D5Uwm59 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: D5Uwm59

Symbol: D5Uwm59
Previously known as: oxsts8440; UW667; 
RGD ID: 69509
Expected Size: 188 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
GRCr85137,115,546 - 137,115,734 (+)Marker Load Pipeline
mRatBN7.25131,830,143 - 131,830,331 (+)MAPPERmRatBN7.2
Rnor_6.05137,126,235 - 137,126,422NCBIRnor6.0
Rnor_5.05140,915,023 - 140,915,210UniSTSRnor5.0
RGSC_v3.45138,760,184 - 138,760,372RGDRGSC3.4
RGSC_v3.45138,760,185 - 138,760,372UniSTSRGSC3.4
RGSC_v3.15138,765,410 - 138,765,598RGD
Celera5130,377,263 - 130,377,450UniSTS
Cytogenetic Map5 RGD




#
Reference Title
Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. Electronic Submission of SSLP Data Sets Gould M, Shepel L, Feb.(9) 2001. University of Wisconsin Medical School, McArdle Cancer Research Center
3. UniSTS Pipeline RGD automated pipelines


 
Forward Primer AAGAGTGTCATGAAGCGTTAGG
Reverse Primer ACTGTCACATCAGGCTCCTC
 
GenBank Nucleotide AF096569 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


1 to 10 of 51 rows
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD ID
Symbol
Name
LOD
P Value
Trait
Sub Trait
Chr
Start
Stop
Species
1549845Scl44Serum cholesterol level QTL 446blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)540128307148607290Rat
8552960Pigfal15Plasma insulin-like growth factor 1 level QTL 15blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)5111416838156416838Rat
1300122Wbc1White blood cell count QTL 12.75leukocyte quantity (VT:0000217)total white blood cell count (CMO:0000365)5125392826139989768Rat
61452Ciaa5CIA Autoantibody QTL 53.5blood autoantibody amount (VT:0003725)calculated serum anti-rat type 2 collagen autoantibody titer (CMO:0001281)594858972143070159Rat
70156Niddm30Non-insulin dependent diabetes mellitus QTL 303.98blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)5129132447151006154Rat
7411582Foco3Food consumption QTL 37.50.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)587468046132468046Rat
7794791Mcs33Mammary carcinoma susceptibility QTL 331.93mammary gland integrity trait (VT:0010552)mammary tumor incidence/prevalence measurement (CMO:0000946)5131345754166875058Rat
1302790Scl20Serum cholesterol level QTL 206.40.0001blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)582394392166664054Rat
1598861Cm64Cardiac mass QTL 642.9heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)5127798274166875058Rat
1578766Tcas11Tongue tumor susceptibility QTL 114.12tongue integrity trait (VT:0010553)number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)546711509161317411Rat

1 to 10 of 51 rows


Note Type Note Reference