DXMgh9 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: DXMgh9

Symbol: DXMgh9
Also known as: R3831; oxsts9246; 
RGD ID: 34192
Expected Size: 145 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2X65,612,192 - 65,612,337 (+)MAPPERmRatBN7.2
Rnor_6.0X70,352,120 - 70,352,264NCBIRnor6.0
Rnor_5.0X71,224,072 - 71,224,216UniSTSRnor5.0
RGSC_v3.4X88,514,168 - 88,514,313RGDRGSC3.4
RGSC_v3.4X88,514,169 - 88,514,313UniSTSRGSC3.4
RGSC_v3.1X88,587,601 - 88,587,746RGD
CeleraX65,971,600 - 65,971,744UniSTS
Cytogenetic MapX RGD
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   WN/N   M520/N   ACI/N   BN-Lx/Cub   GH/Omr   COP/OlaHsd  
QTLs:   Cia19   Bp56  


Annotation



Strains and Sequence

Sequence
 
Forward Primer GTTGTCTGGTGCCAAAAGGT
Reverse Primer AAGGATGATCTTAAGCTCCTGG
 
Strain Variation
Strain, Expected Size(s)
ACI/N132
AVN/Orl153
BBDP/Rhw132
BBDR/Rhw153
BC/CpbU147
BDIX/Han153
BDVII/Cub132
BN-Lx/Cub158
BN/SsNHsd158
BP/Cub132
BUF/Pit160
COP/OlaHsd132
DA/PitN152
DON/Melb155
F344/Pit155
FHH/Eur132
GH/Omr153
IS/Kyo147
LE/Mol153
LEW/Pit132
LH/Mav153
M520/N153
WN/N153


Region

Nucleotide Sequences
GenBank Nucleotide AC141377 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (Rnor_6.0)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
61430Cia18Collagen induced arthritis QTL 183.1joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)X15688119127888215Rat
1598837Memor13Memory QTL 133.2exploratory behavior trait (VT:0010471)difference between time of physical contact/close proximity of test subject and social stimulus during sample phase and test phase (CMO:0002678)X44320616158345622Rat
738035Stresp1Stress response QTL 14.960.000011stress-related behavior trait (VT:0010451)defensive burying - copingX44557974120045269Rat
70221Bp56Blood pressure QTL 564.9arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)X6139809770352120Rat
61431Cia19Collagen induced arthritis QTL 194.4joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)X70352120127888215Rat


Additional Information

RGD Curation Notes
Note Type Note Reference
Database Acc Id Source(s)
NCBI Gene 326439 UniSTS
  326547 UniSTS
UniSTS 122572 UniSTS