Symbol:
Tbp
Name:
TATA box binding protein
RGD ID:
68981
MGI Page
MGI
Description:
Enables RNA polymerase II cis-regulatory region sequence-specific DNA binding activity and RNA polymerase II-specific DNA-binding transcription factor binding activity. Acts upstream of or within transcription by RNA polymerase II and transcription by RNA polymerase III. Located in cytoplasm and nucleus. Part of RNA polymerase transcription factor SL1 complex and transcription factor TFIID complex. Is expressed in several structures, including central nervous system; early conceptus; genitourinary system; gut; and retina. Used to study spinocerebellar ataxia type 17. Human ortholog(s) of this gene implicated in late onset Parkinson's disease; schizophrenia; spinocerebellar ataxia type 17; and type 1 diabetes mellitus. Orthologous to human TBP (TATA-box binding protein).
Type:
protein-coding
RefSeq Status:
VALIDATED
Previously known as:
Gtf2d; GTF2D1; SCA17; TATA sequence-binding protein; TATA-binding factor; TATA-binding protein; TATA-box factor; TATA-box-binding protein; TFIID; TFIID core protein; transcription initiation factor TFIID TBP subunit
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Species
Gene symbol and name
Data Source
Assertion derived from
less info ...
Orthologs 1
Homo sapiens (human):
TBP (TATA-box binding protein) HGNC
EggNOG, Ensembl, HGNC, HomoloGene, Inparanoid, NCBI, OMA, OrthoDB, OrthoMCL, Panther, PhylomeDB, Treefam
Rattus norvegicus (Norway rat):
Tbp (TATA box binding protein) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chinchilla lanigera (long-tailed chinchilla):
Tbp (TATA-box binding protein) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Pan paniscus (bonobo/pygmy chimpanzee):
TBP (TATA-box binding protein) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Canis lupus familiaris (dog):
TBP (TATA-box binding protein) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Ictidomys tridecemlineatus (thirteen-lined ground squirrel):
Tbp (TATA-box binding protein) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Sus scrofa (pig):
TBP (TATA-box binding protein) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chlorocebus sabaeus (green monkey):
TBP (TATA-box binding protein) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Heterocephalus glaber (naked mole-rat):
Tbp (TATA-box binding protein) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Alliance orthologs 3
Rattus norvegicus (Norway rat):
Tbp (TATA box binding protein)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Homo sapiens (human):
TBP (TATA-box binding protein)
Alliance
DIOPT (Ensembl Compara|HGNC|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Danio rerio (zebrafish):
tbp (TATA box binding protein)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid|ZFIN)
Drosophila melanogaster (fruit fly):
Tbp
Alliance
DIOPT (Hieranoid|InParanoid|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Saccharomyces cerevisiae (baker's yeast):
SPT15
Alliance
DIOPT (Hieranoid|InParanoid|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Caenorhabditis elegans (roundworm):
tbp-1
Alliance
DIOPT (Hieranoid|InParanoid|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Drosophila melanogaster (fruit fly):
Trf
Alliance
DIOPT (Ensembl Compara|OrthoFinder|PANTHER)
Xenopus tropicalis (tropical clawed frog):
tbp
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Latest Assembly:
GRCm39 - Mouse Genome Assembly GRCm39
Position:
Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 17 15,720,150 - 15,737,689 (+) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 17 15,720,150 - 15,748,641 (+) Ensembl GRCm39 Ensembl GRCm38 17 15,499,888 - 15,517,427 (+) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 17 15,499,888 - 15,528,379 (+) Ensembl GRCm38 mm10 GRCm38 MGSCv37 17 15,636,852 - 15,654,391 (+) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 17 15,208,038 - 15,221,746 (+) NCBI MGSCv36 mm8 Celera 17 16,285,165 - 16,302,716 (+) NCBI Celera Cytogenetic Map 17 A2 NCBI cM Map 17 8.95 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Imported Annotations - KEGG (archival)
Molecular Function
aryl hydrocarbon receptor binding (IEA,ISO) core promoter sequence-specific DNA binding (ISO) DNA binding (IDA,ISO) DNA-binding transcription factor binding (ISO) enzyme binding (IEA,ISO) protein binding (IPI,ISO) RNA polymerase I core promoter sequence-specific DNA binding (ISO,ISS) RNA polymerase II cis-regulatory region sequence-specific DNA binding (IDA) RNA polymerase II core promoter sequence-specific DNA binding (IEA,ISO) RNA polymerase II general transcription initiation factor activity (IBA,IEA,ISO) RNA polymerase II general transcription initiation factor binding (ISO) RNA polymerase II-specific DNA-binding transcription factor binding (IPI) RNA polymerase III general transcription initiation factor activity (ISO,ISS) TFIIB-class transcription factor binding (IEA,ISO) transcription cis-regulatory region binding (ISO)
1.
Expanded trinucleotide repeats in the TBP/SCA17 gene mapped to chromosome 6q27 are associated with schizophrenia.
Chen CM, etal., Schizophr Res. 2005 Oct 15;78(2-3):131-6.
2.
increased Expression of TBP/TFIID after spinal cord injury in adult rats.
Ding T, etal., Cell Mol Neurobiol. 2014 Jul;34(5):669-77. doi: 10.1007/s10571-014-0048-7. Epub 2014 Apr 8.
3.
Cell growth- and differentiation-dependent regulation of RNA polymerase III transcription.
Dumay-Odelot H, etal., Cell Cycle. 2010 Sep 15;9(18):3687-99. Epub 2010 Sep 1.
4.
Structural insights into transcription initiation by RNA polymerase II.
Grunberg S and Hahn S, Trends Biochem Sci. 2013 Dec;38(12):603-11. doi: 10.1016/j.tibs.2013.09.002. Epub 2013 Oct 11.
5.
Neuronal expression of TATA box-binding protein containing expanded polyglutamine in knock-in mice reduces chaperone protein response by impairing the function of nuclear factor-Y transcription factor.
Huang S, etal., Brain. 2011 Jul;134(Pt 7):1943-58.
6.
A novel transgenic rat model for spinocerebellar ataxia type 17 recapitulates neuropathological changes and supplies in vivo imaging biomarkers.
Kelp A, etal., J Neurosci. 2013 May 22;33(21):9068-81. doi: 10.1523/JNEUROSCI.5622-12.2013.
7.
TFIIB-related factors in RNA polymerase I transcription.
Knutson BA and Hahn S, Biochim Biophys Acta. 2013 Mar-Apr;1829(3-4):265-73. doi: 10.1016/j.bbagrm.2012.08.003. Epub 2012 Aug 30.
8.
Structural bioinformatics of the general transcription factor TFIID.
Malkowska M, etal., Biochimie. 2013 Apr;95(4):680-91. doi: 10.1016/j.biochi.2012.10.024. Epub 2012 Nov 9.
9.
MGDs mouse GO annotations
MGD data from the GO Consortium
10.
SCA17, a novel autosomal dominant cerebellar ataxia caused by an expanded polyglutamine in TATA-binding protein.
Nakamura K, etal., Hum Mol Genet. 2001 Jul 1;10(14):1441-8.
11.
OMIM Disease Annotation Pipeline
OMIM Disease Annotation Pipeline
12.
Association of a CAG/CAA repeat sequence in the TBP gene with type I diabetes.
Owerbach D, etal., Biochem Biophys Res Commun. 2004 Oct 22;323(3):865-9.
13.
No evidence for association of the TATA-box binding protein glutamine repeat sequence or the flanking chromosome 6q27 region with type 1 diabetes.
Payne F, etal., Biochem Biophys Res Commun. 2005 Jun 3;331(2):435-41.
14.
KEGG Annotation Import Pipeline
Pipeline to import KEGG annotations from KEGG into RGD
15.
TBP, a polyglutamine tract containing protein, accumulates in Alzheimer's disease.
Reid SJ, etal., Brain Res Mol Brain Res. 2004 Jun 18;125(1-2):120-8.
16.
Mouse MP Annotation Import Pipeline
RGD automated import pipeline
17.
Data Import for Chemical-Gene Interactions
RGD automated import pipeline for gene-chemical interactions
18.
The presence of TATA-binding protein in the brainstem, correlated with sleep apnea in SIDS victims.
Sawaguchi T, etal., Early Hum Dev. 2003 Dec;75 Suppl:S109-18.
19.
Fundamental cellular processes do not require vertebrate-specific sequences within the TATA-binding protein.
Schmidt EE, etal., J Biol Chem 2003 Feb 21;278(8):6168-74. Epub 2002 Dec 5.
20.
RNA polymerase I activity is regulated at multiple steps in the transcription cycle: recent insights into factors that influence transcription elongation.
Schneider DA Gene. 2012 Feb 10;493(2):176-84. doi: 10.1016/j.gene.2011.08.006. Epub 2011 Aug 26.
21.
Inhibition of transcription by platinum antitumor compounds.
Todd RC and Lippard SJ, Metallomics. 2009;1(4):280-91. doi: 10.1039/b907567d.
22.
Insoluble TATA-binding protein accumulation in Huntington's disease cortex.
van Roon-Mom WM, etal., Brain Res Mol Brain Res. 2002 Dec 30;109(1-2):1-10.
23.
A structural perspective on RNA polymerase I and RNA polymerase III transcription machineries.
Vannini A Biochim Biophys Acta. 2013 Mar-Apr;1829(3-4):258-64. doi: 10.1016/j.bbagrm.2012.09.009. Epub 2012 Sep 29.
Tbp Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 17 15,720,150 - 15,737,689 (+) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 17 15,720,150 - 15,748,641 (+) Ensembl GRCm39 Ensembl GRCm38 17 15,499,888 - 15,517,427 (+) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 17 15,499,888 - 15,528,379 (+) Ensembl GRCm38 mm10 GRCm38 MGSCv37 17 15,636,852 - 15,654,391 (+) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 17 15,208,038 - 15,221,746 (+) NCBI MGSCv36 mm8 Celera 17 16,285,165 - 16,302,716 (+) NCBI Celera Cytogenetic Map 17 A2 NCBI cM Map 17 8.95 NCBI
TBP Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 6 170,554,369 - 170,572,859 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 6 170,554,302 - 170,572,870 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 6 170,863,457 - 170,881,947 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 6 170,705,396 - 170,723,872 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 6 170,781,102 - 170,799,578 NCBI Celera 6 171,658,683 - 171,677,210 (+) NCBI Celera Cytogenetic Map 6 q27 NCBI HuRef 6 168,368,477 - 168,387,004 (+) NCBI HuRef CHM1_1 6 171,124,696 - 171,144,174 (+) NCBI CHM1_1 T2T-CHM13v2.0 6 171,927,920 - 171,946,405 (+) NCBI T2T-CHM13v2.0
Tbp Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 1 65,136,420 - 65,153,515 (+) NCBI GRCr8 mRatBN7.2 1 56,463,330 - 56,480,430 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 1 56,463,618 - 56,510,016 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 1 61,312,927 - 61,329,705 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 1 69,976,468 - 69,993,260 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 1 63,222,896 - 63,239,688 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 1 57,491,381 - 57,509,335 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 1 57,491,643 - 57,508,449 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 1 58,419,943 - 58,438,618 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 1 54,390,756 - 54,407,563 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 1 54,393,700 - 54,410,507 (+) NCBI Celera 1 52,668,920 - 52,685,703 (+) NCBI Celera Cytogenetic Map 1 q12 NCBI
Tbp Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955411 3,268,147 - 3,285,077 (-) Ensembl ChiLan1.0 ChiLan1.0 NW_004955411 3,268,147 - 3,285,567 (-) NCBI ChiLan1.0 ChiLan1.0
TBP Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 5 190,831,188 - 190,849,739 (+) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 6 188,732,844 - 188,751,386 (+) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 6 168,714,214 - 168,732,744 (+) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 6 173,800,204 - 173,818,744 (+) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 6 173,800,240 - 173,826,909 (+) Ensembl panpan1.1 panPan2
TBP Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 12 72,458,959 - 72,479,271 (+) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 12 72,459,041 - 72,479,124 (+) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 12 72,221,201 - 72,241,583 (+) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 12 73,444,412 - 73,464,611 (+) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 12 73,441,852 - 73,464,514 (+) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 12 72,717,146 - 72,737,106 (+) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 12 72,539,334 - 72,559,523 (+) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 12 72,930,358 - 72,950,554 (+) NCBI UU_Cfam_GSD_1.0
Tbp
TBP
TBP Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 13 97,661,905 - 97,678,640 (-) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 13 97,660,864 - 97,681,497 (-) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666040 69,659,919 - 69,679,427 (-) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Tbp
.
Predicted Target Of
Count of predictions: 6219 Count of miRNA genes: 1056 Interacting mature miRNAs: 1642 Transcripts: ENSMUST00000014911, ENSMUST00000117593, ENSMUST00000118001, ENSMUST00000119879, ENSMUST00000143924, ENSMUST00000147081, ENSMUST00000149518, ENSMUST00000153480, ENSMUST00000155051, ENSMUST00000159197, ENSMUST00000162505 Prediction methods: Miranda, Pita, Pita,Targetscan, Rnahybrid, Targetscan Result types: miRGate_prediction
1558807 Ceat1_m chronic experimental autoimmune thyroiditis 1 (mouse) Not determined 17 12636682 26401133 Mouse 12910982 Pifs2_m peptide-induced fatal syndrome 2 (mouse) 17 1 26189355 Mouse 12910528 Nrq1_m noise-induced hearing loss resistant QTL 1 (mouse) 17 1 29198453 Mouse 1302100 Circp2_m circadian photosensitivity 2 (mouse) Not determined 17 1 29198453 Mouse 1300890 Bhr3_m bronchial hyperresponsiveness 3 (mouse) Not determined 17 3974890 48866091 Mouse 1357789 Kdnw3_m kidney weight 3 (mouse) Not determined 17 4854752 47885665 Mouse 1301338 Lmr1_m leishmaniasis resistance 1 (mouse) Not determined 17 10081340 86996400 Mouse 1300995 Fembrs4_m femur breaking strength 4 (mouse) Not determined 17 15061652 49061760 Mouse 4142507 Obrq13_m obesity resistance QTL 13 (mouse) Not determined 12198329 25076769 Mouse 1300613 Pcyts4_m plasmacytoma susceptibility 4 (mouse) Not determined 17 1 27081639 Mouse 4141608 Phl1_m progressive hearing loss 1 (mouse) Not determined 17 7875843 29487423 Mouse 1357452 Vtbt18_m vertebral trabecular bone trait 18 (mouse) Not determined 17 1 20975022 Mouse 1357902 Obq19_m obesity QTL 19 (mouse) Not determined 17 1 25662076 Mouse 1301327 Lmr7_m leishmaniasis resistance 7 (mouse) Not determined 17 4854752 27715939 Mouse 1302028 Asbb3_m autoimmune susceptibility in C57BL/6J and BALB/c 3 (mouse) Not determined 17 10878119 44878219 Mouse 4141215 Mnic1_m macronutrient intake, carbohydrate 1 (mouse) Not determined 4854752 45670266 Mouse 1300787 Cd8mts5_m CD8 memory T cell subset 5 (mouse) Not determined 17 8584914 42585149 Mouse 13524847 Asrq8a_m acoustic startle response 8a (mouse) 17 12646961 46646961 Mouse 1300914 Pcir4_m periosteal circumference 4 (mouse) Not determined 17 15061652 49061760 Mouse 14747010 Mancz14_m mandible centroid size 14 (mouse) 17 11998184 45998184 Mouse 1357680 Idd23_m insulin dependent diabetes susceptibility 23 (mouse) Not determined 17 3974890 26401133 Mouse 1302070 Tbbmd7_m total body bone mineral density 7 (mouse) Not determined 17 15061652 49061760 Mouse 1302196 Myaa1_m modifier of Yaa 1 (mouse) Not determined 17 1 20975022 Mouse 4141272 Tfv1_m total food volume 1 (mouse) Not determined 4854752 65637357 Mouse 10412276 Leci2_m leukocyte endothelial cell interactions 2 (mouse) Not determined 17 3348175 37348299 Mouse 1300706 Alan1_m alloantigen response 1 (mouse) Not determined 17 4854752 46469702 Mouse 1558886 Lgth9_m body length 9 (mouse) Not determined 17 15061652 49061760 Mouse 10043949 Pbft7_m percent body fat 7 (mouse) Not determined 17 6893936 40893936 Mouse 4141067 Hbnr2_m Heligmosomoides bakeri nematode resistance 2 (mouse) Not determined 11885971 45886119 Mouse 12904946 Tammq8_m tibialis anterior muscle mass QTL 8 (mouse) 17 12451787 46451787 Mouse 4142342 Lfnq4_m lung function QTL 4 (mouse) Not determined 11206484 39364059 Mouse 4142150 Stheal11_m soft tissue heal 11 (mouse) Not determined 17 12286211 83361768 Mouse 11081168 Tir7_m trypanosome infection response 7 (mouse) 17 14123372 48123496 Mouse 1357743 Lith3_m lithogenic gene 3 (mouse) Not determined 17 1 26194456 Mouse 12910527 Nrq1a_m noise-induced hearing loss resistant QTL 1a (mouse) 17 1 29198453 Mouse 1301615 Cfld3_m cystic fibrosis lung disease 3 (mouse) Not determined 17 1 27081639 Mouse 1301935 Skull24_m skull morphology 24 (mouse) Not determined 17 8584914 42585149 Mouse 13524851 Asrq8_m acoustic startle response 8 (mouse) 17 1 31030170 Mouse
AI528543
Mouse Assembly Chr Position (strand) Source JBrowse GRCm38 17 15,526,415 - 15,526,540 UniSTS GRCm38 MGSCv37 17 15,663,379 - 15,663,504 UniSTS GRCm37 Celera 17 16,311,700 - 16,311,825 UniSTS Cytogenetic Map 17 A2 UniSTS cM Map 17 8.26 UniSTS cM Map 17 8.25 UniSTS Whitehead/MRC_RH 17 216.66 UniSTS
Tbp
Mouse Assembly Chr Position (strand) Source JBrowse GRCm38 17 15,517,045 - 15,517,241 UniSTS GRCm38 MGSCv37 17 15,641,238 - 15,641,521 UniSTS GRCm37 MGSCv37 17 15,640,000 - 15,641,609 UniSTS GRCm37 Celera 17 16,302,334 - 16,302,530 UniSTS Cytogenetic Map 17 A2 UniSTS cM Map 17 8.25 UniSTS cM Map 17 8.25 UniSTS
PMC104364P2
Mouse Assembly Chr Position (strand) Source JBrowse GRCm38 17 15,513,565 - 15,514,300 UniSTS GRCm38 MGSCv37 17 15,650,529 - 15,651,264 UniSTS GRCm37 Celera 17 16,298,854 - 16,299,589 UniSTS Cytogenetic Map 17 A2 UniSTS cM Map 17 8.25 UniSTS
D17Jcs23
Mouse Assembly Chr Position (strand) Source JBrowse GRCm38 17 15,512,090 - 15,512,279 UniSTS GRCm38 MGSCv37 17 15,649,054 - 15,649,243 UniSTS GRCm37 Celera 17 16,297,367 - 16,297,568 UniSTS Cytogenetic Map 17 A2 UniSTS cM Map 17 UniSTS cM Map 17 8.25 UniSTS
Tbp
Mouse Assembly Chr Position (strand) Source JBrowse GRCm38 17 15,504,274 - 15,504,557 UniSTS GRCm38 MGSCv37 17 15,641,238 - 15,641,521 UniSTS GRCm37 Celera 17 16,289,551 - 16,289,834 UniSTS Cytogenetic Map 17 A2 UniSTS cM Map 17 8.25 UniSTS
Tbp
Mouse Assembly Chr Position (strand) Source JBrowse GRCm38 17 15,503,036 - 15,504,645 UniSTS GRCm38 MGSCv37 17 15,640,000 - 15,641,609 UniSTS GRCm37 Celera 17 16,288,313 - 16,289,922 UniSTS Cytogenetic Map 17 A2 UniSTS
Tbp
Mouse Assembly Chr Position (strand) Source JBrowse Cytogenetic Map 17 A2 UniSTS
Tbp
Mouse Assembly Chr Position (strand) Source JBrowse Cytogenetic Map 17 A2 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
Ensembl Acc Id:
ENSMUST00000014911 ⟹ ENSMUSP00000014911
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 17 15,720,150 - 15,737,689 (+) Ensembl GRCm38.p6 Ensembl 17 15,499,888 - 15,517,427 (+) Ensembl
Ensembl Acc Id:
ENSMUST00000117593 ⟹ ENSMUSP00000112794
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 17 15,720,222 - 15,737,689 (+) Ensembl GRCm38.p6 Ensembl 17 15,499,960 - 15,517,427 (+) Ensembl
Ensembl Acc Id:
ENSMUST00000118001 ⟹ ENSMUSP00000113999
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 17 15,720,172 - 15,737,689 (+) Ensembl GRCm38.p6 Ensembl 17 15,499,910 - 15,517,427 (+) Ensembl
Ensembl Acc Id:
ENSMUST00000119879 ⟹ ENSMUSP00000114007
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 17 15,720,184 - 15,734,634 (+) Ensembl GRCm38.p6 Ensembl 17 15,499,922 - 15,514,372 (+) Ensembl
Ensembl Acc Id:
ENSMUST00000143924 ⟹ ENSMUSP00000122696
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 17 15,720,174 - 15,727,621 (+) Ensembl GRCm38.p6 Ensembl 17 15,499,912 - 15,507,359 (+) Ensembl
Ensembl Acc Id:
ENSMUST00000147081 ⟹ ENSMUSP00000120484
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 17 15,720,163 - 15,727,716 (+) Ensembl GRCm38.p6 Ensembl 17 15,499,901 - 15,507,454 (+) Ensembl
Ensembl Acc Id:
ENSMUST00000149518
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 17 15,735,745 - 15,737,197 (+) Ensembl GRCm38.p6 Ensembl 17 15,515,483 - 15,516,935 (+) Ensembl
Ensembl Acc Id:
ENSMUST00000153480
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 17 15,724,845 - 15,737,130 (+) Ensembl GRCm38.p6 Ensembl 17 15,504,583 - 15,516,868 (+) Ensembl
Ensembl Acc Id:
ENSMUST00000155051 ⟹ ENSMUSP00000117551
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 17 15,720,190 - 15,724,709 (+) Ensembl GRCm38.p6 Ensembl 17 15,499,928 - 15,504,447 (+) Ensembl
Ensembl Acc Id:
ENSMUST00000159197 ⟹ ENSMUSP00000125691
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 17 15,720,150 - 15,724,867 (+) Ensembl GRCm38.p6 Ensembl 17 15,499,888 - 15,504,605 (+) Ensembl
Ensembl Acc Id:
ENSMUST00000162505 ⟹ ENSMUSP00000124317
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 17 15,720,150 - 15,748,641 (+) Ensembl GRCm38.p6 Ensembl 17 15,499,888 - 15,528,379 (+) Ensembl
Ensembl Acc Id:
ENSMUST00000232661
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 17 15,723,251 - 15,725,086 (+) Ensembl GRCm38.p6 Ensembl 17 15,502,989 - 15,504,824 (+) Ensembl
RefSeq Acc Id:
NM_013684 ⟹ NP_038712
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 17 15,720,150 - 15,737,689 (+) NCBI GRCm38 17 15,499,888 - 15,517,427 (+) ENTREZGENE MGSCv37 17 15,636,852 - 15,654,391 (+) RGD Celera 17 16,285,165 - 16,302,716 (+) RGD cM Map 17 ENTREZGENE
Sequence:
AAGAGCGCAACTGGCGGAAGTGACGGCATCAGATGTGCGTCAGGCGTTCGGTGGATCGAGTCCGGTAGCGGTGGCGGGTATCTGCTGGCGGTTTGGCTAGGTTTCTGCGGTCGCGTCATTTTCTCCGC
hide sequence
RefSeq Acc Id:
NP_038712 ⟸ NM_013684
- UniProtKB:
Q80UL8 (UniProtKB/Swiss-Prot), O09169 (UniProtKB/Swiss-Prot), Q8C3S1 (UniProtKB/Swiss-Prot), P29037 (UniProtKB/Swiss-Prot), Q6RI65 (UniProtKB/TrEMBL)
- Sequence:
MDQNNSLPPYAQGLASPQGAMTPGIPIFSPMMPYGTGLTPQPIQNTNSLSILEEQQRQQQQQQQQQQQQQAVATAAASVQQSTSQQPTQGASGQTPQLFHSQTLTTAPLPGTTPLYPSPMTPMTPITP
hide sequence
Ensembl Acc Id:
ENSMUSP00000125691 ⟸ ENSMUST00000159197
Ensembl Acc Id:
ENSMUSP00000114007 ⟸ ENSMUST00000119879
Ensembl Acc Id:
ENSMUSP00000113999 ⟸ ENSMUST00000118001
Ensembl Acc Id:
ENSMUSP00000122696 ⟸ ENSMUST00000143924
Ensembl Acc Id:
ENSMUSP00000120484 ⟸ ENSMUST00000147081
Ensembl Acc Id:
ENSMUSP00000014911 ⟸ ENSMUST00000014911
Ensembl Acc Id:
ENSMUSP00000124317 ⟸ ENSMUST00000162505
Ensembl Acc Id:
ENSMUSP00000112794 ⟸ ENSMUST00000117593
Ensembl Acc Id:
ENSMUSP00000117551 ⟸ ENSMUST00000155051
RGD ID: 13674830 Promoter ID: EPDNEW_M21564 Type: initiation region Name: Tbp_1 Description: Mus musculus TATA box binding protein , mRNA. SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Mouse Assembly Chr Position (strand) Source GRCm38 17 15,499,915 - 15,499,975 EPDNEW
RGD ID: 6828754 Promoter ID: MM_KWN:22228 Type: CpG-Island SO ACC ID: SO:0000170 Source: MPROMDB Tissues & Cell Lines: 3T3L1_Day0, 3T3L1_Day1, 3T3L1_Day2, 3T3L1_Day3, 3T3L1_Day4, 3T3L1_Day6, BoneMarrow_0Hour, BoneMarrow_2Hour, BoneMarrow_4Hour, Brain, ES_Cell, Kidney, Liver, Lung, MEF_B4, MEF_B6, Spleen Transcripts: ENSMUST00000080441, ENSMUST00000117593, ENSMUST00000118001, NM_013684, OTTMUST00000075648, OTTMUST00000075649, OTTMUST00000075650, UC008AON.1 Position: Mouse Assembly Chr Position (strand) Source MGSCv36 17 15,636,526 - 15,637,026 (+) MPROMDB
