D2Mgh24 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D2Mgh24

Symbol: D2Mgh24
Previously known as: oxsts9032; R5881; 
RGD ID: 34497
Expected Size: 150 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.22135,552,383 - 135,552,573 (+)MAPPERmRatBN7.2
Rnor_6.02140,565,889 - 140,566,078NCBIRnor6.0
Rnor_5.02160,040,827 - 160,041,016UniSTSRnor5.0
RGSC_v3.42140,403,502 - 140,403,692RGDRGSC3.4
RGSC_v3.42140,403,503 - 140,403,692UniSTSRGSC3.4
RGSC_v3.12140,353,466 - 140,353,655RGD
Celera2130,047,867 - 130,048,056UniSTS
RH 3.4 Map2860.2UniSTS
RH 3.4 Map2860.2RGD
RH 2.0 Map2697.4RGD
Cytogenetic Map2 RGD
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BP/Cub   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MR/Pit   ODU/N   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   M520/N   ACI/N   BN-Lx/Cub   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd  
QTLs:   BpQTLCluster3   Cm49  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. UniSTS Pipeline RGD automated pipelines
4. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
5. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8
6. Electronic Submission of SSLP Data Sets Wilder R. Oct.2000. National Institute of Arthritis and Musculoskeletal and Skin Diseases, ARB Rat Genetic Database

Strains and Sequence

Sequence
 
Forward Primer CTTCTACAAGCTGCTCTCTGACC
Reverse Primer ACCTCCACATATGTACAAACATGC
 

Region

Nucleotide Sequences
GenBank Nucleotide CH474003 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000232 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


Additional Information

RGD Curation Notes
Note Type Note Reference
Database Acc Id Source(s)
NCBI Gene 100302847 UniSTS
  326501 UniSTS