312215]|Severe early-childhood-onset retinal dystrophy [RCV000366928] Chr8:86574166 [GRCh38]
Chr8:87586394 [GRCh37]
Chr8:8q21.3
benign|likely benign
NM_019098.4(CNGB3):c.*1639C>A single nucleotide variant Achromatopsia 3 [RCV000402102]|Severe early-childhood-onset retinal dystrophy [RCV000356615] Chr8:86574165 [GRCh38]
Chr8:87586393 [GRCh37]
Chr8:8q21.3
benign
NM_019098.5(CNGB3):c.212-6del deletion Achromatopsia [RCV000261330]|Stargardt Disease, Recessive [RCV000300242]|not provided [RCV000911760] Chr8:86726663 [GRCh38]
Chr8:87738891 [GRCh37]
Chr8:8q21.3
benign|uncertain significance
NM_019098.5(CNGB3):c.2308G>T (p.Val770Phe) single nucleotide variant Achromatopsia 3 [RCV000356702]|Severe early-childhood-onset retinal dystrophy [RCV000261883]|not provided [RCV001034257] Chr8:86575926 [GRCh38]
Chr8:87588154 [GRCh37]
Chr8:8q21.3
likely benign|conflicting interpretations of pathogenicity|uncertain significance
NM_019098.5(CNGB3):c.43G>C (p.Gly15Arg) single nucleotide variant Achromatopsia 3 [RCV000277976]|Achromatopsia [RCV001272756]|Severe early-childhood-onset retinal dystrophy [RCV000325972]|not provided [RCV000900243] Chr8:86743585 [GRCh38]
Chr8:87755813 [GRCh37]
Chr8:8q21.3
likely benign|uncertain significance
NM_019098.5(CNGB3):c.739G>A (p.Ala247Thr) single nucleotide variant Achromatopsia 3 [RCV000313538]|Achromatopsia [RCV001828365]|Severe early-childhood-onset retinal dystrophy [RCV000394090]|not provided [RCV001220465] Chr8:86667038 [GRCh38]
Chr8:87679266 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.*1183T>C single nucleotide variant Achromatopsia 3 [RCV000335315]|Severe early-childhood-onset retinal dystrophy [RCV000375939] Chr8:86574621 [GRCh38]
Chr8:87586849 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.595G>A (p.Glu199Lys) single nucleotide variant Achromatopsia 3 [RCV000261965]|Achromatopsia [RCV001272490]|Severe early-childhood-onset retinal dystrophy [RCV000319376]|not provided [RCV000947120] Chr8:86668067 [GRCh38]
Chr8:87680295 [GRCh37]
Chr8:8q21.3
benign|likely benign
NM_019098.5(CNGB3):c.1534A>G (p.Ile512Val) single nucleotide variant Achromatopsia 3 [RCV000336568]|Achromatopsia [RCV001833481]|Severe early-childhood-onset retinal dystrophy [RCV000394987]|not provided [RCV000487572]|not specified [RCV001700999] Chr8:86626027 [GRCh38]
Chr8:87638255 [GRCh37]
Chr8:8q21.3
benign|likely benign|conflicting interpretations of pathogenicity|uncertain significance
NM_019098.5(CNGB3):c.2420C>G (p.Ala807Gly) single nucleotide variant Achromatopsia 3 [RCV000399992]|Achromatopsia [RCV001833480]|Severe early-childhood-onset retinal dystrophy [RCV000297206]|not provided [RCV000762525]|not specified [RCV000608300] Chr8:86575814 [GRCh38]
Chr8:87588042 [GRCh37]
Chr8:8q21.3
benign|likely benign|conflicting interpretations of pathogenicity|uncertain significance
NM_019098.5(CNGB3):c.*909_*910del deletion Achromatopsia [RCV000393411]|Stargardt Disease, Recessive [RCV000315143] Chr8:86574894..86574895 [GRCh38]
Chr8:87587122..87587123 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.241G>A (p.Asp81Asn) single nucleotide variant Achromatopsia [RCV000339116]|Stargardt Disease, Recessive [RCV000397544]|not provided [RCV002523702] Chr8:86726628 [GRCh38]
Chr8:87738856 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.*1303G>A single nucleotide variant Achromatopsia 3 [RCV000280351]|Severe early-childhood-onset retinal dystrophy [RCV000379480] Chr8:86574501 [GRCh38]
Chr8:87586729 [GRCh37]
Chr8:8q21.3
benign|likely benign
NM_019098.5(CNGB3):c.*84C>T single nucleotide variant Achromatopsia 3 [RCV000399337]|Severe early-childhood-onset retinal dystrophy [RCV000340724] Chr8:86575720 [GRCh38]
Chr8:87587948 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.*1093C>T single nucleotide variant Achromatopsia 3 [RCV000350006]|Severe early-childhood-onset retinal dystrophy [RCV000281044] Chr8:86574711 [GRCh38]
Chr8:87586939 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.1510A>G (p.Thr504Ala) single nucleotide variant Achromatopsia 3 [RCV001160803]|Achromatopsia [RCV001276130]|Severe early-childhood-onset retinal dystrophy [RCV001160802]|not provided [RCV000308981] Chr8:86626051 [GRCh38]
Chr8:87638279 [GRCh37]
Chr8:8q21.3
benign|conflicting interpretations of pathogenicity|uncertain significance
NM_019098.5(CNGB3):c.494-11dup duplication Achromatopsia [RCV000293509]|Stargardt Disease, Recessive [RCV000385627]|not provided [RCV000838381] Chr8:86668178..86668179 [GRCh38]
Chr8:87680406..87680407 [GRCh37]
Chr8:8q21.3
benign|likely benign
NM_019098.5(CNGB3):c.2007A>G (p.Lys669=) single nucleotide variant not provided [RCV000280845] Chr8:86578785 [GRCh38]
Chr8:87591013 [GRCh37]
Chr8:8q21.3
conflicting interpretations of pathogenicity|uncertain significance
NM_019098.5(CNGB3):c.*1368T>C single nucleotide variant Achromatopsia 3 [RCV000324660]|Severe early-childhood-onset retinal dystrophy [RCV000264854] Chr8:86574436 [GRCh38]
Chr8:87586664 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.1833C>T (p.His611=) single nucleotide variant Achromatopsia 3 [RCV001164345]|Achromatopsia [RCV001272479]|Severe early-childhood-onset retinal dystrophy [RCV001164346]|not provided [RCV000259449] Chr8:86579201 [GRCh38]
Chr8:87591429 [GRCh37]
Chr8:8q21.3
likely benign|conflicting interpretations of pathogenicity|uncertain significance
NM_019098.5(CNGB3):c.886_896delinsT (p.Thr296fs) indel Achromatopsia 3 [RCV000497907]|CNGB3-Related Disorders [RCV000278041]|not provided [RCV000821438] Chr8:86654019..86654029 [GRCh38]
Chr8:87666247..87666257 [GRCh37]
Chr8:8q21.3
pathogenic|likely pathogenic
NM_019098.5(CNGB3):c.474C>T (p.Pro158=) single nucleotide variant Achromatopsia [RCV001272750]|not provided [RCV000260872] Chr8:86670963 [GRCh38]
Chr8:87683191 [GRCh37]
Chr8:8q21.3
likely benign|conflicting interpretations of pathogenicity|uncertain significance
NM_019098.5(CNGB3):c.1433G>A (p.Arg478Gln) single nucleotide variant not provided [RCV000295645] Chr8:86628966 [GRCh38]
Chr8:87641194 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.912C>T (p.Val304=) single nucleotide variant Achromatopsia 3 [RCV001159528]|Achromatopsia [RCV001828257]|Severe early-childhood-onset retinal dystrophy [RCV001159529]|not provided [RCV000892241]|not specified [RCV000401931] Chr8:86647879 [GRCh38]
Chr8:87660107 [GRCh37]
Chr8:8q21.3
benign|likely benign|uncertain significance
NM_019098.5(CNGB3):c.*731C>T single nucleotide variant Achromatopsia 3 [RCV000357675]|Severe early-childhood-onset retinal dystrophy [RCV000267694] Chr8:86575073 [GRCh38]
Chr8:87587301 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.445_446insT (p.Lys149fs) insertion Achromatopsia 3 [RCV001270470] Chr8:86670991..86670992 [GRCh38]
Chr8:87683219..87683220 [GRCh37]
Chr8:8q21.3
pathogenic
GRCh37/hg19 8q21.2-24.3(chr8:84712253-146295771)x3 copy number gain See cases [RCV002285066] Chr8:84712253..146295771 [GRCh37]
Chr8:8q21.2-24.3
pathogenic
NM_019098.5(CNGB3):c.339-4415_673del deletion Inborn genetic diseases [RCV000623931] Chr8:86667104..86675513 [GRCh38]
Chr8:87679332..87687741 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.773T>C (p.Ile258Thr) single nucleotide variant Achromatopsia 3 [RCV000348660]|Severe early-childhood-onset retinal dystrophy [RCV000293482] Chr8:86667004 [GRCh38]
Chr8:87679232 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.*206G>A single nucleotide variant Achromatopsia 3 [RCV000295002]|Severe early-childhood-onset retinal dystrophy [RCV000345303] Chr8:86575598 [GRCh38]
Chr8:87587826 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.*798A>C single nucleotide variant Achromatopsia 3 [RCV000399193]|Severe early-childhood-onset retinal dystrophy [RCV000351306] Chr8:86575006 [GRCh38]
Chr8:87587234 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.4(CNGB3):c.*1701C>T single nucleotide variant Achromatopsia 3 [RCV000297130]|Severe early-childhood-onset retinal dystrophy [RCV000398362] Chr8:86574103 [GRCh38]
Chr8:87586331 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.4(CNGB3):c.*1881T>C single nucleotide variant Achromatopsia [RCV000272292]|Stargardt Disease, Recessive [RCV000327342] Chr8:86573923 [GRCh38]
Chr8:87586151 [GRCh37]
Chr8:8q21.3
benign
NM_019098.5(CNGB3):c.1160A>G (p.Tyr387Cys) single nucleotide variant Achromatopsia 3 [RCV000327065]|Achromatopsia [RCV001828364]|Severe early-childhood-onset retinal dystrophy [RCV000363049]|not provided [RCV001346392] Chr8:86643769 [GRCh38]
Chr8:87655997 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.843A>G (p.Gly281=) single nucleotide variant not provided [RCV000591974] Chr8:86666934 [GRCh38]
Chr8:87679162 [GRCh37]
Chr8:8q21.3
conflicting interpretations of pathogenicity|uncertain significance
NM_019098.5(CNGB3):c.1783C>T (p.Leu595Phe) single nucleotide variant Achromatopsia 3 [RCV000670705]|Achromatopsia [RCV000598180] Chr8:86579251 [GRCh38]
Chr8:87591479 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.767C>A (p.Ala256Glu) single nucleotide variant not provided [RCV000596023] Chr8:86667010 [GRCh38]
Chr8:87679238 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.221C>T (p.Ser74Phe) single nucleotide variant Achromatopsia [RCV001272754]|not provided [RCV000585434] Chr8:86726648 [GRCh38]
Chr8:87738876 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.163dup (p.Thr55fs) duplication Achromatopsia 3 [RCV000409138] Chr8:86739702..86739703 [GRCh38]
Chr8:87751930..87751931 [GRCh37]
Chr8:8q21.3
likely pathogenic
NM_019098.5(CNGB3):c.556_559del (p.Arg186fs) deletion Achromatopsia 3 [RCV000409215] Chr8:86668103..86668106 [GRCh38]
Chr8:87680331..87680334 [GRCh37]
Chr8:8q21.3
likely pathogenic
NM_019098.5(CNGB3):c.412del (p.Arg138fs) deletion Achromatopsia 3 [RCV000409440]|not provided [RCV001861379] Chr8:86671025 [GRCh38]
Chr8:87683253 [GRCh37]
Chr8:8q21.3
pathogenic|likely pathogenic
NM_019098.5(CNGB3):c.852+55C>T single nucleotide variant Achromatopsia 3 [RCV001543743]|not provided [RCV001713000] Chr8:86666870 [GRCh38]
Chr8:87679098 [GRCh37]
Chr8:8q21.3
benign
NM_019098.5(CNGB3):c.1937del (p.Leu645_Leu646insTer) deletion Achromatopsia 3 [RCV000409769]|not provided [RCV002524616] Chr8:86578855 [GRCh38]
Chr8:87591083 [GRCh37]
Chr8:8q21.3
pathogenic|likely pathogenic
NM_019098.5(CNGB3):c.1579-1G>A single nucleotide variant Achromatopsia 3 [RCV000409806]|Achromatopsia [RCV001199471]|not provided [RCV001092878] Chr8:86611672 [GRCh38]
Chr8:87623900 [GRCh37]
Chr8:8q21.3
pathogenic|likely pathogenic|conflicting interpretations of pathogenicity
NM_019098.5(CNGB3):c.1908del (p.Ile637fs) deletion Achromatopsia 3 [RCV000410311]|not provided [RCV001861370] Chr8:86579126 [GRCh38]
Chr8:87591354 [GRCh37]
Chr8:8q21.3
pathogenic|likely pathogenic
NM_019098.5(CNGB3):c.1889A>C (p.His630Pro) single nucleotide variant not provided [RCV000415895] Chr8:86579145 [GRCh38]
Chr8:87591373 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.1366del (p.Arg456fs) deletion Achromatopsia 3 [RCV000410652]|not provided [RCV001865267] Chr8:86629033 [GRCh38]
Chr8:87641261 [GRCh37]
Chr8:8q21.3
pathogenic|likely pathogenic|conflicting interpretations of pathogenicity
NM_019098.5(CNGB3):c.1929-2A>G single nucleotide variant Achromatopsia 3 [RCV000410908] Chr8:86578865 [GRCh38]
Chr8:87591093 [GRCh37]
Chr8:8q21.3
likely pathogenic
NM_019098.5(CNGB3):c.1928+2T>C single nucleotide variant Achromatopsia 3 [RCV000411120] Chr8:86579104 [GRCh38]
Chr8:87591332 [GRCh37]
Chr8:8q21.3
likely pathogenic
NM_019098.5(CNGB3):c.567del (p.Trp189fs) deletion Achromatopsia 3 [RCV000411187] Chr8:86668095 [GRCh38]
Chr8:87680323 [GRCh37]
Chr8:8q21.3
likely pathogenic
NM_019098.4(CNGB3):c.(990+1_991-1)_(1178+1_1179-1)del deletion Retinal dystrophy [RCV000416312] Chr8:8q21.3 likely pathogenic
NM_019098.5(CNGB3):c.1198T>C (p.Trp400Arg) single nucleotide variant Inborn genetic diseases [RCV002532419]|not provided [RCV000594568] Chr8:86632874 [GRCh38]
Chr8:87645102 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.11C>A (p.Ser4Ter) single nucleotide variant Achromatopsia 3 [RCV000411455]|not provided [RCV001865256] Chr8:86743617 [GRCh38]
Chr8:87755845 [GRCh37]
Chr8:8q21.3
pathogenic|likely pathogenic
NM_019098.5(CNGB3):c.220_221del (p.Ser74fs) microsatellite Achromatopsia 3 [RCV000411501] Chr8:86726648..86726649 [GRCh38]
Chr8:87738876..87738877 [GRCh37]
Chr8:8q21.3
likely pathogenic
NM_019098.5(CNGB3):c.1260del (p.Ile420fs) deletion Achromatopsia 3 [RCV000411676] Chr8:86632812 [GRCh38]
Chr8:87645040 [GRCh37]
Chr8:8q21.3
likely pathogenic
NM_019098.5(CNGB3):c.446_447insT (p.Lys149fs) insertion Achromatopsia 3 [RCV000411864]|not provided [RCV001038514] Chr8:86670990..86670991 [GRCh38]
Chr8:87683218..87683219 [GRCh37]
Chr8:8q21.3
pathogenic|likely pathogenic
NM_019098.5(CNGB3):c.1480+1G>A single nucleotide variant Achromatopsia 3 [RCV000412081]|not provided [RCV001723969] Chr8:86628918 [GRCh38]
Chr8:87641146 [GRCh37]
Chr8:8q21.3
pathogenic|likely pathogenic|conflicting interpretations of pathogenicity
NM_019098.5(CNGB3):c.1098_1101dup (p.Ala368Ter) duplication not provided [RCV000412821] Chr8:86643827..86643828 [GRCh38]
Chr8:87656055..87656056 [GRCh37]
Chr8:8q21.3
pathogenic|likely pathogenic
NM_019098.5(CNGB3):c.1179-2A>T single nucleotide variant Achromatopsia 3 [RCV000412299]|not provided [RCV001543496] Chr8:86632895 [GRCh38]
Chr8:87645123 [GRCh37]
Chr8:8q21.3
likely pathogenic
NM_019098.5(CNGB3):c.819_826del (p.Arg274fs) deletion Achromatopsia 3 [RCV000498183]|Achromatopsia [RCV000592388]|Leber congenital amaurosis [RCV000504685]|Nystagmus [RCV000415035]|Retinal dystrophy [RCV001074298]|not provided [RCV000727187] Chr8:86666951..86666958 [GRCh38]
Chr8:87679179..87679186 [GRCh37]
Chr8:8q21.3
pathogenic
GRCh37/hg19 8q21.3(chr8:87660100-88885305)x3 copy number gain See cases [RCV000446502] Chr8:87660100..88885305 [GRCh37]
Chr8:8q21.3
uncertain significance
GRCh37/hg19 8p23.3-q24.3(chr8:158991-146280828)x3 copy number gain See cases [RCV000447507] Chr8:158991..146280828 [GRCh37]
Chr8:8p23.3-q24.3
pathogenic
NM_019098.5(CNGB3):c.1810C>T (p.Arg604Ter) single nucleotide variant Abnormality of the eye [RCV000504783]|Achromatopsia 3 [RCV000988076]|Achromatopsia [RCV001834626]|not provided [RCV001222784] Chr8:86579224 [GRCh38]
Chr8:87591452 [GRCh37]
Chr8:8q21.3
pathogenic|likely pathogenic
NM_019098.5(CNGB3):c.1492T>A (p.Leu498Met) single nucleotide variant Achromatopsia 3 [RCV000764781]|Achromatopsia [RCV001276131]|not provided [RCV000480707] Chr8:86626069 [GRCh38]
Chr8:87638297 [GRCh37]
Chr8:8q21.3
benign|conflicting interpretations of pathogenicity|uncertain significance
NM_019098.5(CNGB3):c.1662+1G>A single nucleotide variant not provided [RCV000485915] Chr8:86611587 [GRCh38]
Chr8:87623815 [GRCh37]
Chr8:8q21.3
likely pathogenic
NM_019098.5(CNGB3):c.1781+1G>C single nucleotide variant Achromatopsia 3 [RCV000497312]|Retinal dystrophy [RCV001073367]|not provided [RCV001383605] Chr8:86604092 [GRCh38]
Chr8:87616320 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.4(CNGB3):c.1534delinsGT (p.Ile512fs) indel Achromatopsia 3 [RCV000497318] Chr8:86626027 [GRCh38]
Chr8:87638255 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.1673G>T (p.Gly558Val) single nucleotide variant Achromatopsia 3 [RCV000497341]|Achromatopsia [RCV000595133] Chr8:86604201 [GRCh38]
Chr8:87616429 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.1426C>T (p.Gln476Ter) single nucleotide variant Achromatopsia 3 [RCV000497367]|not provided [RCV002523427] Chr8:86628973 [GRCh38]
Chr8:87641201 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.2103G>C (p.Gln701His) single nucleotide variant Achromatopsia 3 [RCV000497376]|Achromatopsia [RCV001275882]|not provided [RCV001066881] Chr8:86578689 [GRCh38]
Chr8:87590917 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.95dup (p.His32fs) duplication Achromatopsia 3 [RCV000497377] Chr8:86743532..86743533 [GRCh38]
Chr8:87755760..87755761 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.1285dup (p.Ser429fs) duplication Achromatopsia 3 [RCV000497416]|Achromatopsia [RCV001834594]|not provided [RCV001386013] Chr8:86632786..86632787 [GRCh38]
Chr8:87645014..87645015 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.4(CNGB3):c.1430_1431delinsC (p.Lys477fs) indel Achromatopsia 3 [RCV000497434] Chr8:86628968..86628969 [GRCh38]
Chr8:87641196..87641197 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.4(CNGB3):c.(?_-1)_(129+1_130-1)del deletion Achromatopsia 3 [RCV000497453]   pathogenic
NM_019098.5(CNGB3):c.281_284del (p.Pro94fs) deletion Achromatopsia 3 [RCV000497501]|not provided [RCV001851324] Chr8:86726585..86726588 [GRCh38]
Chr8:87738813..87738816 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.1635T>A (p.Tyr545Ter) single nucleotide variant Achromatopsia 3 [RCV000497503] Chr8:86611615 [GRCh38]
Chr8:87623843 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.1663-5T>G single nucleotide variant Achromatopsia 3 [RCV000497512]|not provided [RCV001856921] Chr8:86604216 [GRCh38]
Chr8:87616444 [GRCh37]
Chr8:8q21.3
likely pathogenic
NM_019098.5(CNGB3):c.682dup (p.Ala228fs) duplication Achromatopsia 3 [RCV000497518]|not provided [RCV001851325] Chr8:86667094..86667095 [GRCh38]
Chr8:87679322..87679323 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.494-2A>T single nucleotide variant Achromatopsia 3 [RCV000497528] Chr8:86668170 [GRCh38]
Chr8:87680398 [GRCh37]
Chr8:8q21.3
pathogenic
NC_000008.11:g.86711345_86711346ins[MF045864.2:g.1_98770] insertion Achromatopsia 3 [RCV000497553] Chr8:86711345..86711346 [GRCh38]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.1056-3C>G single nucleotide variant Achromatopsia 3 [RCV000497560] Chr8:86643876 [GRCh38]
Chr8:87656104 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.4(CNGB3):c.904-2824_1782-8208delins[KY923049.1:g.1_466] indel Achromatopsia 3 [RCV000497589] Chr8:86587460..86650711 [GRCh38]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.756C>G (p.Tyr252Ter) single nucleotide variant Achromatopsia 3 [RCV000497616]|not provided [RCV002523426] Chr8:86667021 [GRCh38]
Chr8:87679249 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.852+1G>C single nucleotide variant Achromatopsia 3 [RCV000497635]|not provided [RCV001210019] Chr8:86666924 [GRCh38]
Chr8:87679152 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.2221del (p.Asp741fs) deletion Achromatopsia 3 [RCV000497669]|not provided [RCV002526058] Chr8:86576013 [GRCh38]
Chr8:87588241 [GRCh37]
Chr8:8q21.3
pathogenic|uncertain significance
NM_019098.5(CNGB3):c.791_794del (p.Tyr264fs) deletion Achromatopsia 3 [RCV000497672] Chr8:86666983..86666986 [GRCh38]
Chr8:87679211..87679214 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.3G>A (p.Met1Ile) single nucleotide variant Achromatopsia 3 [RCV000497678]|not provided [RCV001851326] Chr8:86743625 [GRCh38]
Chr8:87755853 [GRCh37]
Chr8:8q21.3
pathogenic|likely pathogenic
NM_019098.5(CNGB3):c.265C>T (p.Gln89Ter) single nucleotide variant Achromatopsia 3 [RCV000497694] Chr8:86726604 [GRCh38]
Chr8:87738832 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.1063C>T (p.Arg355Ter) single nucleotide variant Achromatopsia 3 [RCV000497762]|Achromatopsia [RCV001829406]|not provided [RCV001216532] Chr8:86643866 [GRCh38]
Chr8:87656094 [GRCh37]
Chr8:8q21.3
pathogenic|likely pathogenic
NM_019098.5(CNGB3):c.1190_1192del (p.Cys397del) deletion Achromatopsia 3 [RCV000497792]|Achromatopsia [RCV001199470] Chr8:86632880..86632882 [GRCh38]
Chr8:87645108..87645110 [GRCh37]
Chr8:8q21.3
pathogenic|uncertain significance
NM_019098.5(CNGB3):c.29dup (p.Val11fs) duplication Achromatopsia 3 [RCV000497809]|not provided [RCV001380987] Chr8:86743598..86743599 [GRCh38]
Chr8:87755826..87755827 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.806T>C (p.Leu269Pro) single nucleotide variant Achromatopsia 3 [RCV000497819]|not provided [RCV001379169] Chr8:86666971 [GRCh38]
Chr8:87679199 [GRCh37]
Chr8:8q21.3
likely pathogenic
NM_019098.5(CNGB3):c.1781+1del deletion Achromatopsia 3 [RCV000497830]|Achromatopsia [RCV001834595]|not provided [RCV001046928] Chr8:86604092 [GRCh38]
Chr8:87616320 [GRCh37]
Chr8:8q21.3
pathogenic|likely pathogenic
NM_019098.5(CNGB3):c.1243C>T (p.Gln415Ter) single nucleotide variant Achromatopsia 3 [RCV000497880] Chr8:86632829 [GRCh38]
Chr8:87645057 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.1299_1300del (p.Phe434fs) microsatellite Achromatopsia 3 [RCV000497919] Chr8:86632772..86632773 [GRCh38]
Chr8:87645000..87645001 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.1782-3723_2103+739del deletion Achromatopsia 3 [RCV000497920] Chr8:86577950..86582975 [GRCh38]
Chr8:87590178..87595203 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.1579-2A>G single nucleotide variant Achromatopsia 3 [RCV000497923]|Retinal dystrophy [RCV001074857] Chr8:86611673 [GRCh38]
Chr8:87623901 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.4(CNGB3):c.393_394delinsTCCTGGTGA (p.Gln131fs) indel Achromatopsia 3 [RCV000497959] Chr8:86671043..86671044 [GRCh38]
Chr8:87683271..87683272 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.1493del (p.Leu498fs) deletion Achromatopsia 3 [RCV000497969]|not provided [RCV001856916] Chr8:86626068 [GRCh38]
Chr8:87638296 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.212-2527_338+2854del deletion Achromatopsia 3 [RCV000497979] Chr8:86723677..86729184 [GRCh38]
Chr8:87735905..87741412 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.129+2T>C single nucleotide variant Achromatopsia 3 [RCV000498029] Chr8:86743497 [GRCh38]
Chr8:87755725 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.301C>T (p.Gln101Ter) single nucleotide variant Achromatopsia 3 [RCV000498036] Chr8:86726568 [GRCh38]
Chr8:87738796 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.643+2T>C single nucleotide variant Achromatopsia 3 [RCV000498049] Chr8:86668017 [GRCh38]
Chr8:87680245 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.1782-2A>C single nucleotide variant Achromatopsia 3 [RCV000498067]|not provided [RCV001856922] Chr8:86579254 [GRCh38]
Chr8:87591482 [GRCh37]
Chr8:8q21.3
pathogenic|likely pathogenic
NM_019098.5(CNGB3):c.1566_1569dup (p.Leu524fs) duplication Achromatopsia 3 [RCV000498088] Chr8:86625991..86625992 [GRCh38]
Chr8:87638219..87638220 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.1751T>C (p.Leu584Pro) single nucleotide variant Achromatopsia 3 [RCV000498094] Chr8:86604123 [GRCh38]
Chr8:87616351 [GRCh37]
Chr8:8q21.3
likely pathogenic
NM_019098.5(CNGB3):c.1432C>T (p.Arg478Ter) single nucleotide variant Achromatopsia 3 [RCV000498120]|Achromatopsia [RCV000787572]|Retinal dystrophy [RCV001073613]|not provided [RCV001386012] Chr8:86628967 [GRCh38]
Chr8:87641195 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.190del (p.Glu64fs) deletion Achromatopsia 3 [RCV000498146] Chr8:86739676 [GRCh38]
Chr8:87751904 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.882C>G (p.Tyr294Ter) single nucleotide variant Achromatopsia 3 [RCV000498173] Chr8:86654033 [GRCh38]
Chr8:87666261 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.904-2A>T single nucleotide variant Achromatopsia 3 [RCV000498192]|not provided [RCV001856920] Chr8:86647889 [GRCh38]
Chr8:87660117 [GRCh37]
Chr8:8q21.3
pathogenic|likely pathogenic
NM_019098.5(CNGB3):c.2359del (p.Ser787fs) deletion Achromatopsia 3 [RCV000498194] Chr8:86575875 [GRCh38]
Chr8:87588103 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.4(CNGB3):c.(338+1_339-1)_(*1_?)del deletion Achromatopsia 3 [RCV000498212]   pathogenic
NM_019098.5(CNGB3):c.467C>T (p.Ser156Phe) single nucleotide variant Achromatopsia 3 [RCV000498220]|Achromatopsia [RCV001002981]|Severe early-childhood-onset retinal dystrophy [RCV001159644]|not provided [RCV000815424] Chr8:86670970 [GRCh38]
Chr8:87683198 [GRCh37]
Chr8:8q21.3
pathogenic|likely pathogenic|conflicting interpretations of pathogenicity|uncertain significance
NM_019098.5(CNGB3):c.1005dup (p.Glu336Ter) duplication Achromatopsia 3 [RCV000498224] Chr8:86644671..86644672 [GRCh38]
Chr8:87656899..87656900 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.4(CNGB3):c.702_706delinsGTTTTT (p.Cys234fs) indel Achromatopsia 3 [RCV000498260] Chr8:86667071..86667075 [GRCh38]
Chr8:87679299..87679303 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.1056-2A>G single nucleotide variant Achromatopsia 3 [RCV000498297] Chr8:86643875 [GRCh38]
Chr8:87656103 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.4(CNGB3):c.(1578+1_1579-1)_(*1_?)del deletion Achromatopsia 3 [RCV000498326]   pathogenic|likely pathogenic
NM_019098.5(CNGB3):c.926C>T (p.Pro309Leu) single nucleotide variant Achromatopsia 3 [RCV000498361] Chr8:86647865 [GRCh38]
Chr8:87660093 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.1397T>A (p.Met466Lys) single nucleotide variant Achromatopsia 3 [RCV000498368] Chr8:86629002 [GRCh38]
Chr8:87641230 [GRCh37]
Chr8:8q21.3
likely pathogenic
NM_019098.5(CNGB3):c.1823T>A (p.Val608Glu) single nucleotide variant Achromatopsia 3 [RCV000498407] Chr8:86579211 [GRCh38]
Chr8:87591439 [GRCh37]
Chr8:8q21.3
likely pathogenic
NM_019098.5(CNGB3):c.1460G>A (p.Trp487Ter) single nucleotide variant Achromatopsia 3 [RCV000498438] Chr8:86628939 [GRCh38]
Chr8:87641167 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.1781+1G>A single nucleotide variant Achromatopsia 3 [RCV000498488] Chr8:86604092 [GRCh38]
Chr8:87616320 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.1447T>G (p.Tyr483Asp) single nucleotide variant Achromatopsia 3 [RCV000498512]|not provided [RCV001856918] Chr8:86628952 [GRCh38]
Chr8:87641180 [GRCh37]
Chr8:8q21.3
likely pathogenic
NM_019098.5(CNGB3):c.31dup (p.Val11fs) duplication Achromatopsia 3 [RCV000498531] Chr8:86743596..86743597 [GRCh38]
Chr8:87755824..87755825 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.1255G>T (p.Glu419Ter) single nucleotide variant Achromatopsia 3 [RCV000498538]|not provided [RCV000726742] Chr8:86632817 [GRCh38]
Chr8:87645045 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.1285del (p.Ser429fs) deletion Abnormality of the eye [RCV000504627]|Achromatopsia 3 [RCV000498570]|not provided [RCV002523425] Chr8:86632787 [GRCh38]
Chr8:87645015 [GRCh37]
Chr8:8q21.3
pathogenic|likely pathogenic
NM_019098.5(CNGB3):c.2103+1G>A single nucleotide variant Achromatopsia 3 [RCV000498602]|Macular dystrophy [RCV000505012]|not provided [RCV002526060] Chr8:86578688 [GRCh38]
Chr8:87590916 [GRCh37]
Chr8:8q21.3
pathogenic|likely pathogenic
NM_019098.4(CNGB3):c.706delinsTT (p.Ile236fs) indel Achromatopsia 3 [RCV000498622] Chr8:86667071 [GRCh38]
Chr8:87679299 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.1815del (p.Ala606fs) deletion Achromatopsia 3 [RCV000498634]|not provided [RCV001856917] Chr8:86579219 [GRCh38]
Chr8:87591447 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.2T>C (p.Met1Thr) single nucleotide variant Achromatopsia 3 [RCV000498642]|not provided [RCV002526059] Chr8:86743626 [GRCh38]
Chr8:87755854 [GRCh37]
Chr8:8q21.3
pathogenic|likely pathogenic
NM_019098.5(CNGB3):c.208C>T (p.Gln70Ter) single nucleotide variant Achromatopsia 3 [RCV000498655]|not provided [RCV001856919] Chr8:86739658 [GRCh38]
Chr8:87751886 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.257del (p.Pro86fs) deletion Achromatopsia 3 [RCV000498659]|not provided [RCV001865520] Chr8:86726612 [GRCh38]
Chr8:87738840 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.1516del (p.Val506fs) deletion Achromatopsia 3 [RCV000498684] Chr8:86626045 [GRCh38]
Chr8:87638273 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.589_590del (p.Leu197fs) deletion Achromatopsia 3 [RCV000498700] Chr8:86668072..86668073 [GRCh38]
Chr8:87680300..87680301 [GRCh37]
Chr8:8q21.3
pathogenic
NC_000008.11:g.86688947_86688948ins[MF045863.1:g.1_36978] insertion Achromatopsia 3 [RCV000498740] Chr8:86688947..86688948 [GRCh38]
Chr8:8q21.3
pathogenic
NM_019098.4(CNGB3):c.852+4013_903+1698dup duplication Achromatopsia 3 [RCV000498744] Chr8:86652314..86662912 [GRCh38]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.130-1G>T single nucleotide variant Achromatopsia 3 [RCV000498778]|not provided [RCV002527045] Chr8:86739737 [GRCh38]
Chr8:87751965 [GRCh37]
Chr8:8q21.3
pathogenic|likely pathogenic
NM_019098.4(CNGB3):c.873delinsCAAAC (p.Arg291fs) indel Achromatopsia 3 [RCV000498794] Chr8:86654042 [GRCh38]
Chr8:87666270 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.1320+4A>G single nucleotide variant Achromatopsia 3 [RCV000498797]|not provided [RCV001379168] Chr8:86632748 [GRCh38]
Chr8:87644976 [GRCh37]
Chr8:8q21.3
pathogenic|likely pathogenic|uncertain significance
NM_019098.5(CNGB3):c.702T>A (p.Cys234Ter) single nucleotide variant Achromatopsia 3 [RCV000498829] Chr8:86667075 [GRCh38]
Chr8:87679303 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.643G>C (p.Asp215His) single nucleotide variant Achromatopsia 3 [RCV000498841] Chr8:86668019 [GRCh38]
Chr8:87680247 [GRCh37]
Chr8:8q21.3
likely pathogenic
NM_019098.5(CNGB3):c.1663-2660_1781+5516del deletion Achromatopsia 3 [RCV000498844] Chr8:86598577..86606871 [GRCh38]
Chr8:87610805..87619099 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.1578+1G>T single nucleotide variant Achromatopsia 3 [RCV000498971]|Achromatopsia [RCV001829407]|not provided [RCV001216527] Chr8:86625982 [GRCh38]
Chr8:87638210 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.1194T>G (p.Tyr398Ter) single nucleotide variant Achromatopsia 3 [RCV000498976] Chr8:86632878 [GRCh38]
Chr8:87645106 [GRCh37]
Chr8:8q21.3
pathogenic
GRCh37/hg19 8p23.3-q24.3(chr8:158049-146295771) copy number gain See cases [RCV000510234] Chr8:158049..146295771 [GRCh37]
Chr8:8p23.3-q24.3
pathogenic
GRCh37/hg19 8p23.3-q24.3(chr8:158049-146295771)x3 copy number gain See cases [RCV000511095] Chr8:158049..146295771 [GRCh37]
Chr8:8p23.3-q24.3
pathogenic
GRCh37/hg19 8q21.2-24.3(chr8:86841154-146295771)x3 copy number gain See cases [RCV000511002] Chr8:86841154..146295771 [GRCh37]
Chr8:8q21.2-24.3
pathogenic
GRCh37/hg19 8q21.2-24.3(chr8:86841228-142689874)x3 copy number gain See cases [RCV000510854] Chr8:86841228..142689874 [GRCh37]
Chr8:8q21.2-24.3
pathogenic
NM_019098.5(CNGB3):c.11C>T (p.Ser4Leu) single nucleotide variant not provided [RCV000585008] Chr8:86743617 [GRCh38]
Chr8:87755845 [GRCh37]
Chr8:8q21.3
uncertain significance
GRCh37/hg19 8p23.1-q24.3(chr8:12490999-146295771)x3 copy number gain See cases [RCV000512169] Chr8:12490999..146295771 [GRCh37]
Chr8:8p23.1-q24.3
pathogenic
NM_019098.5(CNGB3):c.414A>T (p.Arg138Ser) single nucleotide variant not provided [RCV000513303] Chr8:86671023 [GRCh38]
Chr8:87683251 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.2410A>T (p.Lys804Ter) single nucleotide variant Achromatopsia [RCV001275878]|not provided [RCV000627268] Chr8:86575824 [GRCh38]
Chr8:87588052 [GRCh37]
Chr8:8q21.3
conflicting interpretations of pathogenicity|uncertain significance
NM_019098.5(CNGB3):c.1578+2C>G single nucleotide variant Achromatopsia 3 [RCV000673053] Chr8:86625981 [GRCh38]
Chr8:87638209 [GRCh37]
Chr8:8q21.3
likely pathogenic
NM_019098.5(CNGB3):c.2008G>T (p.Glu670Ter) single nucleotide variant Achromatopsia 3 [RCV000673243] Chr8:86578784 [GRCh38]
Chr8:87591012 [GRCh37]
Chr8:8q21.3
likely pathogenic
NM_019098.5(CNGB3):c.1774dup (p.Glu592fs) duplication Achromatopsia 3 [RCV000673293] Chr8:86604099..86604100 [GRCh38]
Chr8:87616327..87616328 [GRCh37]
Chr8:8q21.3
likely pathogenic
NM_019098.5(CNGB3):c.203A>G (p.Asn68Ser) single nucleotide variant not provided [RCV000659108] Chr8:86739663 [GRCh38]
Chr8:87751891 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.2301_2304dup (p.Ser769fs) duplication Achromatopsia 3 [RCV000671490]|not provided [RCV002531286] Chr8:86575929..86575930 [GRCh38]
Chr8:87588157..87588158 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.74G>A (p.Arg25His) single nucleotide variant Achromatopsia [RCV001828702]|not provided [RCV001213369] Chr8:86743554 [GRCh38]
Chr8:87755782 [GRCh37]
Chr8:8q21.3
likely benign|uncertain significance
NM_019098.5(CNGB3):c.1481-2A>C single nucleotide variant Achromatopsia 3 [RCV000668523] Chr8:86626082 [GRCh38]
Chr8:87638310 [GRCh37]
Chr8:8q21.3
likely pathogenic
NM_019098.5(CNGB3):c.445_447delinsT (p.Lys149fs) indel Achromatopsia 3 [RCV000672942] Chr8:86670990..86670992 [GRCh38]
Chr8:87683218..87683220 [GRCh37]
Chr8:8q21.3
likely pathogenic
NM_019098.5(CNGB3):c.2101C>T (p.Gln701Ter) single nucleotide variant Achromatopsia 3 [RCV000670727] Chr8:86578691 [GRCh38]
Chr8:87590919 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.2383G>A (p.Gly795Arg) single nucleotide variant Achromatopsia 3 [RCV000670701]|Achromatopsia [RCV001830448]|not provided [RCV001245682] Chr8:86575851 [GRCh38]
Chr8:87588079 [GRCh37]
Chr8:8q21.3
uncertain significance
GRCh37/hg19 8q21.2-23.3(chr8:86841154-116518125)x3 copy number gain not provided [RCV000683045] Chr8:86841154..116518125 [GRCh37]
Chr8:8q21.2-23.3
pathogenic
GRCh37/hg19 8p23.3-q24.3(chr8:164984-146293414)x3 copy number gain not provided [RCV000747254] Chr8:164984..146293414 [GRCh37]
Chr8:8p23.3-q24.3
pathogenic
GRCh37/hg19 8p23.3-q24.3(chr8:10213-146293414)x3 copy number gain not provided [RCV000747248] Chr8:10213..146293414 [GRCh37]
Chr8:8p23.3-q24.3
pathogenic
GRCh37/hg19 8q21.3(chr8:87664244-87672457)x1 copy number loss not provided [RCV000747697] Chr8:87664244..87672457 [GRCh37]
Chr8:8q21.3
benign
GRCh37/hg19 8q21.3(chr8:87671396-87672457)x1 copy number loss not provided [RCV000747698] Chr8:87671396..87672457 [GRCh37]
Chr8:8q21.3
benign
GRCh37/hg19 8q21.3(chr8:87671396-87673633)x1 copy number loss not provided [RCV000747699] Chr8:87671396..87673633 [GRCh37]
Chr8:8q21.3
benign
NM_019098.5(CNGB3):c.2217T>C (p.Asp739=) single nucleotide variant Achromatopsia [RCV001832156]|not provided [RCV000941286] Chr8:86576017 [GRCh38]
Chr8:87588245 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.1065A>G (p.Arg355=) single nucleotide variant not provided [RCV000978255] Chr8:86643864 [GRCh38]
Chr8:87656092 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.1578+8C>T single nucleotide variant not provided [RCV000977407] Chr8:86625975 [GRCh38]
Chr8:87638203 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.2313_2315del (p.Arg772del) deletion Achromatopsia 3 [RCV001559264]|Achromatopsia [RCV001825510]|not provided [RCV000762526] Chr8:86575919..86575921 [GRCh38]
Chr8:87588147..87588149 [GRCh37]
Chr8:8q21.3
conflicting interpretations of pathogenicity|uncertain significance
NM_019098.5(CNGB3):c.2158CAAAAAGAAAATGAAGATAAA[1] (p.720QKENEDK[1]) microsatellite Achromatopsia 3 [RCV001810484]|Achromatopsia [RCV001275881]|Severe early-childhood-onset retinal dystrophy [RCV001029857]|not provided [RCV000762527] Chr8:86576035..86576055 [GRCh38]
Chr8:87588263..87588283 [GRCh37]
Chr8:8q21.3
likely pathogenic|benign|likely benign|conflicting interpretations of pathogenicity|uncertain significance
NM_019098.5(CNGB3):c.168G>C (p.Lys56Asn) single nucleotide variant Achromatopsia 3 [RCV001162610]|Severe early-childhood-onset retinal dystrophy [RCV001162611]|not provided [RCV001057922] Chr8:86739698 [GRCh38]
Chr8:87751926 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.717C>T (p.Arg239=) single nucleotide variant not provided [RCV000981908] Chr8:86667060 [GRCh38]
Chr8:87679288 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.1383C>T (p.Asp461=) single nucleotide variant Achromatopsia [RCV001272483]|not provided [RCV000914521] Chr8:86629016 [GRCh38]
Chr8:87641244 [GRCh37]
Chr8:8q21.3
benign
NM_019098.5(CNGB3):c.900T>C (p.Phe300=) single nucleotide variant not provided [RCV000928091] Chr8:86654015 [GRCh38]
Chr8:87666243 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.1732A>T (p.Thr578Ser) single nucleotide variant Achromatopsia [RCV001276128]|not provided [RCV000947119] Chr8:86604142 [GRCh38]
Chr8:87616370 [GRCh37]
Chr8:8q21.3
likely benign|uncertain significance
NM_019098.5(CNGB3):c.1179-6T>C single nucleotide variant Achromatopsia [RCV001825820]|not provided [RCV000904663] Chr8:86632899 [GRCh38]
Chr8:87645127 [GRCh37]
Chr8:8q21.3
benign|likely benign
NM_019098.5(CNGB3):c.1020C>T (p.His340=) single nucleotide variant not provided [RCV000983239] Chr8:86644657 [GRCh38]
Chr8:87656885 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.1368C>T (p.Arg456=) single nucleotide variant Achromatopsia 3 [RCV001162415]|Achromatopsia [RCV001272740]|Severe early-childhood-onset retinal dystrophy [RCV001162416]|not provided [RCV000926379] Chr8:86629031 [GRCh38]
Chr8:87641259 [GRCh37]
Chr8:8q21.3
benign|likely benign|uncertain significance
NM_019098.5(CNGB3):c.811A>G (p.Ile271Val) single nucleotide variant not provided [RCV001044055] Chr8:86666966 [GRCh38]
Chr8:87679194 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.450G>T (p.Leu150Phe) single nucleotide variant Achromatopsia [RCV001272751]|not provided [RCV001033961] Chr8:86670987 [GRCh38]
Chr8:87683215 [GRCh37]
Chr8:8q21.3
likely benign|uncertain significance
NM_019098.5(CNGB3):c.1369G>A (p.Ala457Thr) single nucleotide variant Achromatopsia [RCV001272739]|not provided [RCV001034154] Chr8:86629030 [GRCh38]
Chr8:87641258 [GRCh37]
Chr8:8q21.3
likely benign|uncertain significance
NM_019098.5(CNGB3):c.1706_1707del (p.Val569fs) deletion not provided [RCV001040004] Chr8:86604167..86604168 [GRCh38]
Chr8:87616395..87616396 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.1744G>C (p.Val582Leu) single nucleotide variant not provided [RCV001044860] Chr8:86604130 [GRCh38]
Chr8:87616358 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.768G>A (p.Ala256=) single nucleotide variant Achromatopsia [RCV001832432]|not provided [RCV001045301] Chr8:86667009 [GRCh38]
Chr8:87679237 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.419G>A (p.Arg140His) single nucleotide variant Achromatopsia [RCV001272752]|not provided [RCV001068381] Chr8:86671018 [GRCh38]
Chr8:87683246 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.1373G>A (p.Cys458Tyr) single nucleotide variant not provided [RCV001069010] Chr8:86629026 [GRCh38]
Chr8:87641254 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.1367G>A (p.Arg456His) single nucleotide variant Achromatopsia [RCV001272484]|not provided [RCV001061978] Chr8:86629032 [GRCh38]
Chr8:87641260 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.129G>C (p.Gln43His) single nucleotide variant Achromatopsia [RCV001833683]|Retinal dystrophy [RCV001073578]|not provided [RCV001322107] Chr8:86743499 [GRCh38]
Chr8:87755727 [GRCh37]
Chr8:8q21.3
uncertain significance
NC_000008.11:g.(?_86654002)_(86654072_?)dup duplication not provided [RCV001032036] Chr8:87666230..87666300 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.2107A>G (p.Lys703Glu) single nucleotide variant Achromatopsia [RCV001827259]|not provided [RCV001043004] Chr8:86576127 [GRCh38]
Chr8:87588355 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.1197T>G (p.Tyr399Ter) single nucleotide variant Retinal dystrophy [RCV001075138]|not provided [RCV002554744] Chr8:86632875 [GRCh38]
Chr8:87645103 [GRCh37]
Chr8:8q21.3
pathogenic|likely pathogenic
NM_019098.4(CNGB3):c.(211+1_212-1)_(338+1_339-1)del deletion Achromatopsia [RCV000787752]   likely pathogenic
NM_019098.5(CNGB3):c.1936T>C (p.Leu646=) single nucleotide variant Achromatopsia [RCV001276126]|not provided [RCV000923856] Chr8:86578856 [GRCh38]
Chr8:87591084 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.2130G>A (p.Glu710=) single nucleotide variant Achromatopsia [RCV001276125]|not provided [RCV000968130] Chr8:86576104 [GRCh38]
Chr8:87588332 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.720C>T (p.Leu240=) single nucleotide variant Achromatopsia 3 [RCV001162523]|Achromatopsia [RCV001279841]|Severe early-childhood-onset retinal dystrophy [RCV001162524]|not provided [RCV000941658] Chr8:86667057 [GRCh38]
Chr8:87679285 [GRCh37]
Chr8:8q21.3
likely benign|uncertain significance
NM_019098.5(CNGB3):c.459A>C (p.Gly153=) single nucleotide variant Achromatopsia [RCV001832164]|not provided [RCV000942214] Chr8:86670978 [GRCh38]
Chr8:87683206 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.2004G>A (p.Pro668=) single nucleotide variant not provided [RCV000942790] Chr8:86578788 [GRCh38]
Chr8:87591016 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.319G>A (p.Gly107Arg) single nucleotide variant Achromatopsia 3 [RCV001161028]|Achromatopsia [RCV001272753]|Severe early-childhood-onset retinal dystrophy [RCV001161029]|not provided [RCV000905932] Chr8:86726550 [GRCh38]
Chr8:87738778 [GRCh37]
Chr8:8q21.3
likely benign|uncertain significance
NM_019098.5(CNGB3):c.1542G>C (p.Val514=) single nucleotide variant not provided [RCV000978007] Chr8:86626019 [GRCh38]
Chr8:87638247 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.1178+9T>C single nucleotide variant Achromatopsia 3 [RCV001164461]|Achromatopsia [RCV001272742]|Severe early-childhood-onset retinal dystrophy [RCV001164462]|not provided [RCV000970399] Chr8:86643742 [GRCh38]
Chr8:87655970 [GRCh37]
Chr8:8q21.3
benign|uncertain significance
NM_019098.5(CNGB3):c.1626C>T (p.Ser542=) single nucleotide variant Achromatopsia 3 [RCV001159426]|Achromatopsia [RCV001272482]|Severe early-childhood-onset retinal dystrophy [RCV001159425]|not provided [RCV000973424] Chr8:86611624 [GRCh38]
Chr8:87623852 [GRCh37]
Chr8:8q21.3
benign|likely benign
NM_019098.5(CNGB3):c.1929-1G>A single nucleotide variant Achromatopsia 3 [RCV002507388]|Achromatopsia [RCV001830725]|not provided [RCV000801505] Chr8:86578864 [GRCh38]
Chr8:87591092 [GRCh37]
Chr8:8q21.3
likely pathogenic
NM_019098.5(CNGB3):c.2085del (p.Lys695fs) deletion Achromatopsia 3 [RCV001784457]|not provided [RCV000824470] Chr8:86578707 [GRCh38]
Chr8:87590935 [GRCh37]
Chr8:8q21.3
likely pathogenic
NC_000008.11:g.86668179dup duplication not provided [RCV000838381] Chr8:8q21.3 benign
NM_019098.5(CNGB3):c.852+1G>T single nucleotide variant Achromatopsia 3 [RCV000988078]|not provided [RCV001858684] Chr8:86666924 [GRCh38]
Chr8:87679152 [GRCh37]
Chr8:8q21.3
pathogenic|likely pathogenic
NM_019098.5(CNGB3):c.1216_1219del (p.Ile406fs) deletion not provided [RCV000821902] Chr8:86632853..86632856 [GRCh38]
Chr8:87645081..87645084 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.*737T>C single nucleotide variant Achromatopsia 3 [RCV001164146]|Severe early-childhood-onset retinal dystrophy [RCV001164147] Chr8:86575067 [GRCh38]
Chr8:87587295 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.715C>A (p.Arg239Ser) single nucleotide variant Achromatopsia [RCV001827148]|not provided [RCV000999049] Chr8:86667062 [GRCh38]
Chr8:87679290 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.*1476T>A single nucleotide variant Achromatopsia 3 [RCV001164045]|Severe early-childhood-onset retinal dystrophy [RCV001164044] Chr8:86574328 [GRCh38]
Chr8:87586556 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.*108C>T single nucleotide variant Achromatopsia 3 [RCV001164238]|Severe early-childhood-onset retinal dystrophy [RCV001164237] Chr8:86575696 [GRCh38]
Chr8:87587924 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.260A>G (p.Asp87Gly) single nucleotide variant Achromatopsia [RCV001832492]|Inborn genetic diseases [RCV002553340]|not provided [RCV001054277] Chr8:86726609 [GRCh38]
Chr8:87738837 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.1488T>G (p.Ser496=) single nucleotide variant not provided [RCV000940974] Chr8:86626073 [GRCh38]
Chr8:87638301 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.1149T>C (p.Thr383=) single nucleotide variant Achromatopsia [RCV001272744]|not provided [RCV000941399] Chr8:86643780 [GRCh38]
Chr8:87656008 [GRCh37]
Chr8:8q21.3
likely benign
GRCh37/hg19 8p12-q24.3(chr8:31936551-146295771)x3 copy number gain not provided [RCV000848192] Chr8:31936551..146295771 [GRCh37]
Chr8:8p12-q24.3
pathogenic
NM_019098.5(CNGB3):c.2087G>A (p.Arg696Gln) single nucleotide variant Achromatopsia 3 [RCV001162314]|Achromatopsia [RCV001828576]|Severe early-childhood-onset retinal dystrophy [RCV001162315]|not provided [RCV001247986] Chr8:86578705 [GRCh38]
Chr8:87590933 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.677C>A (p.Thr226Asn) single nucleotide variant Achromatopsia 3 [RCV001164560]|Severe early-childhood-onset retinal dystrophy [RCV001162525]|not provided [RCV002558550] Chr8:86667100 [GRCh38]
Chr8:87679328 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.1126A>G (p.Asn376Asp) single nucleotide variant Achromatopsia [RCV001829965]|not provided [RCV001245736] Chr8:86643803 [GRCh38]
Chr8:87656031 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.*997A>G single nucleotide variant Achromatopsia 3 [RCV001162126]|Severe early-childhood-onset retinal dystrophy [RCV001162127] Chr8:86574807 [GRCh38]
Chr8:87587035 [GRCh37]
Chr8:8q21.3
benign|likely benign
NM_019098.5(CNGB3):c.441G>T (p.Lys147Asn) single nucleotide variant Achromatopsia [RCV001833988]|not provided [RCV001230020] Chr8:86670996 [GRCh38]
Chr8:87683224 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.1477C>A (p.Leu493Ile) single nucleotide variant not provided [RCV001209132] Chr8:86628922 [GRCh38]
Chr8:87641150 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.2285C>T (p.Ala762Val) single nucleotide variant not provided [RCV001208531] Chr8:86575949 [GRCh38]
Chr8:87588177 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.1056-2A>C single nucleotide variant not provided [RCV001240443] Chr8:86643875 [GRCh38]
Chr8:87656103 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.1048A>C (p.Ile350Leu) single nucleotide variant not provided [RCV001214323] Chr8:86644629 [GRCh38]
Chr8:87656857 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.475G>A (p.Glu159Lys) single nucleotide variant Achromatopsia [RCV001834100]|not provided [RCV001239685] Chr8:86670962 [GRCh38]
Chr8:87683190 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.1806C>A (p.Asn602Lys) single nucleotide variant not provided [RCV001237571] Chr8:86579228 [GRCh38]
Chr8:87591456 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.553T>C (p.Tyr185His) single nucleotide variant not provided [RCV001227476] Chr8:86668109 [GRCh38]
Chr8:87680337 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.212-1G>C single nucleotide variant not provided [RCV001222080] Chr8:86726658 [GRCh38]
Chr8:87738886 [GRCh37]
Chr8:8q21.3
likely pathogenic
NM_019098.5(CNGB3):c.1805A>T (p.Asn602Ile) single nucleotide variant not provided [RCV001226197] Chr8:86579229 [GRCh38]
Chr8:87591457 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.1829C>T (p.Ala610Val) single nucleotide variant Achromatopsia [RCV001835326]|not provided [RCV001248206] Chr8:86579205 [GRCh38]
Chr8:87591433 [GRCh37]
Chr8:8q21.3
uncertain significance
GRCh37/hg19 8p23.3-q24.3(chr8:158048-146295771)x3 copy number gain not provided [RCV000848478] Chr8:158048..146295771 [GRCh37]
Chr8:8p23.3-q24.3
pathogenic
NM_019098.5(CNGB3):c.2328del (p.Arg777fs) deletion Achromatopsia [RCV001002976]|not provided [RCV000999048] Chr8:86575906 [GRCh38]
Chr8:87588134 [GRCh37]
Chr8:8q21.3
pathogenic|uncertain significance
NM_019098.5(CNGB3):c.-1G>A single nucleotide variant Achromatopsia 3 [RCV001164672]|Severe early-childhood-onset retinal dystrophy [RCV001164671] Chr8:86743628 [GRCh38]
Chr8:87755856 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.1698T>A (p.His566Gln) single nucleotide variant not provided [RCV001247578] Chr8:86604176 [GRCh38]
Chr8:87616404 [GRCh37]
Chr8:8q21.3
likely benign|uncertain significance
GRCh37/hg19 8q21.13-21.3(chr8:84358585-89159915)x1 copy number loss not provided [RCV000845762] Chr8:84358585..89159915 [GRCh37]
Chr8:8q21.13-21.3
uncertain significance
NM_019098.5(CNGB3):c.1245_1246del (p.Gln415fs) deletion not provided [RCV001008573] Chr8:86632826..86632827 [GRCh38]
Chr8:87645054..87645055 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.*1218C>T single nucleotide variant Achromatopsia 3 [RCV001160493]|Severe early-childhood-onset retinal dystrophy [RCV001160492] Chr8:86574586 [GRCh38]
Chr8:87586814 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.*1143T>C single nucleotide variant Achromatopsia 3 [RCV001160494]|Severe early-childhood-onset retinal dystrophy [RCV001160495] Chr8:86574661 [GRCh38]
Chr8:87586889 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.1999C>A (p.Pro667Thr) single nucleotide variant not provided [RCV003104814] Chr8:86578793 [GRCh38]
Chr8:87591021 [GRCh37]
Chr8:8q21.3
uncertain significance
Single allele single nucleotide variant not provided [RCV001568458] Chr8:86743736 [GRCh38]
Chr8:87755964 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.1481-145A>C single nucleotide variant Achromatopsia 3 [RCV001543741] Chr8:86626225 [GRCh38]
Chr8:87638453 [GRCh37]
Chr8:8q21.3
benign
NM_019098.5(CNGB3):c.1782-95A>C single nucleotide variant not provided [RCV001577381] Chr8:86579347 [GRCh38]
Chr8:87591575 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.211+33_211+34del deletion not provided [RCV001678305] Chr8:86739621..86739622 [GRCh38]
Chr8:87751849..87751850 [GRCh37]
Chr8:8q21.3
benign
NM_019098.5(CNGB3):c.1320+56G>A single nucleotide variant not provided [RCV001717610] Chr8:86632696 [GRCh38]
Chr8:87644924 [GRCh37]
Chr8:8q21.3
benign
NM_019098.5(CNGB3):c.211+100T>G single nucleotide variant not provided [RCV001656433] Chr8:86739555 [GRCh38]
Chr8:87751783 [GRCh37]
Chr8:8q21.3
benign
NM_019098.5(CNGB3):c.2103+67C>T single nucleotide variant not provided [RCV001716551] Chr8:86578622 [GRCh38]
Chr8:87590850 [GRCh37]
Chr8:8q21.3
benign
NM_019098.5(CNGB3):c.1179-78A>T single nucleotide variant not provided [RCV001676821] Chr8:86632971 [GRCh38]
Chr8:87645199 [GRCh37]
Chr8:8q21.3
benign
NM_019098.5(CNGB3):c.715C>T (p.Arg239Cys) single nucleotide variant Achromatopsia [RCV001272748]|not provided [RCV000931618] Chr8:86667062 [GRCh38]
Chr8:87679290 [GRCh37]
Chr8:8q21.3
benign|likely benign
NM_019098.5(CNGB3):c.1663-2137C>T single nucleotide variant Achromatopsia 3 [RCV001027518]|Achromatopsia [RCV000853552]|not provided [RCV002275149] Chr8:86606348 [GRCh38]
Chr8:87618576 [GRCh37]
Chr8:8q21.3
pathogenic|likely pathogenic
NM_019098.5(CNGB3):c.1320+10G>A single nucleotide variant not provided [RCV000932518] Chr8:86632742 [GRCh38]
Chr8:87644970 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.1663-1205G>A single nucleotide variant Achromatopsia 3 [RCV001270472]|Achromatopsia [RCV000853551] Chr8:86605416 [GRCh38]
Chr8:87617644 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.504G>T (p.Thr168=) single nucleotide variant Achromatopsia [RCV001827070]|not provided [RCV000975780] Chr8:86668158 [GRCh38]
Chr8:87680386 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.1347A>T (p.Thr449=) single nucleotide variant Achromatopsia 3 [RCV001162418]|Achromatopsia [RCV001272741]|Severe early-childhood-onset retinal dystrophy [RCV001162417]|not provided [RCV000941867] Chr8:86629052 [GRCh38]
Chr8:87641280 [GRCh37]
Chr8:8q21.3
likely benign|uncertain significance
NM_019098.5(CNGB3):c.1110T>C (p.Val370=) single nucleotide variant Achromatopsia [RCV001272746]|not provided [RCV000928625] Chr8:86643819 [GRCh38]
Chr8:87656047 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.459A>G (p.Gly153=) single nucleotide variant not provided [RCV000978278] Chr8:86670978 [GRCh38]
Chr8:87683206 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.1566C>T (p.Val522=) single nucleotide variant Achromatopsia [RCV001832112]|not provided [RCV000930072] Chr8:86625995 [GRCh38]
Chr8:87638223 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.1183C>T (p.Leu395=) single nucleotide variant not provided [RCV000942629] Chr8:86632889 [GRCh38]
Chr8:87645117 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.633T>C (p.Asp211=) single nucleotide variant not provided [RCV000982491] Chr8:86668029 [GRCh38]
Chr8:87680257 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.1422T>C (p.Leu474=) single nucleotide variant Achromatopsia [RCV001276133]|not provided [RCV000944291] Chr8:86628977 [GRCh38]
Chr8:87641205 [GRCh37]
Chr8:8q21.3
likely benign|uncertain significance
NM_019098.5(CNGB3):c.1055+1G>C single nucleotide variant Achromatopsia [RCV001199472]|not provided [RCV001860542] Chr8:86644621 [GRCh38]
Chr8:87656849 [GRCh37]
Chr8:8q21.3
pathogenic|likely pathogenic
NM_019098.5(CNGB3):c.2419G>T (p.Ala807Ser) single nucleotide variant Achromatopsia [RCV001834009]|not provided [RCV001231829] Chr8:86575815 [GRCh38]
Chr8:87588043 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.*1431G>A single nucleotide variant Achromatopsia 3 [RCV001159141]|Severe early-childhood-onset retinal dystrophy [RCV001159140] Chr8:86574373 [GRCh38]
Chr8:87586601 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.*649A>G single nucleotide variant Achromatopsia 3 [RCV001159238]|Severe early-childhood-onset retinal dystrophy [RCV001159237] Chr8:86575155 [GRCh38]
Chr8:87587383 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.*570T>C single nucleotide variant Achromatopsia 3 [RCV001159240]|Severe early-childhood-onset retinal dystrophy [RCV001159239] Chr8:86575234 [GRCh38]
Chr8:87587462 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.2423A>C (p.Lys808Thr) single nucleotide variant Achromatopsia 3 [RCV001159336]|Inborn genetic diseases [RCV002558410]|Severe early-childhood-onset retinal dystrophy [RCV001159337] Chr8:86575811 [GRCh38]
Chr8:87588039 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.1773A>G (p.Gly591=) single nucleotide variant Achromatopsia 3 [RCV001159423]|Severe early-childhood-onset retinal dystrophy [RCV001159424] Chr8:86604101 [GRCh38]
Chr8:87616329 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.115C>A (p.Gln39Lys) single nucleotide variant Achromatopsia [RCV001834089]|not provided [RCV001239459] Chr8:86743513 [GRCh38]
Chr8:87755741 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.460G>T (p.Asp154Tyr) single nucleotide variant Achromatopsia 3 [RCV001159646]|Severe early-childhood-onset retinal dystrophy [RCV001159645] Chr8:86670977 [GRCh38]
Chr8:87683205 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.2245A>G (p.Lys749Glu) single nucleotide variant Achromatopsia 3 [RCV002504366]|Achromatopsia [RCV001835305]|Inborn genetic diseases [RCV002564125]|not provided [RCV001247784] Chr8:86575989 [GRCh38]
Chr8:87588217 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.1315G>A (p.Gly439Ser) single nucleotide variant not provided [RCV001232147] Chr8:86632757 [GRCh38]
Chr8:87644985 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.1247C>T (p.Thr416Ile) single nucleotide variant not provided [RCV001070421] Chr8:86632825 [GRCh38]
Chr8:87645053 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.1696C>T (p.His566Tyr) single nucleotide variant Achromatopsia 3 [RCV002491826]|Achromatopsia [RCV001835238]|not provided [RCV001245381] Chr8:86604178 [GRCh38]
Chr8:87616406 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.2350C>T (p.Leu784Phe) single nucleotide variant Achromatopsia 3 [RCV001160704]|Severe early-childhood-onset retinal dystrophy [RCV001160705] Chr8:86575884 [GRCh38]
Chr8:87588112 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.2011G>T (p.Glu671Ter) single nucleotide variant not provided [RCV001071877] Chr8:86578781 [GRCh38]
Chr8:87591009 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.2158CAAAAAGAAAATGAAGATAAA[3] (p.720QKENEDK[3]) microsatellite Achromatopsia [RCV001835180]|not provided [RCV001243660] Chr8:86576034..86576035 [GRCh38]
Chr8:87588262..87588263 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.853-1G>T single nucleotide variant not provided [RCV001213727] Chr8:86654063 [GRCh38]
Chr8:87666291 [GRCh37]
Chr8:8q21.3
likely pathogenic
NC_000008.11:g.(?_86604083)_(86604221_?)del deletion not provided [RCV001031205] Chr8:87616311..87616449 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.1924G>A (p.Ala642Thr) single nucleotide variant Achromatopsia [RCV001833940]|not provided [RCV001224219] Chr8:86579110 [GRCh38]
Chr8:87591338 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.192_195dup (p.His66fs) duplication not provided [RCV001056792] Chr8:86739670..86739671 [GRCh38]
Chr8:87751898..87751899 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.2149G>C (p.Glu717Gln) single nucleotide variant not provided [RCV001227970] Chr8:86576085 [GRCh38]
Chr8:87588313 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.2159A>G (p.Gln720Arg) single nucleotide variant Achromatopsia 3 [RCV001162312]|Achromatopsia [RCV001276124]|Severe early-childhood-onset retinal dystrophy [RCV001162313]|not provided [RCV000933583] Chr8:86576075 [GRCh38]
Chr8:87588303 [GRCh37]
Chr8:8q21.3
likely benign|uncertain significance
NM_019098.5(CNGB3):c.494-8dup duplication Achromatopsia [RCV001272749]|not provided [RCV000891279] Chr8:86668175..86668176 [GRCh38]
Chr8:87680403..87680404 [GRCh37]
Chr8:8q21.3
likely benign|uncertain significance
NM_019098.5(CNGB3):c.211+17dup duplication not provided [RCV001541288] Chr8:86739620..86739621 [GRCh38]
Chr8:87751848..87751849 [GRCh37]
Chr8:8q21.3
benign
NM_019098.5(CNGB3):c.643+135A>T single nucleotide variant not provided [RCV001660830] Chr8:86667884 [GRCh38]
Chr8:87680112 [GRCh37]
Chr8:8q21.3
benign
NM_019098.5(CNGB3):c.129+50C>T single nucleotide variant not provided [RCV001560059] Chr8:86743449 [GRCh38]
Chr8:87755677 [GRCh37]
Chr8:8q21.3
likely benign
GRCh37/hg19 8q21.3(chr8:87010235-91879538)x1 copy number loss not provided [RCV002472864] Chr8:87010235..91879538 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.211+34del deletion not provided [RCV001619066] Chr8:86739621 [GRCh38]
Chr8:87751849 [GRCh37]
Chr8:8q21.3
benign
NM_019098.5(CNGB3):c.211+32_211+34del deletion not provided [RCV001675236] Chr8:86739621..86739623 [GRCh38]
Chr8:87751849..87751851 [GRCh37]
Chr8:8q21.3
benign
NM_019098.5(CNGB3):c.130-72G>T single nucleotide variant not provided [RCV001595699] Chr8:86739808 [GRCh38]
Chr8:87752036 [GRCh37]
Chr8:8q21.3
benign
NM_019098.5(CNGB3):c.493+96C>T single nucleotide variant not provided [RCV001598479] Chr8:86670848 [GRCh38]
Chr8:87683076 [GRCh37]
Chr8:8q21.3
benign
NM_019098.5(CNGB3):c.*435G>A single nucleotide variant Achromatopsia 3 [RCV001160593]|Severe early-childhood-onset retinal dystrophy [RCV001160592] Chr8:86575369 [GRCh38]
Chr8:87587597 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.1207C>T (p.Arg403Ter) single nucleotide variant Achromatopsia [RCV001002977]|not provided [RCV001090382] Chr8:86632865 [GRCh38]
Chr8:87645093 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.*291T>A single nucleotide variant Achromatopsia 3 [RCV001162207]|Severe early-childhood-onset retinal dystrophy [RCV001162208] Chr8:86575513 [GRCh38]
Chr8:87587741 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.*800C>G single nucleotide variant Achromatopsia 3 [RCV001162131]|Severe early-childhood-onset retinal dystrophy [RCV001162130] Chr8:86575004 [GRCh38]
Chr8:87587232 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.721G>A (p.Val241Ile) single nucleotide variant Achromatopsia 3 [RCV001160908]|Severe early-childhood-onset retinal dystrophy [RCV001162522]|not provided [RCV001474218] Chr8:86667056 [GRCh38]
Chr8:87679284 [GRCh37]
Chr8:8q21.3
likely benign|uncertain significance
NM_019098.4(CNGB3):c.1193A>G single nucleotide variant Achromatopsia [RCV001272485]|not provided [RCV001041757] Chr8:86632879 [GRCh38]
Chr8:87645107 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.*183A>C single nucleotide variant Achromatopsia 3 [RCV001162211]|Severe early-childhood-onset retinal dystrophy [RCV001162212] Chr8:86575621 [GRCh38]
Chr8:87587849 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.1781+1G>T single nucleotide variant Achromatopsia 3 [RCV000999643] Chr8:86604092 [GRCh38]
Chr8:87616320 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.1775A>G (p.Glu592Gly) single nucleotide variant Achromatopsia [RCV001276127]|not provided [RCV001054813] Chr8:86604099 [GRCh38]
Chr8:87616327 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.1856T>C (p.Leu619Pro) single nucleotide variant Achromatopsia [RCV001272478]|not provided [RCV001055424] Chr8:86579178 [GRCh38]
Chr8:87591406 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.1515G>A (p.Thr505=) single nucleotide variant Achromatopsia 3 [RCV001160800]|Achromatopsia [RCV001828574]|Severe early-childhood-onset retinal dystrophy [RCV001160801]|not provided [RCV001240796] Chr8:86626046 [GRCh38]
Chr8:87638274 [GRCh37]
Chr8:8q21.3
likely benign|uncertain significance
NM_019098.5(CNGB3):c.387T>G (p.Asp129Glu) single nucleotide variant Achromatopsia 3 [RCV001161024]|Severe early-childhood-onset retinal dystrophy [RCV001161025] Chr8:86671050 [GRCh38]
Chr8:87683278 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.1531G>T (p.Ala511Ser) single nucleotide variant not provided [RCV001056551] Chr8:86626030 [GRCh38]
Chr8:87638258 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.*29G>T single nucleotide variant Achromatopsia 3 [RCV001159335]|Severe early-childhood-onset retinal dystrophy [RCV001159334] Chr8:86575775 [GRCh38]
Chr8:87588003 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.4(CNGB3):c.*1733T>C single nucleotide variant Achromatopsia 3 [RCV001160380]|Severe early-childhood-onset retinal dystrophy [RCV001160381] Chr8:86574071 [GRCh38]
Chr8:87586299 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.2267G>A (p.Cys756Tyr) single nucleotide variant Achromatopsia [RCV001833650]|not provided [RCV001066997] Chr8:86575967 [GRCh38]
Chr8:87588195 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.105_114del (p.Gln36fs) deletion Achromatopsia [RCV001002982]|not provided [RCV001869436] Chr8:86743514..86743523 [GRCh38]
Chr8:87755742..87755751 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.2342G>A (p.Arg781His) single nucleotide variant Achromatopsia [RCV001276122]|not provided [RCV001064246] Chr8:86575892 [GRCh38]
Chr8:87588120 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.4(CNGB3):c.*1654C>T single nucleotide variant Achromatopsia 3 [RCV001162032]|Severe early-childhood-onset retinal dystrophy [RCV001162033] Chr8:86574150 [GRCh38]
Chr8:87586378 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.2235G>C (p.Glu745Asp) single nucleotide variant Achromatopsia [RCV001276123]|not provided [RCV001059497] Chr8:86575999 [GRCh38]
Chr8:87588227 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.1982_1984dup (p.Asp661_Leu662insHis) duplication Achromatopsia [RCV001835292]|not provided [RCV001247190] Chr8:86578807..86578808 [GRCh38]
Chr8:87591035..87591036 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.1834G>T (p.Gly612Trp) single nucleotide variant Achromatopsia [RCV001827234]|Inborn genetic diseases [RCV002552485]|not provided [RCV001039249] Chr8:86579200 [GRCh38]
Chr8:87591428 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.777_778del (p.Ile259fs) microsatellite not provided [RCV001049018] Chr8:86666999..86667000 [GRCh38]
Chr8:87679227..87679228 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.1052A>G (p.Tyr351Cys) single nucleotide variant Achromatopsia [RCV001834057]|not provided [RCV001237239] Chr8:86644625 [GRCh38]
Chr8:87656853 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.968T>G (p.Phe323Cys) single nucleotide variant Achromatopsia [RCV001272486]|not provided [RCV001049171] Chr8:86647823 [GRCh38]
Chr8:87660051 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.1117T>C (p.Trp373Arg) single nucleotide variant Achromatopsia [RCV001272745]|not provided [RCV001049380] Chr8:86643812 [GRCh38]
Chr8:87656040 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.1178+6T>C single nucleotide variant Achromatopsia [RCV001272743]|not provided [RCV001049381] Chr8:86643745 [GRCh38]
Chr8:87655973 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.*915G>C single nucleotide variant Achromatopsia 3 [RCV001162129]|Severe early-childhood-onset retinal dystrophy [RCV001162128] Chr8:86574889 [GRCh38]
Chr8:87587117 [GRCh37]
Chr8:8q21.3
benign
NM_019098.5(CNGB3):c.*272G>T single nucleotide variant Achromatopsia 3 [RCV001162210]|Severe early-childhood-onset retinal dystrophy [RCV001162209] Chr8:86575532 [GRCh38]
Chr8:87587760 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.206T>C (p.Ile69Thr) single nucleotide variant Achromatopsia [RCV001835310]|not provided [RCV001247846] Chr8:86739660 [GRCh38]
Chr8:87751888 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.782A>G (p.Asp261Gly) single nucleotide variant Achromatopsia [RCV001002979] Chr8:86666995 [GRCh38]
Chr8:87679223 [GRCh37]
Chr8:8q21.3
likely pathogenic
NM_019098.5(CNGB3):c.595del (p.Glu199fs) deletion Achromatopsia 3 [RCV002471019]|not provided [RCV001051493] Chr8:86668067 [GRCh38]
Chr8:87680295 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.567G>A (p.Trp189Ter) single nucleotide variant not provided [RCV001035903] Chr8:86668095 [GRCh38]
Chr8:87680323 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.1378G>A (p.Asp460Asn) single nucleotide variant Achromatopsia [RCV001832424]|not provided [RCV001044716] Chr8:86629021 [GRCh38]
Chr8:87641249 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.989A>G (p.Lys330Arg) single nucleotide variant Achromatopsia 3 [RCV001164463]|Severe early-childhood-onset retinal dystrophy [RCV001164464] Chr8:86647802 [GRCh38]
Chr8:87660030 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.1811G>A (p.Arg604Gln) single nucleotide variant Achromatopsia [RCV001835328]|not provided [RCV001248209] Chr8:86579223 [GRCh38]
Chr8:87591451 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.1738G>A (p.Val580Ile) single nucleotide variant Achromatopsia [RCV001272480]|not provided [RCV001064205] Chr8:86604136 [GRCh38]
Chr8:87616364 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.2375C>T (p.Ala792Val) single nucleotide variant Achromatopsia [RCV001827223]|not provided [RCV001037308] Chr8:86575859 [GRCh38]
Chr8:87588087 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.2050G>A (p.Gly684Arg) single nucleotide variant Achromatopsia [RCV001834042]|not provided [RCV001235312] Chr8:86578742 [GRCh38]
Chr8:87590970 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.1204G>T (p.Val402Phe) single nucleotide variant Achromatopsia [RCV001835321]|not provided [RCV001248071] Chr8:86632868 [GRCh38]
Chr8:87645096 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.1013A>G (p.Asn338Ser) single nucleotide variant Achromatopsia [RCV001835330]|not provided [RCV001248276] Chr8:86644664 [GRCh38]
Chr8:87656892 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.503C>T (p.Thr168Met) single nucleotide variant Achromatopsia [RCV001828530]|Retinal dystrophy [RCV001073549]|not provided [RCV001071811] Chr8:86668159 [GRCh38]
Chr8:87680387 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.701_702delinsTG (p.Cys234Leu) indel not provided [RCV001231891] Chr8:86667075..86667076 [GRCh38]
Chr8:87679303..87679304 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.*499G>C single nucleotide variant Achromatopsia 3 [RCV001159241]|Severe early-childhood-onset retinal dystrophy [RCV001159242] Chr8:86575305 [GRCh38]
Chr8:87587533 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.2419G>A (p.Ala807Thr) single nucleotide variant Achromatopsia 3 [RCV001159338]|Severe early-childhood-onset retinal dystrophy [RCV001159339]|not provided [RCV002558411] Chr8:86575815 [GRCh38]
Chr8:87588043 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.473C>T (p.Pro158Leu) single nucleotide variant Achromatopsia 3 [RCV001159642]|Severe early-childhood-onset retinal dystrophy [RCV001159643] Chr8:86670964 [GRCh38]
Chr8:87683192 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.2387A>G (p.Glu796Gly) single nucleotide variant Achromatopsia [RCV001276121]|not provided [RCV001070958] Chr8:86575847 [GRCh38]
Chr8:87588075 [GRCh37]
Chr8:8q21.3
likely benign|conflicting interpretations of pathogenicity|uncertain significance
NM_019098.5(CNGB3):c.1255G>A (p.Glu419Lys) single nucleotide variant Retinal dystrophy [RCV001073612]|not provided [RCV001862509] Chr8:86632817 [GRCh38]
Chr8:87645045 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.442A>G (p.Lys148Glu) single nucleotide variant not provided [RCV001038515] Chr8:86670995 [GRCh38]
Chr8:87683223 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.298del (p.Glu100fs) deletion not provided [RCV001009149] Chr8:86726571 [GRCh38]
Chr8:87738799 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.819del (p.Arg274fs) deletion Achromatopsia [RCV001002978] Chr8:86666958 [GRCh38]
Chr8:87679186 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.4(CNGB3):c.*1705A>C single nucleotide variant Achromatopsia 3 [RCV001160382]|Severe early-childhood-onset retinal dystrophy [RCV001160383] Chr8:86574099 [GRCh38]
Chr8:87586327 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.82G>A (p.Glu28Lys) single nucleotide variant Achromatopsia [RCV001279845]|not provided [RCV001039694] Chr8:86743546 [GRCh38]
Chr8:87755774 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.831T>G (p.Phe277Leu) single nucleotide variant Achromatopsia [RCV001272488]|not provided [RCV001039797] Chr8:86666946 [GRCh38]
Chr8:87679174 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.2T>A (p.Met1Lys) single nucleotide variant not provided [RCV001232354] Chr8:86743626 [GRCh38]
Chr8:87755854 [GRCh37]
Chr8:8q21.3
likely pathogenic
NC_000008.11:g.(?_86739645)_(86743637_?)del deletion not provided [RCV001033075] Chr8:87751873..87755865 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.701_702delinsAG (p.Cys234Ter) indel not provided [RCV001203868] Chr8:86667075..86667076 [GRCh38]
Chr8:87679303..87679304 [GRCh37]
Chr8:8q21.3
pathogenic
GRCh37/hg19 8p23.3-q24.3(chr8:158048-146295771) copy number gain Polydactyly [RCV002280629] Chr8:158048..146295771 [GRCh37]
Chr8:8p23.3-q24.3
pathogenic
NM_019098.5(CNGB3):c.468C>T (p.Ser156=) single nucleotide variant Achromatopsia [RCV001279844]|not provided [RCV002542935] Chr8:86670969 [GRCh38]
Chr8:87683197 [GRCh37]
Chr8:8q21.3
likely benign|uncertain significance
NM_019098.5(CNGB3):c.1167_1168insC (p.Glu390fs) insertion Achromatopsia 3 [RCV001353010] Chr8:86643761..86643762 [GRCh38]
Chr8:87655989..87655990 [GRCh37]
Chr8:8q21.3
likely pathogenic
NM_019098.5(CNGB3):c.498G>T (p.Lys166Asn) single nucleotide variant not provided [RCV001301240] Chr8:86668164 [GRCh38]
Chr8:87680392 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.527G>A (p.Ser176Asn) single nucleotide variant not provided [RCV001299414] Chr8:86668135 [GRCh38]
Chr8:87680363 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.818C>T (p.Pro273Leu) single nucleotide variant Achromatopsia [RCV001835555]|not provided [RCV001314557] Chr8:86666959 [GRCh38]
Chr8:87679187 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.853G>A (p.Val285Met) single nucleotide variant Achromatopsia [RCV001835580]|not provided [RCV001317704] Chr8:86654062 [GRCh38]
Chr8:87666290 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.803T>C (p.Met268Thr) single nucleotide variant Achromatopsia [RCV001831094]|not provided [RCV001343314] Chr8:86666974 [GRCh38]
Chr8:87679202 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.910G>T (p.Val304Phe) single nucleotide variant Achromatopsia [RCV001830396]|not provided [RCV001337675] Chr8:86647881 [GRCh38]
Chr8:87660109 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.353C>T (p.Pro118Leu) single nucleotide variant Achromatopsia [RCV001825898]|not provided [RCV001343922] Chr8:86671084 [GRCh38]
Chr8:87683312 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.1003_1011del (p.Phe335_Phe337del) deletion not provided [RCV001309639] Chr8:86644666..86644674 [GRCh38]
Chr8:87656894..87656902 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.613A>C (p.Lys205Gln) single nucleotide variant Achromatopsia [RCV001830328]|not provided [RCV001319507] Chr8:86668049 [GRCh38]
Chr8:87680277 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.315C>T (p.Asp105=) single nucleotide variant not provided [RCV001392540] Chr8:86726554 [GRCh38]
Chr8:87738782 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.1376T>C (p.Met459Thr) single nucleotide variant Achromatopsia [RCV001831330]|not provided [RCV001374180] Chr8:86629023 [GRCh38]
Chr8:87641251 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.1245A>G (p.Gln415=) single nucleotide variant not provided [RCV001422311] Chr8:86632827 [GRCh38]
Chr8:87645055 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.2180A>G (p.Gln727Arg) single nucleotide variant Achromatopsia [RCV001826012]|not provided [RCV001361861] Chr8:86576054 [GRCh38]
Chr8:87588282 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.2124A>G (p.Gly708=) single nucleotide variant Achromatopsia [RCV001831416]|not provided [RCV001396821] Chr8:86576110 [GRCh38]
Chr8:87588338 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.680T>C (p.Leu227Pro) single nucleotide variant Achromatopsia 3 [RCV002250749]|Achromatopsia [RCV001279842]|not provided [RCV001305799] Chr8:86667097 [GRCh38]
Chr8:87679325 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.1458A>G (p.Thr486=) single nucleotide variant not provided [RCV001395997] Chr8:86628941 [GRCh38]
Chr8:87641169 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.494-6A>G single nucleotide variant not provided [RCV001422649] Chr8:86668174 [GRCh38]
Chr8:87680402 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.2124A>C (p.Gly708=) single nucleotide variant not provided [RCV001422657] Chr8:86576110 [GRCh38]
Chr8:87588338 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.84A>G (p.Glu28=) single nucleotide variant not provided [RCV001392430] Chr8:86743544 [GRCh38]
Chr8:87755772 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.412A>C (p.Arg138=) single nucleotide variant not provided [RCV001396882] Chr8:86671025 [GRCh38]
Chr8:87683253 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.1306A>C (p.Ser436Arg) single nucleotide variant not provided [RCV001362630] Chr8:86632766 [GRCh38]
Chr8:87644994 [GRCh37]
Chr8:8q21.3
likely pathogenic|uncertain significance
NM_019098.5(CNGB3):c.2224A>T (p.Lys742Ter) single nucleotide variant not provided [RCV001344809] Chr8:86576010 [GRCh38]
Chr8:87588238 [GRCh37]
Chr8:8q21.3
likely benign|uncertain significance
NM_019098.5(CNGB3):c.1178+5G>T single nucleotide variant Achromatopsia 3 [RCV001270471] Chr8:86643746 [GRCh38]
Chr8:87655974 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.489A>T (p.Gln163His) single nucleotide variant Achromatopsia [RCV001279843]|not provided [RCV001343561] Chr8:86670948 [GRCh38]
Chr8:87683176 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.2200G>C (p.Gly734Arg) single nucleotide variant not provided [RCV001296510] Chr8:86576034 [GRCh38]
Chr8:87588262 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.547C>G (p.His183Asp) single nucleotide variant not provided [RCV001341553] Chr8:86668115 [GRCh38]
Chr8:87680343 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.1087A>T (p.Ile363Phe) single nucleotide variant not provided [RCV001344535] Chr8:86643842 [GRCh38]
Chr8:87656070 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.2153A>G (p.Asp718Gly) single nucleotide variant not provided [RCV001359960] Chr8:86576081 [GRCh38]
Chr8:87588309 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.506C>A (p.Ala169Asp) single nucleotide variant not provided [RCV001366292] Chr8:86668156 [GRCh38]
Chr8:87680384 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.1632C>T (p.Leu544=) single nucleotide variant not provided [RCV001421414] Chr8:86611618 [GRCh38]
Chr8:87623846 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.1778T>G (p.Ile593Ser) single nucleotide variant Achromatopsia [RCV001831270]|not provided [RCV001366796] Chr8:86604096 [GRCh38]
Chr8:87616324 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.2370T>C (p.Pro790=) single nucleotide variant not provided [RCV001395567] Chr8:86575864 [GRCh38]
Chr8:87588092 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.2103+4A>G single nucleotide variant Achromatopsia [RCV001279840] Chr8:86578685 [GRCh38]
Chr8:87590913 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.1937T>C (p.Leu646Ser) single nucleotide variant not provided [RCV001316654] Chr8:86578855 [GRCh38]
Chr8:87591083 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.995C>T (p.Thr332Ile) single nucleotide variant Achromatopsia [RCV001831259]|not provided [RCV001365425] Chr8:86644682 [GRCh38]
Chr8:87656910 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.991-8C>T single nucleotide variant not provided [RCV001422125] Chr8:86644694 [GRCh38]
Chr8:87656922 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.852+4010_903+1699dup duplication Achromatopsia 3 [RCV001293009] Chr8:86652312..86652313 [GRCh38]
Chr8:87664540..87664541 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.1638G>A (p.Leu546=) single nucleotide variant not provided [RCV001421419] Chr8:86611612 [GRCh38]
Chr8:87623840 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.927A>G (p.Pro309=) single nucleotide variant not provided [RCV001493790] Chr8:86647864 [GRCh38]
Chr8:87660092 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.2307A>T (p.Ser769=) single nucleotide variant not provided [RCV001412366] Chr8:86575927 [GRCh38]
Chr8:87588155 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.1063C>A (p.Arg355=) single nucleotide variant not provided [RCV001413634] Chr8:86643866 [GRCh38]
Chr8:87656094 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.1178+11A>G single nucleotide variant not provided [RCV001457508] Chr8:86643740 [GRCh38]
Chr8:87655968 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.249C>A (p.Thr83=) single nucleotide variant not provided [RCV001490342] Chr8:86726620 [GRCh38]
Chr8:87738848 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.1911C>T (p.Ile637=) single nucleotide variant not provided [RCV001495435] Chr8:86579123 [GRCh38]
Chr8:87591351 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.273A>G (p.Ala91=) single nucleotide variant not provided [RCV001501963] Chr8:86726596 [GRCh38]
Chr8:87738824 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.1615A>C (p.Arg539=) single nucleotide variant not provided [RCV001399459] Chr8:86611635 [GRCh38]
Chr8:87623863 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.318C>T (p.Pro106=) single nucleotide variant not provided [RCV001417206] Chr8:86726551 [GRCh38]
Chr8:87738779 [GRCh37]
Chr8:8q21.3
likely benign
NC_000008.10:g.(?_87666240)_(87683326_?)dup duplication not provided [RCV001380713] Chr8:87666240..87683326 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.1827G>T (p.Val609=) single nucleotide variant not provided [RCV001425361] Chr8:86579207 [GRCh38]
Chr8:87591435 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.1464C>T (p.Asp488=) single nucleotide variant not provided [RCV001491269] Chr8:86628935 [GRCh38]
Chr8:87641163 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.1480+7A>G single nucleotide variant not provided [RCV001462783] Chr8:86628912 [GRCh38]
Chr8:87641140 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.2346A>G (p.Gln782=) single nucleotide variant not provided [RCV001471290] Chr8:86575888 [GRCh38]
Chr8:87588116 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.1186A>C (p.Arg396=) single nucleotide variant not provided [RCV001491423] Chr8:86632886 [GRCh38]
Chr8:87645114 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.1389T>C (p.Ile463=) single nucleotide variant not provided [RCV001480359] Chr8:86629010 [GRCh38]
Chr8:87641238 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.1176C>T (p.Asn392=) single nucleotide variant not provided [RCV001503801] Chr8:86643753 [GRCh38]
Chr8:87655981 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.1794A>T (p.Ala598=) single nucleotide variant not provided [RCV001471812] Chr8:86579240 [GRCh38]
Chr8:87591468 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.1782-20C>T single nucleotide variant not provided [RCV001483871] Chr8:86579272 [GRCh38]
Chr8:87591500 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.2325A>G (p.Leu775=) single nucleotide variant not provided [RCV001455767] Chr8:86575909 [GRCh38]
Chr8:87588137 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.1662+9A>G single nucleotide variant not provided [RCV001463633] Chr8:86611579 [GRCh38]
Chr8:87623807 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.2367T>C (p.Ala789=) single nucleotide variant not provided [RCV001489450] Chr8:86575867 [GRCh38]
Chr8:87588095 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.1956C>T (p.Thr652=) single nucleotide variant Achromatopsia [RCV001826248]|not provided [RCV001434707] Chr8:86578836 [GRCh38]
Chr8:87591064 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.852+10G>A single nucleotide variant not provided [RCV001393424] Chr8:86666915 [GRCh38]
Chr8:87679143 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.991-6A>G single nucleotide variant not provided [RCV001401318] Chr8:86644692 [GRCh38]
Chr8:87656920 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.852+9G>T single nucleotide variant not provided [RCV001491949] Chr8:86666916 [GRCh38]
Chr8:87679144 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.1224T>C (p.Ile408=) single nucleotide variant not provided [RCV001478285] Chr8:86632848 [GRCh38]
Chr8:87645076 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.212-19G>T single nucleotide variant not provided [RCV001486233] Chr8:86726676 [GRCh38]
Chr8:87738904 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.1578+20A>G single nucleotide variant not provided [RCV001493592] Chr8:86625963 [GRCh38]
Chr8:87638191 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.2179_2182del (p.Gln727fs) deletion not provided [RCV001382163] Chr8:86576052..86576055 [GRCh38]
Chr8:87588280..87588283 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.130-1G>A single nucleotide variant Achromatopsia [RCV001831366]|not provided [RCV001379099] Chr8:86739737 [GRCh38]
Chr8:87751965 [GRCh37]
Chr8:8q21.3
likely pathogenic
NM_019098.5(CNGB3):c.1221C>T (p.Thr407=) single nucleotide variant not provided [RCV001428047] Chr8:86632851 [GRCh38]
Chr8:87645079 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.1335T>C (p.Ile445=) single nucleotide variant not provided [RCV001409629] Chr8:86629064 [GRCh38]
Chr8:87641292 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.381T>C (p.Tyr127=) single nucleotide variant not provided [RCV001400808] Chr8:86671056 [GRCh38]
Chr8:87683284 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.1968C>G (p.Thr656=) single nucleotide variant not provided [RCV001434276] Chr8:86578824 [GRCh38]
Chr8:87591052 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.2175T>C (p.Asp725=) single nucleotide variant not provided [RCV001435746] Chr8:86576059 [GRCh38]
Chr8:87588287 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.39T>C (p.Pro13=) single nucleotide variant not provided [RCV001430265] Chr8:86743589 [GRCh38]
Chr8:87755817 [GRCh37]
Chr8:8q21.3
likely benign
NC_000008.10:g.(?_87638201)_(87645131_?)del deletion not provided [RCV001380712] Chr8:87638201..87645131 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.969T>C (p.Phe323=) single nucleotide variant not provided [RCV001424972] Chr8:86647822 [GRCh38]
Chr8:87660050 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.1928+7C>A single nucleotide variant not provided [RCV001435915] Chr8:86579099 [GRCh38]
Chr8:87591327 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.835A>G (p.Arg279Gly) single nucleotide variant not provided [RCV001426684] Chr8:86666942 [GRCh38]
Chr8:87679170 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.1413T>A (p.Ile471=) single nucleotide variant not provided [RCV001403480] Chr8:86628986 [GRCh38]
Chr8:87641214 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.339-8T>C single nucleotide variant not provided [RCV001423582] Chr8:86671106 [GRCh38]
Chr8:87683334 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.666C>T (p.Leu222=) single nucleotide variant not provided [RCV001449462] Chr8:86667111 [GRCh38]
Chr8:87679339 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.999A>G (p.Ser333=) single nucleotide variant not provided [RCV001431206] Chr8:86644678 [GRCh38]
Chr8:87656906 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.1782-11CT[2] microsatellite not provided [RCV001444724] Chr8:86579258..86579259 [GRCh38]
Chr8:87591486..87591487 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.1928+11T>A single nucleotide variant not provided [RCV001416028] Chr8:86579095 [GRCh38]
Chr8:87591323 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.130-7C>T single nucleotide variant not provided [RCV001431070] Chr8:86739743 [GRCh38]
Chr8:87751971 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.183G>A (p.Thr61=) single nucleotide variant Achromatopsia [RCV001831451]|not provided [RCV001410558] Chr8:86739683 [GRCh38]
Chr8:87751911 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.1077C>T (p.Tyr359=) single nucleotide variant not provided [RCV001431177] Chr8:86643852 [GRCh38]
Chr8:87656080 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.211+8T>C single nucleotide variant not provided [RCV001447683] Chr8:86739647 [GRCh38]
Chr8:87751875 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.1579-5T>C single nucleotide variant not provided [RCV001393289] Chr8:86611676 [GRCh38]
Chr8:87623904 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.2382C>A (p.Gly794=) single nucleotide variant not provided [RCV001437959] Chr8:86575852 [GRCh38]
Chr8:87588080 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.2340T>A (p.Ser780=) single nucleotide variant not provided [RCV001438857] Chr8:86575894 [GRCh38]
Chr8:87588122 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.12G>T (p.Ser4=) single nucleotide variant not provided [RCV001408494] Chr8:86743616 [GRCh38]
Chr8:87755844 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.701G>A (p.Cys234Tyr) single nucleotide variant Achromatopsia 3 [RCV001526713] Chr8:86667076 [GRCh38]
Chr8:87679304 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.668T>A (p.Leu223Ter) single nucleotide variant not provided [RCV001388898] Chr8:86667109 [GRCh38]
Chr8:87679337 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.504G>A (p.Thr168=) single nucleotide variant not provided [RCV001445371] Chr8:86668158 [GRCh38]
Chr8:87680386 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.1539T>C (p.Asp513=) single nucleotide variant not provided [RCV001416422] Chr8:86626022 [GRCh38]
Chr8:87638250 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.1125A>C (p.Ser375=) single nucleotide variant not provided [RCV001432112] Chr8:86643804 [GRCh38]
Chr8:87656032 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.990+7T>G single nucleotide variant not provided [RCV001428471] Chr8:86647794 [GRCh38]
Chr8:87660022 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.2307A>G (p.Ser769=) single nucleotide variant not provided [RCV001408960] Chr8:86575927 [GRCh38]
Chr8:87588155 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.2397T>C (p.Leu799=) single nucleotide variant not provided [RCV001427507] Chr8:86575837 [GRCh38]
Chr8:87588065 [GRCh37]
Chr8:8q21.3
likely benign
NC_000008.10:g.(?_87644970)_(87660125_?)del deletion not provided [RCV001377767] Chr8:87644970..87660125 [GRCh37]
Chr8:8q21.3
likely pathogenic
NM_019098.5(CNGB3):c.1738del (p.Val580fs) deletion not provided [RCV001382110] Chr8:86604136 [GRCh38]
Chr8:87616364 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.211+10C>A single nucleotide variant not provided [RCV001468237] Chr8:86739645 [GRCh38]
Chr8:87751873 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.873G>A (p.Arg291=) single nucleotide variant not provided [RCV001494911] Chr8:86654042 [GRCh38]
Chr8:87666270 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.1056-6T>C single nucleotide variant not provided [RCV001457569] Chr8:86643879 [GRCh38]
Chr8:87656107 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.212-8T>C single nucleotide variant not provided [RCV001465028] Chr8:86726665 [GRCh38]
Chr8:87738893 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.1392C>G (p.Ala464=) single nucleotide variant not provided [RCV001450556] Chr8:86629007 [GRCh38]
Chr8:87641235 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.588T>C (p.Pro196=) single nucleotide variant not provided [RCV001482446] Chr8:86668074 [GRCh38]
Chr8:87680302 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.1350C>T (p.Ala450=) single nucleotide variant not provided [RCV001473488] Chr8:86629049 [GRCh38]
Chr8:87641277 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.153A>G (p.Lys51=) single nucleotide variant not provided [RCV001450862] Chr8:86739713 [GRCh38]
Chr8:87751941 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.258T>C (p.Pro86=) single nucleotide variant not provided [RCV001458497] Chr8:86726611 [GRCh38]
Chr8:87738839 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.1928+18C>T single nucleotide variant not provided [RCV001519654] Chr8:86579088 [GRCh38]
Chr8:87591316 [GRCh37]
Chr8:8q21.3
benign
NM_019098.5(CNGB3):c.562T>C (p.Leu188=) single nucleotide variant not provided [RCV001482459] Chr8:86668100 [GRCh38]
Chr8:87680328 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.1321-97C>A single nucleotide variant not provided [RCV001688578] Chr8:86629175 [GRCh38]
Chr8:87641403 [GRCh37]
Chr8:8q21.3
benign
NM_019098.5(CNGB3):c.2403T>C (p.Ile801=) single nucleotide variant not provided [RCV001496365] Chr8:86575831 [GRCh38]
Chr8:87588059 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.1251A>G (p.Leu417=) single nucleotide variant not provided [RCV001499811] Chr8:86632821 [GRCh38]
Chr8:87645049 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.1272C>G (p.Leu424=) single nucleotide variant not provided [RCV001465232] Chr8:86632800 [GRCh38]
Chr8:87645028 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.2418G>A (p.Lys806=) single nucleotide variant not provided [RCV001451754] Chr8:86575816 [GRCh38]
Chr8:87588044 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.2352C>T (p.Leu784=) single nucleotide variant not provided [RCV001451764] Chr8:86575882 [GRCh38]
Chr8:87588110 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.1614A>G (p.Leu538=) single nucleotide variant not provided [RCV001452289] Chr8:86611636 [GRCh38]
Chr8:87623864 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.1662+67A>G single nucleotide variant not provided [RCV001613575] Chr8:86611521 [GRCh38]
Chr8:87623749 [GRCh37]
Chr8:8q21.3
benign
NM_019098.5(CNGB3):c.1800A>G (p.Gly600=) single nucleotide variant not provided [RCV001501021] Chr8:86579234 [GRCh38]
Chr8:87591462 [GRCh37]
Chr8:8q21.3
likely benign
Single allele single nucleotide variant not provided [RCV001665651] Chr8:86743727 [GRCh38]
Chr8:87755955 [GRCh37]
Chr8:8q21.3
benign
NM_019098.5(CNGB3):c.494-11del deletion Achromatopsia [RCV001832690]|not provided [RCV001513344] Chr8:86668179 [GRCh38]
Chr8:87680407 [GRCh37]
Chr8:8q21.3
benign|likely benign
NM_019098.5(CNGB3):c.1611G>A (p.Leu537=) single nucleotide variant not provided [RCV001453501] Chr8:86611639 [GRCh38]
Chr8:87623867 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.643+18A>G single nucleotide variant not provided [RCV001478264] Chr8:86668001 [GRCh38]
Chr8:87680229 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.2400T>A (p.Thr800=) single nucleotide variant not provided [RCV001471316] Chr8:86575834 [GRCh38]
Chr8:87588062 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.945C>T (p.Leu315=) single nucleotide variant not provided [RCV001453195] Chr8:86647846 [GRCh38]
Chr8:87660074 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.1191T>C (p.Cys397=) single nucleotide variant not provided [RCV001490250] Chr8:86632881 [GRCh38]
Chr8:87645109 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.2181_2184del (p.Glu729fs) deletion not provided [RCV001377961] Chr8:86576050..86576053 [GRCh38]
Chr8:87588278..87588281 [GRCh37]
Chr8:8q21.3
likely pathogenic
NM_019098.5(CNGB3):c.212-5dup duplication not provided [RCV001405711] Chr8:86726661..86726662 [GRCh38]
Chr8:87738889..87738890 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.1782-17A>G single nucleotide variant not provided [RCV001497819] Chr8:86579269 [GRCh38]
Chr8:87591497 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.318C>G (p.Pro106=) single nucleotide variant not provided [RCV001468609] Chr8:86726551 [GRCh38]
Chr8:87738779 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.130-5C>T single nucleotide variant not provided [RCV001452359] Chr8:86739741 [GRCh38]
Chr8:87751969 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.2103+8G>A single nucleotide variant not provided [RCV001460972] Chr8:86578681 [GRCh38]
Chr8:87590909 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.2295A>G (p.Glu765=) single nucleotide variant not provided [RCV001486458] Chr8:86575939 [GRCh38]
Chr8:87588167 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.1248T>A (p.Thr416=) single nucleotide variant not provided [RCV001470862] Chr8:86632824 [GRCh38]
Chr8:87645052 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.826C>T (p.Gln276Ter) single nucleotide variant not provided [RCV001390850] Chr8:86666951 [GRCh38]
Chr8:87679179 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.1458A>C (p.Thr486=) single nucleotide variant not provided [RCV001457179] Chr8:86628941 [GRCh38]
Chr8:87641169 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.705T>C (p.Phe235=) single nucleotide variant not provided [RCV001460564] Chr8:86667072 [GRCh38]
Chr8:87679300 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.354G>A (p.Pro118=) single nucleotide variant not provided [RCV001510841] Chr8:86671083 [GRCh38]
Chr8:87683311 [GRCh37]
Chr8:8q21.3
benign
NM_019098.5(CNGB3):c.1626C>A (p.Ser542=) single nucleotide variant not provided [RCV001496506] Chr8:86611624 [GRCh38]
Chr8:87623852 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.264T>C (p.Pro88=) single nucleotide variant not provided [RCV001438332] Chr8:86726605 [GRCh38]
Chr8:87738833 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.12G>A (p.Ser4=) single nucleotide variant Achromatopsia [RCV001826306]|not provided [RCV001476500] Chr8:86743616 [GRCh38]
Chr8:87755844 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.1056-1G>C single nucleotide variant not provided [RCV001378336] Chr8:86643874 [GRCh38]
Chr8:87656102 [GRCh37]
Chr8:8q21.3
pathogenic|likely pathogenic
NM_019098.5(CNGB3):c.528C>T (p.Ser176=) single nucleotide variant not provided [RCV001496828] Chr8:86668134 [GRCh38]
Chr8:87680362 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.886_890del (p.Thr296fs) deletion Achromatopsia 3 [RCV002307741]|not provided [RCV001383906] Chr8:86654025..86654029 [GRCh38]
Chr8:87666253..87666257 [GRCh37]
Chr8:8q21.3
pathogenic|likely pathogenic
NM_019098.5(CNGB3):c.212-12T>C single nucleotide variant not provided [RCV001430146] Chr8:86726669 [GRCh38]
Chr8:87738897 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.1908G>T (p.Arg636Ser) single nucleotide variant not provided [RCV001436927] Chr8:86579126 [GRCh38]
Chr8:87591354 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.600C>T (p.Tyr200=) single nucleotide variant not provided [RCV001503872] Chr8:86668062 [GRCh38]
Chr8:87680290 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.15G>C (p.Leu5=) single nucleotide variant not provided [RCV001416390] Chr8:86743613 [GRCh38]
Chr8:87755841 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.853-16T>C single nucleotide variant not provided [RCV001477041] Chr8:86654078 [GRCh38]
Chr8:87666306 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.1370C>A (p.Ala457Asp) single nucleotide variant not provided [RCV001489350] Chr8:86629029 [GRCh38]
Chr8:87641257 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.917C>A (p.Ser306Ter) single nucleotide variant not provided [RCV001384785] Chr8:86647874 [GRCh38]
Chr8:87660102 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.129+19T>C single nucleotide variant not provided [RCV001459872] Chr8:86743480 [GRCh38]
Chr8:87755708 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.1662+20C>A single nucleotide variant not provided [RCV001502824] Chr8:86611568 [GRCh38]
Chr8:87623796 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.1359C>T (p.Asn453_Tyr454=) single nucleotide variant not provided [RCV003106821] Chr8:86629040 [GRCh38]
Chr8:87641268 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.442_446delinsGAAAAT (p.Lys148fs) indel Achromatopsia 3 [RCV001780519] Chr8:86670991..86670995 [GRCh38]
Chr8:87683219..87683223 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.381T>G (p.Tyr127Ter) single nucleotide variant not provided [RCV002007463] Chr8:86671056 [GRCh38]
Chr8:87683284 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.1415C>T (p.Pro472Leu) single nucleotide variant not provided [RCV001896898] Chr8:86628984 [GRCh38]
Chr8:87641212 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.192G>T (p.Glu64Asp) single nucleotide variant not provided [RCV002008906] Chr8:86739674 [GRCh38]
Chr8:87751902 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.385G>A (p.Asp129Asn) single nucleotide variant not provided [RCV001950653] Chr8:86671052 [GRCh38]
Chr8:87683280 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.1553TCA[1] (p.Ile519del) microsatellite not provided [RCV001915574] Chr8:86626003..86626005 [GRCh38]
Chr8:87638231..87638233 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.307G>A (p.Glu103Lys) single nucleotide variant not provided [RCV001983655] Chr8:86726562 [GRCh38]
Chr8:87738790 [GRCh37]
Chr8:8q21.3
uncertain significance
NC_000008.10:g.(?_87679143)_(87680406_?)del deletion not provided [RCV001946930] Chr8:87679143..87680406 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.1331T>G (p.Val444Gly) single nucleotide variant not provided [RCV002002233] Chr8:86629068 [GRCh38]
Chr8:87641296 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.2362A>G (p.Met788Val) single nucleotide variant not provided [RCV001913707] Chr8:86575872 [GRCh38]
Chr8:87588100 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.350A>G (p.Lys117Arg) single nucleotide variant not provided [RCV001891986] Chr8:86671087 [GRCh38]
Chr8:87683315 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.2103+5T>C single nucleotide variant not provided [RCV001950316] Chr8:86578684 [GRCh38]
Chr8:87590912 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.129+3A>G single nucleotide variant not provided [RCV001914100] Chr8:86743496 [GRCh38]
Chr8:87755724 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.760C>T (p.Leu254Phe) single nucleotide variant not provided [RCV001950478] Chr8:86667017 [GRCh38]
Chr8:87679245 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.1168G>T (p.Glu390Ter) single nucleotide variant not provided [RCV002007197] Chr8:86643761 [GRCh38]
Chr8:87655989 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.626G>C (p.Ser209Thr) single nucleotide variant not provided [RCV002045259] Chr8:86668036 [GRCh38]
Chr8:87680264 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.1327G>T (p.Asp443Tyr) single nucleotide variant not provided [RCV002009374] Chr8:86629072 [GRCh38]
Chr8:87641300 [GRCh37]
Chr8:8q21.3
uncertain significance
NC_000008.10:g.(?_87588022)_(87591490_?)del deletion not provided [RCV001982965] Chr8:87588022..87591490 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.1924G>T (p.Ala642Ser) single nucleotide variant not provided [RCV002039865] Chr8:86579110 [GRCh38]
Chr8:87591338 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.283A>C (p.Thr95Pro) single nucleotide variant not provided [RCV002021813] Chr8:86726586 [GRCh38]
Chr8:87738814 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.571A>G (p.Lys191Glu) single nucleotide variant not provided [RCV002003867] Chr8:86668091 [GRCh38]
Chr8:87680319 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.68G>T (p.Ser23Ile) single nucleotide variant Inborn genetic diseases [RCV002548768]|not provided [RCV002023394] Chr8:86743560 [GRCh38]
Chr8:87755788 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.598T>C (p.Tyr200His) single nucleotide variant not provided [RCV001945442] Chr8:86668064 [GRCh38]
Chr8:87680292 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.647G>A (p.Arg216Gln) single nucleotide variant not provided [RCV001985025] Chr8:86667130 [GRCh38]
Chr8:87679358 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.952G>A (p.Gly318Arg) single nucleotide variant not provided [RCV001964918] Chr8:86647839 [GRCh38]
Chr8:87660067 [GRCh37]
Chr8:8q21.3
uncertain significance
GRCh37/hg19 8q21.3(chr8:87429000-87605195)x1 copy number loss not provided [RCV001827603] Chr8:87429000..87605195 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.1756G>A (p.Ala586Thr) single nucleotide variant not provided [RCV001967425] Chr8:86604118 [GRCh38]
Chr8:87616346 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.1370_1371del (p.Ala457fs) deletion not provided [RCV001928423] Chr8:86629028..86629029 [GRCh38]
Chr8:87641256..87641257 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.397C>T (p.His133Tyr) single nucleotide variant not provided [RCV001894541] Chr8:86671040 [GRCh38]
Chr8:87683268 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.479C>T (p.Ala160Val) single nucleotide variant not provided [RCV002022215] Chr8:86670958 [GRCh38]
Chr8:87683186 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.1231C>T (p.Leu411Phe) single nucleotide variant not provided [RCV001948485] Chr8:86632841 [GRCh38]
Chr8:87645069 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.1431del (p.Lys477fs) deletion not provided [RCV001928234] Chr8:86628968 [GRCh38]
Chr8:87641196 [GRCh37]
Chr8:8q21.3
pathogenic
GRCh37/hg19 8q21.3(chr8:87660100-88885305) copy number gain not specified [RCV002053783] Chr8:87660100..88885305 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.1214T>C (p.Leu405Ser) single nucleotide variant Achromatopsia 3 [RCV002052156] Chr8:86632858 [GRCh38]
Chr8:87645086 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.1578+3A>T single nucleotide variant not provided [RCV001895118] Chr8:86625980 [GRCh38]
Chr8:87638208 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.2047A>C (p.Thr683Pro) single nucleotide variant Achromatopsia 3 [RCV002478317]|Inborn genetic diseases [RCV002555289]|not provided [RCV001913102] Chr8:86578745 [GRCh38]
Chr8:87590973 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.2184del (p.Glu729fs) deletion not provided [RCV001911708] Chr8:86576050 [GRCh38]
Chr8:87588278 [GRCh37]
Chr8:8q21.3
pathogenic
GRCh37/hg19 8q21.11-21.3(chr8:77906471-88917707) copy number loss not specified [RCV002053776] Chr8:77906471..88917707 [GRCh37]
Chr8:8q21.11-21.3
pathogenic
NM_019098.5(CNGB3):c.1126A>C (p.Asn376His) single nucleotide variant not provided [RCV001968640] Chr8:86643803 [GRCh38]
Chr8:87656031 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.194C>G (p.Pro65Arg) single nucleotide variant not provided [RCV002023671] Chr8:86739672 [GRCh38]
Chr8:87751900 [GRCh37]
Chr8:8q21.3
uncertain significance
GRCh37/hg19 8q13.2-24.3(chr8:70382990-146295771) copy number gain not specified [RCV002053772] Chr8:70382990..146295771 [GRCh37]
Chr8:8q13.2-24.3
pathogenic
NC_000008.10:g.(?_87679332)_(87687741_?)del deletion not provided [RCV002007268] Chr8:87679332..87687741 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.1929-6_1929-5delinsAA indel not provided [RCV001976547] Chr8:86578868..86578869 [GRCh38]
Chr8:87591096..87591097 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.991-1_992del deletion not provided [RCV002037058] Chr8:86644685..86644687 [GRCh38]
Chr8:87656913..87656915 [GRCh37]
Chr8:8q21.3
likely pathogenic
NM_019098.5(CNGB3):c.1044A>G (p.Ala348=) single nucleotide variant not provided [RCV001962885] Chr8:86644633 [GRCh38]
Chr8:87656861 [GRCh37]
Chr8:8q21.3
likely benign
NM_019098.5(CNGB3):c.1764G>A (p.Ser588=) single nucleotide variant not provided [RCV001943120] Chr8:86604110 [GRCh38]
Chr8:87616338 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.959A>T (p.Asn320Ile) single nucleotide variant not provided [RCV001957384] Chr8:86647832 [GRCh38]
Chr8:87660060 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.1576A>T (p.Lys526Ter) single nucleotide variant not provided [RCV001936904] Chr8:86625985 [GRCh38]
Chr8:87638213 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.590T>G (p.Leu197Ter) single nucleotide variant not provided [RCV002037721] Chr8:86668072 [GRCh38]
Chr8:87680300 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.1666G>T (p.Glu556Ter) single nucleotide variant not provided [RCV001981889] Chr8:86604208 [GRCh38]
Chr8:87616436 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.1250del (p.Leu417fs) deletion not provided [RCV001944195] Chr8:86632822 [GRCh38]
Chr8:87645050 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.1180T>A (p.Tyr394Asn) single nucleotide variant not provided [RCV001920901] Chr8:86632892 [GRCh38]
Chr8:87645120 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.1461G>A (p.Trp487Ter) single nucleotide variant not provided [RCV001982043] Chr8:86628938 [GRCh38]
Chr8:87641166 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.1301T>C (p.Phe434Ser) single nucleotide variant not provided [RCV001925978] Chr8:86632771 [GRCh38]
Chr8:87644999 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.903+1G>A single nucleotide variant not provided [RCV002016435] Chr8:86654011 [GRCh38]
Chr8:87666239 [GRCh37]
Chr8:8q21.3
likely pathogenic
NM_019098.5(CNGB3):c.107A>G (p.Gln36Arg) single nucleotide variant not provided [RCV001975810] Chr8:86743521 [GRCh38]
Chr8:87755749 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.953G>T (p.Gly318Val) single nucleotide variant not provided [RCV002014951] Chr8:86647838 [GRCh38]
Chr8:87660066 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.377A>G (p.Glu126Gly) single nucleotide variant not provided [RCV002000984] Chr8:86671060 [GRCh38]
Chr8:87683288 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.1579-2del deletion not provided [RCV002000119] Chr8:86611673 [GRCh38]
Chr8:87623901 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.2401A>G (p.Ile801Val) single nucleotide variant not provided [RCV002019353] Chr8:86575833 [GRCh38]
Chr8:87588061 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.250_262del (p.Thr84fs) deletion not provided [RCV001941651] Chr8:86726607..86726619 [GRCh38]
Chr8:87738835..87738847 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.1310T>G (p.Leu437Ter) single nucleotide variant not provided [RCV001962739] Chr8:86632762 [GRCh38]
Chr8:87644990 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.566G>A (p.Trp189Ter) single nucleotide variant not provided [RCV001920136] Chr8:86668096 [GRCh38]
Chr8:87680324 [GRCh37]
Chr8:8q21.3
pathogenic
NM_019098.5(CNGB3):c.2179_2180delinsGG (p.Gln727Gly) indel not provided [RCV001943798] Chr8:86576054..86576055 [GRCh38]
Chr8:87588282..87588283 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.2186A>G (p.Glu729Gly) single nucleotide variant not provided [RCV002029316] Chr8:86576048 [GRCh38]
Chr8:87588276 [GRCh37]
Chr8:8q21.3
uncertain significance
NM_019098.5(CNGB3):c.1400A>G (p.Asn467Ser) single nucleotide variant not provided [