Symbol:
Pik3cb
Name:
phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit beta
RGD ID:
620917
Description:
Enables 1-phosphatidylinositol-3-kinase activity. Involved in phosphatidylinositol phosphate biosynthetic process. Located in brush border membrane. Part of phosphatidylinositol 3-kinase complex. Used to study thrombosis. Biomarker of hepatocellular carcinoma. Human ortholog(s) of this gene implicated in glioblastoma; prostate adenocarcinoma; prostate cancer; and type 2 diabetes mellitus. Orthologous to human PIK3CB (phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit beta); PARTICIPATES IN epidermal growth factor/neuregulin signaling pathway; FasL mediated signaling pathway; phosphatidylinositol 3-kinase class I signaling pathway; INTERACTS WITH 17beta-estradiol; 2,6-dinitrotoluene; allethrin.
Type:
protein-coding
RefSeq Status:
VALIDATED
Previously known as:
catalytic phosphatidylinositol 3-kinase beta; LOC100910021; p110beta; phosphatidylinositol 3-kinase catalytic subunit beta isoform; phosphatidylinositol 3-kinase, catalytic subunit, beta isoform; phosphatidylinositol 3-kinase, catalytic, beta polypeptide; phosphatidylinositol 4,5-bisphosphate 3-kinase 110 kDa catalytic subunit beta; phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit beta isoform; phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit beta isoform-like; phosphatidylinositol-4,5-bisphosphate 3-kinase 110 kDa catalytic subunit beta; phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit beta isoform; phosphoinositide-3-kinase, catalytic, beta polypeptide; PI3-kinase p110 subunit beta; PI3-kinase subunit beta; PI3K; PI3K-beta; PI3Kbeta; ptdIns-3-kinase p110; ptdIns-3-kinase subunit beta; ptdIns-3-kinase subunit p110-beta; serine/threonine protein kinase PIK3CB
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Species
Gene symbol and name
Data Source
Assertion derived from
less info ...
Orthologs 1
Homo sapiens (human):
PIK3CB (phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit beta) HGNC
EggNOG, HomoloGene, Inparanoid, NCBI, OMA, OrthoDB, OrthoMCL, Panther, Treefam
Mus musculus (house mouse):
Pik3cb (phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit beta) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chinchilla lanigera (long-tailed chinchilla):
Pik3cb (phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit beta) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Pan paniscus (bonobo/pygmy chimpanzee):
PIK3CB (phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit beta) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Canis lupus familiaris (dog):
PIK3CB (phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit beta) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Ictidomys tridecemlineatus (thirteen-lined ground squirrel):
Pik3cb (phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit beta) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Sus scrofa (pig):
PIK3CB (phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit beta) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chlorocebus sabaeus (green monkey):
PIK3CB (phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit beta) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Heterocephalus glaber (naked mole-rat):
Pik3cb (phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit beta) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Other homologs 2
Homo sapiens (human):
TAAR5 (trace amine associated receptor 5) HGNC
OMA
Alliance orthologs 3
Homo sapiens (human):
PIK3CB (phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit beta)
Alliance
DIOPT (Ensembl Compara|HGNC|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Mus musculus (house mouse):
Pik3cb (phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit beta)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Danio rerio (zebrafish):
pik3cb (phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit beta)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Caenorhabditis elegans (roundworm):
age-1
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OrthoFinder|PANTHER|SonicParanoid)
Drosophila melanogaster (fruit fly):
Pi3K92E
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Xenopus tropicalis (tropical clawed frog):
pik3cb
Alliance
DIOPT (Ensembl Compara|OMA|OrthoFinder|PANTHER|PhylomeDB)
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 8 108,474,017 - 108,579,140 (-) NCBI GRCr8 mRatBN7.2 8 99,594,600 - 99,699,772 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 8 99,594,644 - 99,699,663 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 8 105,261,003 - 105,332,672 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 8 103,460,307 - 103,531,975 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 8 101,302,802 - 101,374,469 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 8 107,275,849 - 107,381,088 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 8 107,275,725 - 107,380,933 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 8 106,700,158 - 106,788,063 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 8 103,886,682 - 103,957,112 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 8 103,906,136 - 103,976,567 (-) NCBI Celera 8 99,000,434 - 99,072,100 (-) NCBI Celera Cytogenetic Map 8 q31 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Pik3cb Rat (-)-alpha-phellandrene increases expression ISO PIK3CB (Homo sapiens) 6480464 alpha phellandrene results in increased expression of PIK3CB mRNA CTD PMID:25075043 Pik3cb Rat (-)-epigallocatechin 3-gallate multiple interactions ISO PIK3CB (Homo sapiens) 6480464 [potassium chromate(VI) co-treated with epigallocatechin gallate] results in decreased expression of PIK3CB mRNA CTD PMID:22079256 Pik3cb Rat 1,2-dimethylhydrazine decreases expression ISO Pik3cb (Mus musculus) 6480464 1 and 2-Dimethylhydrazine results in decreased expression of PIK3CB mRNA CTD PMID:22206623 Pik3cb Rat 17beta-estradiol decreases expression EXP 6480464 Estradiol results in decreased expression of PIK3CB mRNA CTD PMID:32145629 Pik3cb Rat 17beta-estradiol decreases expression ISO Pik3cb (Mus musculus) 6480464 Estradiol results in decreased expression of PIK3CB mRNA CTD PMID:39298647 Pik3cb Rat 2,2',4,4'-Tetrabromodiphenyl ether decreases expression ISO PIK3CB (Homo sapiens) 6480464 2 more ... CTD PMID:31675489 Pik3cb Rat 2,3',4,4',5-Pentachlorobiphenyl increases expression ISO Pik3cb (Mus musculus) 6480464 2 more ... CTD PMID:31388691 Pik3cb Rat 2,3,7,8-tetrachlorodibenzodioxine multiple interactions ISO Pik3cb (Mus musculus) 6480464 Tetrachlorodibenzodioxin promotes the reaction [AHR protein binds to PIK3CB promoter] CTD PMID:19654925 Pik3cb Rat 2,3,7,8-tetrachlorodibenzodioxine decreases expression ISO PIK3CB (Homo sapiens) 6480464 Tetrachlorodibenzodioxin results in decreased expression of PIK3CB mRNA CTD PMID:21632981 Pik3cb Rat 2,3,7,8-tetrachlorodibenzodioxine affects expression ISO Pik3cb (Mus musculus) 6480464 Tetrachlorodibenzodioxin affects the expression of PIK3CB mRNA CTD PMID:21570461 Pik3cb Rat 2,6-dinitrotoluene affects expression EXP 6480464 2 and 6-dinitrotoluene affects the expression of PIK3CB mRNA CTD PMID:21346803 Pik3cb Rat 3,3',5,5'-tetrabromobisphenol A decreases expression ISO PIK3CB (Homo sapiens) 6480464 tetrabromobisphenol A results in decreased expression of PIK3CB protein CTD PMID:31675489 Pik3cb Rat 3-methylcholanthrene multiple interactions ISO Pik3cb (Mus musculus) 6480464 [Methylcholanthrene co-treated with Tetradecanoylphorbol Acetate] results in increased expression of PIK3CB mRNA CTD PMID:23519560 Pik3cb Rat 4,4'-sulfonyldiphenol decreases expression ISO Pik3cb (Mus musculus) 6480464 bisphenol S results in decreased expression of PIK3CB mRNA CTD PMID:39298647 Pik3cb Rat 4-hydroxynon-2-enal increases expression ISO Pik3cb (Mus musculus) 6480464 4-hydroxy-2-nonenal results in increased expression of PIK3CB mRNA CTD PMID:19191707 Pik3cb Rat all-trans-retinoic acid multiple interactions ISO PIK3CB (Homo sapiens) 6480464 LE 540 inhibits the reaction [Tretinoin results in increased expression of and results in increased activity of PIK3CB protein] and Tretinoin results in increased expression of and results in increased activity of PIK3CB protein CTD PMID:16043647 Pik3cb Rat all-trans-retinoic acid decreases expression ISO PIK3CB (Homo sapiens) 6480464 Tretinoin results in decreased expression of PIK3CB mRNA CTD PMID:15498508 Pik3cb Rat all-trans-retinoic acid increases expression ISO PIK3CB (Homo sapiens) 6480464 Tretinoin results in increased expression of PIK3CB mRNA CTD PMID:16043647 and PMID:33167477 Pik3cb Rat allethrin multiple interactions EXP 6480464 [cypermethrin co-treated with decamethrin co-treated with fenvalerate co-treated with cyhalothrin co-treated with Allethrins] results in decreased expression of PIK3CB protein CTD PMID:34896426 Pik3cb Rat alpha-phellandrene increases expression ISO PIK3CB (Homo sapiens) 6480464 alpha phellandrene results in increased expression of PIK3CB mRNA CTD PMID:25075043 Pik3cb Rat aristolochic acid A decreases expression ISO PIK3CB (Homo sapiens) 6480464 aristolochic acid I results in decreased expression of PIK3CB mRNA CTD PMID:33212167 Pik3cb Rat aristolochic acid A multiple interactions EXP 6480464 Grape Seed Proanthocyanidins inhibits the reaction [aristolochic acid I results in decreased expression of PIK3CB mRNA] CTD PMID:35850572 Pik3cb Rat aristolochic acid A decreases expression EXP 6480464 aristolochic acid I results in decreased expression of PIK3CB mRNA CTD PMID:35850572 Pik3cb Rat arsane multiple interactions ISO PIK3CB (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in decreased expression of PIK3CB mRNA and [sodium arsenite results in increased abundance of Arsenic] which results in decreased expression of PIK3CB mRNA CTD PMID:39836092 Pik3cb Rat arsenic atom multiple interactions ISO PIK3CB (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in decreased expression of PIK3CB mRNA and [sodium arsenite results in increased abundance of Arsenic] which results in decreased expression of PIK3CB mRNA CTD PMID:39836092 Pik3cb Rat arsenite(3-) multiple interactions ISO PIK3CB (Homo sapiens) 6480464 arsenite inhibits the reaction [G3BP1 protein binds to PIK3CB mRNA] CTD PMID:32406909 Pik3cb Rat arsenous acid decreases expression ISO PIK3CB (Homo sapiens) 6480464 Arsenic Trioxide results in decreased expression of PIK3CB protein CTD PMID:34042274 Pik3cb Rat benzo[a]pyrene decreases expression ISO PIK3CB (Homo sapiens) 6480464 Benzo(a)pyrene results in decreased expression of PIK3CB mRNA CTD PMID:20064835 more ... Pik3cb Rat benzo[a]pyrene increases methylation ISO Pik3cb (Mus musculus) 6480464 Benzo(a)pyrene results in increased methylation of PIK3CB exon and Benzo(a)pyrene results in increased methylation of PIK3CB intron CTD PMID:27901495 Pik3cb Rat benzo[a]pyrene increases expression ISO PIK3CB (Homo sapiens) 6480464 Benzo(a)pyrene metabolite results in increased expression of PIK3CB mRNA CTD PMID:26314263 Pik3cb Rat benzo[a]pyrene diol epoxide I decreases expression ISO PIK3CB (Homo sapiens) 6480464 7 more ... CTD PMID:19150397 Pik3cb Rat Benzo[k]fluoranthene decreases expression ISO Pik3cb (Mus musculus) 6480464 benzo(k)fluoranthene results in decreased expression of PIK3CB mRNA CTD PMID:26377693 Pik3cb Rat beta-lapachone decreases expression ISO PIK3CB (Homo sapiens) 6480464 beta-lapachone results in decreased expression of PIK3CB mRNA CTD PMID:38218311 Pik3cb Rat beta-lapachone increases expression ISO PIK3CB (Homo sapiens) 6480464 beta-lapachone results in increased expression of PIK3CB mRNA CTD PMID:38218311 Pik3cb Rat bexarotene increases expression EXP 6480464 bexarotene results in increased expression of PIK3CB mRNA CTD PMID:16648578 Pik3cb Rat bis(2-ethylhexyl) phthalate increases expression ISO Pik3cb (Mus musculus) 6480464 Diethylhexyl Phthalate results in increased expression of PIK3CB mRNA CTD PMID:34319233 Pik3cb Rat bisphenol A affects expression EXP 6480464 bisphenol A affects the expression of PIK3CB mRNA CTD PMID:25181051 and PMID:32145629 Pik3cb Rat bisphenol A decreases methylation ISO PIK3CB (Homo sapiens) 6480464 bisphenol A results in decreased methylation of PIK3CB gene CTD PMID:31601247 Pik3cb Rat bisphenol A multiple interactions ISO PIK3CB (Homo sapiens) 6480464 [bisphenol A co-treated with Fulvestrant] affects the methylation of PIK3CB gene CTD PMID:31601247 Pik3cb Rat bisphenol A decreases expression ISO PIK3CB (Homo sapiens) 6480464 bisphenol A results in decreased expression of PIK3CB protein CTD PMID:31675489 Pik3cb Rat bisphenol A decreases expression EXP 6480464 bisphenol A results in decreased expression of PIK3CB mRNA CTD PMID:34947998 Pik3cb Rat cadmium dichloride increases expression ISO PIK3CB (Homo sapiens) 6480464 Cadmium Chloride results in increased expression of PIK3CB mRNA CTD PMID:38568856 Pik3cb Rat calcium atom affects transport EXP 6480464 PIK3CB protein affects the transport of Calcium CTD PMID:11597992 Pik3cb Rat calcium(0) affects transport EXP 6480464 PIK3CB protein affects the transport of Calcium CTD PMID:11597992 Pik3cb Rat cannabidiol multiple interactions ISO PIK3CB (Homo sapiens) 6480464 [Cannabidiol co-treated with moringin] results in decreased expression of PIK3CB mRNA and [Oxygen co-treated with Ozone co-treated with Cannabidiol] results in decreased expression of PIK3CB mRNA CTD PMID:30096889 and PMID:32992648 Pik3cb Rat cannabidiol increases expression ISO PIK3CB (Homo sapiens) 6480464 Cannabidiol results in increased expression of PIK3CB mRNA CTD PMID:27918106 more ... Pik3cb Rat capecitabine multiple interactions ISO PIK3CB (Homo sapiens) 151893289 capecitabine decreases expression and phosphorylation of PIK3CB protein in colon RGD Pik3cb Rat cobalt dichloride increases expression ISO PIK3CB (Homo sapiens) 6480464 cobaltous chloride results in increased expression of PIK3CB mRNA CTD PMID:26314263 Pik3cb Rat copper atom multiple interactions ISO PIK3CB (Homo sapiens) 6480464 [Chelating Agents binds to Copper] which results in increased expression of PIK3CB mRNA CTD PMID:30911355 Pik3cb Rat copper(0) multiple interactions ISO PIK3CB (Homo sapiens) 6480464 [Chelating Agents binds to Copper] which results in increased expression of PIK3CB mRNA CTD PMID:30911355 Pik3cb Rat copper(II) sulfate decreases expression ISO PIK3CB (Homo sapiens) 6480464 Copper Sulfate results in decreased expression of PIK3CB mRNA CTD PMID:19549813 Pik3cb Rat crocidolite asbestos affects expression ISO PIK3CB (Homo sapiens) 6480464 Asbestos and Crocidolite affects the expression of PIK3CB mRNA CTD PMID:17331233 Pik3cb Rat cyclosporin A increases expression ISO PIK3CB (Homo sapiens) 6480464 Cyclosporine results in increased expression of PIK3CB mRNA CTD PMID:25562108 Pik3cb Rat cyhalothrin multiple interactions EXP 6480464 [cypermethrin co-treated with decamethrin co-treated with fenvalerate co-treated with cyhalothrin co-treated with Allethrins] results in decreased expression of PIK3CB protein CTD PMID:34896426 Pik3cb Rat cypermethrin multiple interactions EXP 6480464 [cypermethrin co-treated with decamethrin co-treated with fenvalerate co-treated with cyhalothrin co-treated with Allethrins] results in decreased expression of PIK3CB protein CTD PMID:34896426 Pik3cb Rat decabromodiphenyl ether decreases expression ISO PIK3CB (Homo sapiens) 6480464 decabromobiphenyl ether results in decreased expression of PIK3CB protein CTD PMID:31675489 Pik3cb Rat dexamethasone multiple interactions ISO Pik3cb (Mus musculus) 6480464 Dexamethasone inhibits the reaction [lipopolysaccharide and Escherichia coli O111 B4 results in increased phosphorylation of PIK3CB protein] CTD PMID:38729284 Pik3cb Rat diarsenic trioxide decreases expression ISO PIK3CB (Homo sapiens) 6480464 Arsenic Trioxide results in decreased expression of PIK3CB protein CTD PMID:34042274 Pik3cb Rat Dibutyl phosphate affects expression ISO PIK3CB (Homo sapiens) 6480464 di-n-butylphosphoric acid affects the expression of PIK3CB mRNA CTD PMID:37042841 Pik3cb Rat dibutyl phthalate increases expression ISO Pik3cb (Mus musculus) 6480464 Dibutyl Phthalate results in increased expression of PIK3CB mRNA CTD PMID:17361019 and PMID:21266533 Pik3cb Rat dibutyl phthalate multiple interactions ISO Pik3cb (Mus musculus) 6480464 Dibutyl Phthalate promotes the reaction [[Streptozocin co-treated with Dietary Fats] results in decreased expression of PIK3CB protein] and L 783281 inhibits the reaction [Dibutyl Phthalate promotes the reaction [[Streptozocin co-treated with Dietary Fats] results in decreased expression of PIK3CB protein]] CTD PMID:29526571 Pik3cb Rat dioscin decreases expression ISO PIK3CB (Homo sapiens) 6480464 dioscin results in decreased expression of PIK3CB mRNA CTD PMID:29990575 Pik3cb Rat dioxygen multiple interactions ISO PIK3CB (Homo sapiens) 6480464 [Oxygen co-treated with Ozone co-treated with Cannabidiol] results in decreased expression of PIK3CB mRNA and [Oxygen co-treated with Ozone] results in decreased expression of PIK3CB mRNA CTD PMID:32992648 Pik3cb Rat Doramectin decreases expression EXP 6480464 doramectin results in decreased expression of PIK3CB mRNA CTD PMID:35137919 Pik3cb Rat dorsomorphin multiple interactions ISO PIK3CB (Homo sapiens) 6480464 [NOG protein co-treated with entinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of PIK3CB mRNA CTD PMID:27188386 Pik3cb Rat doxorubicin decreases expression ISO PIK3CB (Homo sapiens) 6480464 Doxorubicin results in decreased expression of PIK3CB mRNA CTD PMID:29803840 Pik3cb Rat entinostat increases expression ISO PIK3CB (Homo sapiens) 6480464 entinostat results in increased expression of PIK3CB mRNA CTD PMID:26272509 Pik3cb Rat entinostat multiple interactions ISO PIK3CB (Homo sapiens) 6480464 [NOG protein co-treated with entinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of PIK3CB mRNA CTD PMID:27188386 Pik3cb Rat ethanol increases expression EXP 6480464 Ethanol results in increased expression of PIK3CB mRNA CTD PMID:20655511 Pik3cb Rat ethanol affects splicing ISO Pik3cb (Mus musculus) 6480464 Ethanol affects the splicing of PIK3CB mRNA CTD PMID:30319688 Pik3cb Rat fenthion decreases expression ISO Pik3cb (Mus musculus) 6480464 Fenthion results in decreased expression of PIK3CB mRNA CTD PMID:34813904 Pik3cb Rat fenvalerate multiple interactions EXP 6480464 [cypermethrin co-treated with decamethrin co-treated with fenvalerate co-treated with cyhalothrin co-treated with Allethrins] results in decreased expression of PIK3CB protein CTD PMID:34896426 Pik3cb Rat Forsythiaside multiple interactions ISO Pik3cb (Mus musculus) 6480464 [2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one co-treated with forsythiaside] inhibits the reaction [lipopolysaccharide more ... CTD PMID:38729284 Pik3cb Rat fulvestrant increases methylation ISO PIK3CB (Homo sapiens) 6480464 Fulvestrant results in increased methylation of PIK3CB gene CTD PMID:31601247 Pik3cb Rat fulvestrant multiple interactions ISO PIK3CB (Homo sapiens) 6480464 [bisphenol A co-treated with Fulvestrant] affects the methylation of PIK3CB gene CTD PMID:31601247 Pik3cb Rat gentamycin increases expression EXP 6480464 Gentamicins results in increased expression of PIK3CB mRNA CTD PMID:33387578 Pik3cb Rat idelalisib multiple interactions ISO Pik3cb (Mus musculus) 6480464 idelalisib inhibits the reaction [TGFB1 protein results in increased expression of PIK3CB mRNA] CTD PMID:31522336 Pik3cb Rat idelalisib increases expression ISO Pik3cb (Mus musculus) 6480464 idelalisib results in increased expression of PIK3CB mRNA CTD PMID:31522336 Pik3cb Rat isoflurane decreases expression EXP 597931096 isoflurane decreases expression of PI3K mRNA and protein in hippocampus RGD Pik3cb Rat lead(0) affects expression ISO PIK3CB (Homo sapiens) 6480464 Lead affects the expression of PIK3CB mRNA CTD PMID:28903495 Pik3cb Rat LY294002 decreases activity ISO Pik3cb (Mus musculus) 6480464 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one results in decreased activity of PIK3CB protein CTD PMID:16179367 Pik3cb Rat LY294002 multiple interactions ISO PIK3CB (Homo sapiens) 6480464 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one promotes the reaction [fosbretabulin analog results in decreased expression of PIK3CB protein] CTD PMID:35122754 Pik3cb Rat LY294002 decreases expression ISO PIK3CB (Homo sapiens) 6480464 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one analog results in decreased expression of PIK3CB protein CTD PMID:35122754 Pik3cb Rat LY294002 multiple interactions ISO Pik3cb (Mus musculus) 6480464 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one inhibits the reaction [lipopolysaccharide more ... CTD PMID:31522336 and PMID:38729284 Pik3cb Rat LY294002 increases expression ISO Pik3cb (Mus musculus) 6480464 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one results in increased expression of PIK3CB mRNA CTD PMID:31522336 Pik3cb Rat manganese atom multiple interactions ISO PIK3CB (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in decreased expression of PIK3CB mRNA and [manganese chloride results in increased abundance of Manganese] which results in decreased expression of PIK3CB mRNA CTD PMID:39836092 Pik3cb Rat manganese(0) multiple interactions ISO PIK3CB (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in decreased expression of PIK3CB mRNA and [manganese chloride results in increased abundance of Manganese] which results in decreased expression of PIK3CB mRNA CTD PMID:39836092 Pik3cb Rat manganese(II) chloride multiple interactions ISO PIK3CB (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in decreased expression of PIK3CB mRNA and [manganese chloride results in increased abundance of Manganese] which results in decreased expression of PIK3CB mRNA CTD PMID:39836092 Pik3cb Rat metformin multiple interactions ISO PIK3CB (Homo sapiens) 6480464 [Metformin co-treated with Pioglitazone] results in decreased expression of PIK3CB mRNA CTD PMID:32589349 Pik3cb Rat methidathion decreases expression ISO Pik3cb (Mus musculus) 6480464 methidathion results in decreased expression of PIK3CB mRNA CTD PMID:34813904 Pik3cb Rat methylmercury(1+) increases expression ISO PIK3CB (Homo sapiens) 6480464 methylmercury II results in increased expression of PIK3CB mRNA CTD PMID:26314263 Pik3cb Rat microcystin-LR multiple interactions ISO Pik3cb (Mus musculus) 6480464 Wortmannin inhibits the reaction [cyanoginosin LR results in increased expression of PIK3CB protein] CTD PMID:36288207 Pik3cb Rat microcystin-LR increases expression ISO Pik3cb (Mus musculus) 6480464 cyanoginosin LR results in increased expression of PIK3CB protein CTD PMID:36288207 Pik3cb Rat minocycline multiple interactions ISO Pik3cb (Mus musculus) 6480464 Minocycline inhibits the reaction [Paraquat results in increased expression of PIK3CB protein] CTD PMID:38189626 Pik3cb Rat morin increases expression ISO PIK3CB (Homo sapiens) 6480464 morin results in increased expression of PIK3CB mRNA CTD PMID:28689916 Pik3cb Rat N,N-diethyl-m-toluamide multiple interactions EXP 6480464 [Permethrin co-treated with DEET] results in increased methylation of PIK3CB gene CTD PMID:33148267 Pik3cb Rat N-nitrosodiethylamine increases expression EXP 152177911 N-nitrosodiethylamine increases expression of PI3Kc/b protein in liver in rats RGD Pik3cb Rat ochratoxin A increases expression ISO PIK3CB (Homo sapiens) 6480464 ochratoxin A metabolite results in increased expression of PIK3CB mRNA and ochratoxin A results in increased expression of PIK3CB mRNA CTD PMID:26314263 Pik3cb Rat ozone multiple interactions ISO PIK3CB (Homo sapiens) 6480464 [Oxygen co-treated with Ozone co-treated with Cannabidiol] results in decreased expression of PIK3CB mRNA and [Oxygen co-treated with Ozone] results in decreased expression of PIK3CB mRNA CTD PMID:32992648 Pik3cb Rat paracetamol increases expression EXP 6480464 Acetaminophen results in increased expression of PIK3CB mRNA CTD PMID:33387578 Pik3cb Rat paraquat increases expression ISO Pik3cb (Mus musculus) 6480464 Paraquat results in increased expression of PIK3CB protein CTD PMID:38189626 Pik3cb Rat paraquat multiple interactions ISO Pik3cb (Mus musculus) 6480464 Minocycline inhibits the reaction [Paraquat results in increased expression of PIK3CB protein] CTD PMID:38189626 Pik3cb Rat permethrin multiple interactions EXP 6480464 [Permethrin co-treated with DEET] results in increased methylation of PIK3CB gene CTD PMID:33148267 Pik3cb Rat phenobarbital affects expression ISO Pik3cb (Mus musculus) 6480464 Phenobarbital affects the expression of PIK3CB mRNA CTD PMID:23091169 Pik3cb Rat phorbol 13-acetate 12-myristate multiple interactions ISO Pik3cb (Mus musculus) 6480464 [Methylcholanthrene co-treated with Tetradecanoylphorbol Acetate] results in increased expression of PIK3CB mRNA CTD PMID:23519560 Pik3cb Rat pioglitazone multiple interactions ISO PIK3CB (Homo sapiens) 6480464 [Metformin co-treated with Pioglitazone] results in decreased expression of PIK3CB mRNA CTD PMID:32589349 Pik3cb Rat potassium chromate decreases expression ISO PIK3CB (Homo sapiens) 6480464 potassium chromate(VI) results in decreased expression of PIK3CB mRNA CTD PMID:22079256 Pik3cb Rat potassium chromate multiple interactions ISO PIK3CB (Homo sapiens) 6480464 [potassium chromate(VI) co-treated with epigallocatechin gallate] results in decreased expression of PIK3CB mRNA CTD PMID:22079256 Pik3cb Rat pyrethrins decreases expression EXP 6480464 Pyrethrins results in decreased expression of PIK3CB protein CTD PMID:34896426 Pik3cb Rat resveratrol multiple interactions ISO PIK3CB (Homo sapiens) 6480464 resveratrol results in decreased activity of [PIK3R1 protein binds to PIK3CB protein] CTD PMID:17550345 Pik3cb Rat resveratrol decreases expression ISO PIK3CB (Homo sapiens) 6480464 resveratrol results in decreased expression of PIK3CB mRNA CTD PMID:25667456 Pik3cb Rat resveratrol multiple interactions EXP 6480464 resveratrol inhibits the reaction [Streptozocin results in decreased expression of PIK3CB mRNA] CTD PMID:26071184 Pik3cb Rat SB 431542 multiple interactions ISO PIK3CB (Homo sapiens) 6480464 [NOG protein co-treated with entinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of PIK3CB mRNA CTD PMID:27188386 Pik3cb Rat Sinomenine multiple interactions ISO PIK3CB (Homo sapiens) 6480464 sinomenine inhibits the reaction [TGFB1 protein results in increased expression of PIK3CB mRNA] and sinomenine inhibits the reaction [TGFB1 protein results in increased phosphorylation of PIK3CB protein] CTD PMID:37436133 Pik3cb Rat sirolimus multiple interactions ISO Pik3cb (Mus musculus) 6480464 Sirolimus inhibits the reaction [TGFB1 protein results in increased expression of PIK3CB mRNA] CTD PMID:31522336 Pik3cb Rat sirolimus increases expression ISO Pik3cb (Mus musculus) 6480464 Sirolimus results in increased expression of PIK3CB mRNA CTD PMID:31522336 Pik3cb Rat sodium arsenite decreases expression ISO Pik3cb (Mus musculus) 6480464 sodium arsenite results in decreased expression of PIK3CB mRNA CTD PMID:31532247 Pik3cb Rat sodium arsenite increases expression EXP 6480464 sodium arsenite results in increased expression of PIK3CB protein CTD PMID:34673086 Pik3cb Rat sodium arsenite multiple interactions ISO PIK3CB (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in decreased expression of PIK3CB mRNA and [sodium arsenite results in increased abundance of Arsenic] which results in decreased expression of PIK3CB mRNA CTD PMID:39836092 Pik3cb Rat streptozocin decreases expression EXP 6480464 Streptozocin results in decreased expression of PIK3CB mRNA CTD PMID:26071184 Pik3cb Rat streptozocin multiple interactions ISO Pik3cb (Mus musculus) 6480464 [Streptozocin co-treated with Dietary Fats] results in decreased expression of PIK3CB protein more ... CTD PMID:29526571 Pik3cb Rat streptozocin multiple interactions EXP 6480464 resveratrol inhibits the reaction [Streptozocin results in decreased expression of PIK3CB mRNA] CTD PMID:26071184 Pik3cb Rat T-2 toxin decreases expression ISO PIK3CB (Homo sapiens) 6480464 T-2 Toxin results in decreased expression of PIK3CB mRNA CTD PMID:34581912 Pik3cb Rat tamibarotene affects expression ISO PIK3CB (Homo sapiens) 6480464 tamibarotene affects the expression of PIK3CB mRNA CTD PMID:15498508 Pik3cb Rat tetrachloromethane increases expression ISO Pik3cb (Mus musculus) 6480464 Carbon Tetrachloride results in increased expression of PIK3CB mRNA CTD PMID:31919559 Pik3cb Rat tetracycline increases expression ISO Pik3cb (Mus musculus) 6480464 Tetracycline results in increased expression of PIK3CB mRNA CTD PMID:16917069 Pik3cb Rat titanium dioxide increases methylation ISO Pik3cb (Mus musculus) 6480464 titanium dioxide results in increased methylation of PIK3CB promoter CTD PMID:35295148 Pik3cb Rat tributylstannane increases expression ISO PIK3CB (Homo sapiens) 6480464 tributyltin results in increased expression of PIK3CB mRNA CTD PMID:26314263 Pik3cb Rat Tributyltin oxide increases expression ISO PIK3CB (Homo sapiens) 6480464 bis(tri-n-butyltin)oxide results in increased expression of PIK3CB mRNA CTD PMID:26314263 Pik3cb Rat valproic acid increases expression ISO PIK3CB (Homo sapiens) 6480464 Valproic Acid results in increased expression of PIK3CB mRNA CTD PMID:23179753 and PMID:28001369 Pik3cb Rat wortmannin decreases activity ISO PIK3CB (Homo sapiens) 6480464 wortmannin results in decreased activity of PIK3CB protein CTD PMID:11931710 Pik3cb Rat wortmannin decreases expression EXP 597931096 [wortmannin cotreatment with isoflurane] decreases expression of PI3K mRNA and protein in hippocampus RGD Pik3cb Rat wortmannin multiple interactions ISO Pik3cb (Mus musculus) 6480464 Wortmannin inhibits the reaction [cyanoginosin LR results in increased expression of PIK3CB protein] CTD PMID:36288207
Imported Annotations - KEGG (archival)
Imported Annotations - PID (archival)
(-)-alpha-phellandrene (ISO) (-)-epigallocatechin 3-gallate (ISO) 1,2-dimethylhydrazine (ISO) 17beta-estradiol (EXP,ISO) 2,2',4,4'-Tetrabromodiphenyl ether (ISO) 2,3',4,4',5-Pentachlorobiphenyl (ISO) 2,3,7,8-tetrachlorodibenzodioxine (ISO) 2,6-dinitrotoluene (EXP) 3,3',5,5'-tetrabromobisphenol A (ISO) 3-methylcholanthrene (ISO) 4,4'-sulfonyldiphenol (ISO) 4-hydroxynon-2-enal (ISO) all-trans-retinoic acid (ISO) allethrin (EXP) alpha-phellandrene (ISO) aristolochic acid A (EXP,ISO) arsane (ISO) arsenic atom (ISO) arsenite(3-) (ISO) arsenous acid (ISO) benzo[a]pyrene (ISO) benzo[a]pyrene diol epoxide I (ISO) Benzo[k]fluoranthene (ISO) beta-lapachone (ISO) bexarotene (EXP) bis(2-ethylhexyl) phthalate (ISO) bisphenol A (EXP,ISO) cadmium dichloride (ISO) calcium atom (EXP) calcium(0) (EXP) cannabidiol (ISO) capecitabine (ISO) cobalt dichloride (ISO) copper atom (ISO) copper(0) (ISO) copper(II) sulfate (ISO) crocidolite asbestos (ISO) cyclosporin A (ISO) cyhalothrin (EXP) cypermethrin (EXP) decabromodiphenyl ether (ISO) dexamethasone (ISO) diarsenic trioxide (ISO) Dibutyl phosphate (ISO) dibutyl phthalate (ISO) dioscin (ISO) dioxygen (ISO) Doramectin (EXP) dorsomorphin (ISO) doxorubicin (ISO) entinostat (ISO) ethanol (EXP,ISO) fenthion (ISO) fenvalerate (EXP) Forsythiaside (ISO) fulvestrant (ISO) gentamycin (EXP) idelalisib (ISO) isoflurane (EXP) lead(0) (ISO) LY294002 (ISO) manganese atom (ISO) manganese(0) (ISO) manganese(II) chloride (ISO) metformin (ISO) methidathion (ISO) methylmercury(1+) (ISO) microcystin-LR (ISO) minocycline (ISO) morin (ISO) N,N-diethyl-m-toluamide (EXP) N-nitrosodiethylamine (EXP) ochratoxin A (ISO) ozone (ISO) paracetamol (EXP) paraquat (ISO) permethrin (EXP) phenobarbital (ISO) phorbol 13-acetate 12-myristate (ISO) pioglitazone (ISO) potassium chromate (ISO) pyrethrins (EXP) resveratrol (EXP,ISO) SB 431542 (ISO) Sinomenine (ISO) sirolimus (ISO) sodium arsenite (EXP,ISO) streptozocin (EXP,ISO) T-2 toxin (ISO) tamibarotene (ISO) tetrachloromethane (ISO) tetracycline (ISO) titanium dioxide (ISO) tributylstannane (ISO) Tributyltin oxide (ISO) valproic acid (ISO) wortmannin (EXP,ISO)
Biological Process
angiogenesis involved in wound healing (IEA,ISO) autophagy (IEA) cell adhesion (IEA) cell migration (IBA) embryonic cleavage (IEA,ISO) endocytosis (IEA) endothelial cell proliferation (IEA,ISO) homophilic cell adhesion via plasma membrane adhesion molecules (IEA,ISO) intracellular calcium ion homeostasis (IEA,ISO) lipid metabolic process (IEA) natural killer cell mediated cytotoxicity (ISO) negative regulation of hypoxia-induced intrinsic apoptotic signaling pathway (IEA,ISO) negative regulation of MAPK cascade (IEA,ISO) negative regulation of phosphatidylinositol 3-kinase/protein kinase B signal transduction (IEA,ISO) negative regulation of sprouting angiogenesis (ISO) negative regulation of vascular endothelial growth factor signaling pathway (ISO) phosphatidylinositol 3-kinase/protein kinase B signal transduction (IBA,IEA,ISO) phosphatidylinositol phosphate biosynthetic process (IDA,IEA,ISO) phosphatidylinositol-3-phosphate biosynthetic process (IBA,IEA) phosphatidylinositol-mediated signaling (IBA) platelet activation (IEA,ISO) positive regulation of endothelial cell migration (IEA,ISO) positive regulation of gene expression (ISO) positive regulation of neutrophil apoptotic process (ISO) positive regulation of nitric oxide biosynthetic process (ISO) positive regulation of Rac protein signal transduction (IEA,ISO) regulation of cell-matrix adhesion (IEA,ISO) response to ischemia (IEA,ISO) sphingosine-1-phosphate receptor signaling pathway (IEA,ISO)
1.
Bile acid depletion and repletion regulate cholangiocyte growth and secretion by a phosphatidylinositol 3-kinase-dependent pathway in rats.
Alpini G, etal., Gastroenterology 2002 Oct;123(4):1226-37.
2.
Targeted RNA interference of phosphatidylinositol 3-kinase p110-beta induces apoptosis and proliferation arrest in endometrial carcinoma cells.
An HJ, etal., J Pathol. 2007 Jun;212(2):161-9.
3.
PTEN restoration and PIK3CB knockdown synergistically suppress glioblastoma growth in vitro and in xenografts.
Chen H, etal., J Neurooncol. 2011 Aug;104(1):155-67. doi: 10.1007/s11060-010-0492-2. Epub 2010 Dec 29.
4.
PI3K-FRAP/mTOR pathway is critical for hepatocyte proliferation whereas MEK/ERK supports both proliferation and survival.
Coutant A, etal., Hepatology 2002 Nov;36(5):1079-88.
5.
Hepatocyte growth factor activates phosphoinositide 3-kinase C2 beta in renal brush-border plasma membranes.
Crljen V, etal., Biochem J 2002 Aug 1;365(Pt 3):791-9.
6.
Isoform-specific phosphoinositide 3-kinase inhibitors exert distinct effects in solid tumors.
Edgar KA, etal., Cancer Res. 2010 Feb 1;70(3):1164-72. doi: 10.1158/0008-5472.CAN-09-2525. Epub 2010 Jan 26.
7.
Phylogenetic-based propagation of functional annotations within the Gene Ontology consortium.
Gaudet P, etal., Brief Bioinform. 2011 Sep;12(5):449-62. doi: 10.1093/bib/bbr042. Epub 2011 Aug 27.
8.
Rat ISS GO annotations from GOA human gene data--August 2006
GOA data from the GO Consortium
9.
Phosphoinositide 3-kinases as a common platform for multi-hormone signaling.
Hirsch E, etal., J Endocrinol. 2007 Aug;194(2):243-56.
10.
PI 3-kinase p110beta: a new target for antithrombotic therapy.
Jackson SP, etal., Nat Med. 2005 May;11(5):507-14. Epub 2005 Apr 17.
11.
Platelet-derived growth factor-BB-mediated activation of Akt suppresses smooth muscle-specific gene expression through inhibition of mitogen-activated protein kinase and redistribution of serum response factor.
Kaplan-Albuquerque N, etal., J Biol Chem. 2003 Oct 10;278(41):39830-8. Epub 2003 Jul 25.
12.
Endometrial cancer cells exhibit high expression of p110ß and its selective inhibition induces variable responses on PI3K signaling, cell survival and proliferation.
Karlsson T, etal., Oncotarget. 2017 Jan 17;8(3):3881-3894. doi: 10.18632/oncotarget.13989.
13.
KEGG: Kyoto Encyclopedia of Genes and Genomes
KEGG
14.
Troglitazone but not metformin restores insulin-stimulated phosphoinositide 3-kinase activity and increases p110beta protein levels in skeletal muscle of type 2 diabetic subjects.
Kim YB, etal., Diabetes. 2002 Feb;51(2):443-8.
15.
Rat ISS GO annotations from MGI mouse gene data--August 2006
MGD data from the GO Consortium
16.
Electronic Transfer of LocusLink and RefSeq Data
NCBI rat LocusLink and RefSeq merged data July 26, 2002
17.
KEGG Annotation Import Pipeline
Pipeline to import KEGG annotations from KEGG into RGD
18.
PID Annotation Import Pipeline
Pipeline to import Pathway Interaction Database annotations from NCI into RGD
19.
In vivo regulation of phosphoinositide 3-kinase in retina through light-induced tyrosine phosphorylation of the insulin receptor beta-subunit.
Rajala RV, etal., J Biol Chem 2002 Nov 8;277(45):43319-26.
20.
GOA pipeline
RGD automated data pipeline
21.
ClinVar Automated Import and Annotation Pipeline
RGD automated import pipeline for ClinVar variants, variant-to-disease annotations and gene-to-disease annotations
22.
Data Import for Chemical-Gene Interactions
RGD automated import pipeline for gene-chemical interactions
23.
MicroRNA126 inhibits proliferation and metastasis by targeting pik3r2 in prostate cancer.
Song L, etal., Mol Med Rep. 2016 Feb;13(2):1204-10. doi: 10.3892/mmr.2015.4661. Epub 2015 Dec 9.
24.
Survival kinase genes present prognostic significance in glioblastoma.
Varghese RT, etal., Oncotarget. 2016 Mar 4. doi: 10.18632/oncotarget.7917.
25.
BACE1 gene silencing alleviates isoflurane anesthesia‑induced postoperative cognitive dysfunction in immature rats by activating the PI3K/Akt signaling pathway.
Wang YB, etal., Mol Med Rep. 2018 Nov;18(5):4259-4270. doi: 10.3892/mmr.2018.9453. Epub 2018 Sep 4.
26.
PTEN-deficient cancers depend on PIK3CB.
Wee S, etal., Proc Natl Acad Sci U S A. 2008 Sep 2;105(35):13057-62. doi: 10.1073/pnas.0802655105. Epub 2008 Aug 28.
27.
PIK3CA and PIK3CB expression and relationship with multidrug resistance in colorectal carcinoma.
Wen F, etal., Int J Clin Exp Pathol. 2014 Oct 15;7(11):8295-303. eCollection 2014.
28.
MicroRNA-21 promotes cell proliferation, migration, and resistance to apoptosis through PTEN/PI3K/AKT signaling pathway in esophageal cancer.
Wu YR, etal., Tumour Biol. 2016 Sep;37(9):12061-12070. doi: 10.1007/s13277-016-5074-2. Epub 2016 May 17.
29.
ErbB4 protects against neuronal apoptosis via activation of YAP/PIK3CB signaling pathway in a rat model of subarachnoid hemorrhage.
Yan F, etal., Exp Neurol. 2017 Nov;297:92-100. doi: 10.1016/j.expneurol.2017.07.014. Epub 2017 Jul 27.
30.
Inhibitory effects of Chanling Gao on the proliferation and liver metastasis of transplanted colorectal cancer in nude mice.
Yang B, etal., PLoS One. 2019 Feb 21;14(2):e0201504. doi: 10.1371/journal.pone.0201504. eCollection 2019.
31.
Phosphatidylinositol 3-kinase CB association with preoperative radiotherapy response in rectal adenocarcinoma.
Yu WD, etal., World J Gastroenterol. 2014 Nov 21;20(43):16258-67. doi: 10.3748/wjg.v20.i43.16258.
32.
Garlic Oil Suppressed Nitrosodiethylamine-Induced Hepatocarcinoma in Rats by Inhibiting PI3K-AKT-NF-κB Pathway.
Zhang CL, etal., Int J Biol Sci. 2015 Apr 25;11(6):643-51. doi: 10.7150/ijbs.10785. eCollection 2015.
33.
Phosphoinositide 3-OH kinase p85alpha and p110beta are essential for androgen receptor transactivation and tumor progression in prostate cancers.
Zhu Q, etal., Oncogene. 2008 Jul 31;27(33):4569-79. doi: 10.1038/onc.2008.91. Epub 2008 Mar 31.
Pik3cb Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 8 108,474,017 - 108,579,140 (-) NCBI GRCr8 mRatBN7.2 8 99,594,600 - 99,699,772 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 8 99,594,644 - 99,699,663 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 8 105,261,003 - 105,332,672 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 8 103,460,307 - 103,531,975 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 8 101,302,802 - 101,374,469 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 8 107,275,849 - 107,381,088 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 8 107,275,725 - 107,380,933 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 8 106,700,158 - 106,788,063 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 8 103,886,682 - 103,957,112 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 8 103,906,136 - 103,976,567 (-) NCBI Celera 8 99,000,434 - 99,072,100 (-) NCBI Celera Cytogenetic Map 8 q31 NCBI
PIK3CB Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 3 138,652,698 - 138,834,928 (-) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 3 138,652,336 - 138,834,928 (-) Ensembl GRCh38 hg38 GRCh38 GRCh37 3 138,371,540 - 138,553,770 (-) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 3 139,856,921 - 139,960,875 (-) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 3 139,856,928 - 139,960,883 NCBI Celera 3 136,799,538 - 136,904,134 (-) NCBI Celera Cytogenetic Map 3 q22.3 NCBI HuRef 3 135,746,166 - 135,853,444 (-) NCBI HuRef CHM1_1 3 138,335,402 - 138,442,207 (-) NCBI CHM1_1 T2T-CHM13v2.0 3 141,393,413 - 141,575,643 (-) NCBI T2T-CHM13v2.0
Pik3cb Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 9 98,920,455 - 99,022,264 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 9 98,918,707 - 99,022,674 (-) Ensembl GRCm39 Ensembl GRCm38 9 99,038,402 - 99,140,235 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 9 99,036,654 - 99,140,621 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 9 98,938,821 - 99,040,630 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 9 98,847,754 - 98,949,439 (-) NCBI MGSCv36 mm8 Celera 9 98,576,088 - 98,662,033 (-) NCBI Celera Cytogenetic Map 9 E3.3 NCBI cM Map 9 51.41 NCBI
Pik3cb Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955501 259,645 - 379,909 (+) Ensembl ChiLan1.0 ChiLan1.0 NW_004955501 251,829 - 381,255 (+) NCBI ChiLan1.0 ChiLan1.0
PIK3CB Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 2 136,561,870 - 136,744,097 (-) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 3 136,566,598 - 136,748,779 (-) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 3 135,685,120 - 135,867,096 (-) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 3 143,288,563 - 143,431,314 (-) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 3 143,288,563 - 143,431,314 (-) Ensembl panpan1.1 panPan2
PIK3CB Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 23 34,832,661 - 34,955,410 (-) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 23 34,836,540 - 34,993,939 (-) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 23 34,826,488 - 35,032,061 (-) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 23 35,375,472 - 35,581,398 (-) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 23 35,378,018 - 35,581,338 (-) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 23 35,056,048 - 35,262,274 (-) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 23 35,121,991 - 35,327,601 (-) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 23 35,371,974 - 35,577,846 (-) NCBI UU_Cfam_GSD_1.0
Pik3cb Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024405602 74,167,334 - 74,302,042 (-) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936540 907,112 - 1,041,848 (-) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936540 907,118 - 1,041,814 (-) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
PIK3CB Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 13 79,425,835 - 79,610,840 (-) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 13 79,427,033 - 79,610,840 (-) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 13 87,042,709 - 87,067,016 (+) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
PIK3CB Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 15 51,705,585 - 51,885,848 (+) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 15 51,775,733 - 51,889,238 (+) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666041 24,691,992 - 24,889,924 (+) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Pik3cb
.
Predicted Target Of
Count of predictions: 43 Count of miRNA genes: 39 Interacting mature miRNAs: 41 Transcripts: ENSRNOT00000022179 Prediction methods: Miranda, Rnahybrid, Targetscan Result types: miRGate_prediction
1300177 Cm2 Cardiac mass QTL 2 3.65 heart mass (VT:0007028) heart weight (CMO:0000017) 8 54259986 100382532 Rat 1549909 Stresp11 Stress response QTL 11 6.83 0.0019 stress-related behavior trait (VT:0010451) number of approaches toward negative stimulus before onset of defensive burying response (CMO:0001960) 8 73473045 118473045 Rat 1554321 Bmd3 Bone mineral density QTL 3 7.9 0.0001 femur mineral mass (VT:0010011) volumetric bone mineral density (CMO:0001553) 8 40952565 123900184 Rat 9590292 Uminl3 Urine mineral level QTL 3 3.62 0.001 urine mineral amount (VT:0015086) urine electrolyte level (CMO:0000593) 8 71888757 116888757 Rat 1578769 Uae31 Urinary albumin excretion QTL 31 3.3 0.001 urine albumin amount (VT:0002871) urine albumin excretion rate (CMO:0000757) 8 30848154 101699754 Rat 738011 Anxrr9 Anxiety related response QTL 9 6.1 exploratory behavior trait (VT:0010471) number of entries into a discrete space in an experimental apparatus (CMO:0000960) 8 93535351 123900184 Rat 8693654 Alc32 Alcohol consumption QTL 32 2 0.755 drinking behavior trait (VT:0001422) calculated ethanol drink intake rate (CMO:0001615) 8 88612425 107550209 Rat 1358912 Bw51 Body weight QTL 51 2.95 body mass (VT:0001259) body weight (CMO:0000012) 8 51351728 107062046 Rat 1578765 Klgr1 Kidney lesion grade QTL 1 3.3 0.0001 kidney morphology trait (VT:0002135) organ lesion measurement (CMO:0000677) 8 30848154 101699754 Rat 738014 Anxrr15 Anxiety related response QTL 15 3.6 0.005 locomotor behavior trait (VT:0001392) amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958) 8 95718998 123900184 Rat 1300171 Bp184 Blood pressure QTL 184 3.66 arterial blood pressure trait (VT:2000000) blood pressure time series experimental set point of the baroreceptor response (CMO:0002593) 8 70513503 118219066 Rat 1578755 Pur5 Proteinuria QTL 5 3.3 0.0001 urine total protein amount (VT:0000032) urine total protein excretion rate (CMO:0000756) 8 30848154 101699754 Rat 2313400 Anxrr25 Anxiety related response QTL 25 aggression-related behavior trait (VT:0015014) tameness/aggressiveness composite score (CMO:0002136) 8 89265192 114019816 Rat 2303171 Bp331 Blood pressure QTL 331 5.57 0.005 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 8 61290298 119084929 Rat 631210 Bw3 Body weight QTL3 5.9 mesenteric fat pad mass (VT:0010427) mesenteric fat pad weight to body weight ratio (CMO:0000654) 8 69349194 112783834 Rat 1358903 Bp252 Blood pressure QTL 252 7 0.0001 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 8 93965141 123900184 Rat 8694446 Bw170 Body weight QTL 170 12.07 0.001 retroperitoneal fat pad mass (VT:0010430) retroperitoneal fat pad weight to body weight ratio (CMO:0000635) 8 71888757 116888757 Rat 631650 Stl6 Serum triglyceride level QTL 6 4 0.0019 blood triglyceride amount (VT:0002644) plasma triglyceride level (CMO:0000548) 8 10378157 112202585 Rat 631653 Bp125 Blood pressure QTL 125 3.3 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 8 66142385 111142385 Rat 1581557 Eae16 Experimental allergic encephalomyelitis QTL 16 3.8 nervous system integrity trait (VT:0010566) experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046) 8 8462195 110921472 Rat 70197 BpQTLcluster8 Blood pressure QTL cluster 8 3.482 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 8 46531639 119088626 Rat 2316950 Scl66 Serum cholesterol level QTL 66 4.1 blood cholesterol amount (VT:0000180) plasma total cholesterol level (CMO:0000585) 8 30848259 105647037 Rat 2300182 Bmd56 Bone mineral density QTL 56 5.4 femur mineral mass (VT:0010011) volumetric bone mineral density (CMO:0001553) 8 95718998 123900184 Rat 2300181 Bmd55 Bone mineral density QTL 55 5.7 0.0001 femur mineral mass (VT:0010011) volumetric bone mineral density (CMO:0001553) 8 76468691 121468691 Rat 1358893 Bp263 Blood pressure QTL 263 5.01 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 8 93965141 123900184 Rat 8694200 Abfw4 Abdominal fat weight QTL 4 9.07 0.001 visceral adipose mass (VT:0010063) abdominal fat pad weight to body weight ratio (CMO:0000095) 8 71888757 116888757 Rat 8694392 Bw161 Body weight QTL 161 8.06 0.001 body lean mass (VT:0010483) lean tissue morphological measurement (CMO:0002184) 8 71888757 116888757 Rat 61437 Cia6 Collagen induced arthritis QTL 6 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 8 82460758 122812818 Rat
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
11
49
113
91
90
59
25
59
6
218
97
93
45
60
31
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000022179 ⟹ ENSRNOP00000022179
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 8 99,594,644 - 99,699,549 (-) Ensembl Rnor_6.0 Ensembl 8 107,275,725 - 107,380,933 (-) Ensembl
Ensembl Acc Id:
ENSRNOT00000039271 ⟹ ENSRNOP00000035786
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source Rnor_6.0 Ensembl 8 106,863,494 - 106,870,994 (-) Ensembl
Ensembl Acc Id:
ENSRNOT00000112462 ⟹ ENSRNOP00000089360
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 8 99,663,541 - 99,699,663 (-) Ensembl
RefSeq Acc Id:
NM_053481 ⟹ NP_445933
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 8 108,474,017 - 108,545,708 (-) NCBI mRatBN7.2 8 99,594,642 - 99,666,336 (-) NCBI Rnor_6.0 8 107,275,881 - 107,347,573 (-) NCBI Rnor_5.0 8 106,700,158 - 106,788,063 (-) NCBI RGSC_v3.4 8 103,886,682 - 103,957,112 (-) RGD Celera 8 99,000,434 - 99,072,100 (-) NCBI
Sequence:
ATGTGCTTCCGCTCTATAATGCCTCCTGCTATGGCAGACACCCTTGACATCTGGGCCGTGGATTCACAGATCGCGTCTGATGGCTCCATCTCTGTCGATTTCCTTCTGCCCACTGGGATTTATATCCA
hide sequence
RefSeq Acc Id:
XM_017595943 ⟹ XP_017451432
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 8 108,474,025 - 108,579,140 (-) NCBI mRatBN7.2 8 99,594,600 - 99,699,772 (-) NCBI Rnor_6.0 8 107,275,849 - 107,381,088 (-) NCBI
Sequence:
CGCGGGCACGGCGGTGGCGCGCGCGTGCTCCGTCGGGCGGTGCAGCGGCTGAGACGGAGCCGGC
hide sequence
RefSeq Acc Id:
XM_017595946 ⟹ XP_017451435
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 8 108,474,025 - 108,579,138 (-) NCBI mRatBN7.2 8 99,594,600 - 99,699,770 (-) NCBI Rnor_6.0 8 107,275,849 - 107,381,088 (-) NCBI
Sequence:
CGCGGGCACGGCGGTGGCGCGCGCGTGCTCCGTCGGGCGGTGCAGCGGCTGAGACGGAGCCGGC
hide sequence
RefSeq Acc Id:
XM_017595947 ⟹ XP_017451436
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 8 108,474,025 - 108,578,750 (-) NCBI mRatBN7.2 8 99,594,600 - 99,699,387 (-) NCBI Rnor_6.0 8 107,275,849 - 107,380,798 (-) NCBI
Sequence:
GGCGCGCGGGCTCCGAGGTACGCGGCGCCAGGCCTCGGGCGGCGGACACGGAGCAGCGGAGGGC
hide sequence
RefSeq Acc Id:
XR_005487938
Type:
NON-CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 8 108,474,025 - 108,579,140 (-) NCBI mRatBN7.2 8 99,594,600 - 99,699,772 (-) NCBI
RefSeq Acc Id:
XR_010054039
Type:
NON-CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 8 108,474,025 - 108,578,750 (-) NCBI
RefSeq Acc Id:
NP_445933 ⟸ NM_053481
- UniProtKB:
Q9Z1L0 (UniProtKB/Swiss-Prot)
- Sequence:
MCFRSIMPPAMADTLDIWAVDSQIASDGSISVDFLLPTGIYIQLEVPREATISYIKQMLWKQVHNYPMFNLLMDIDSYMFACVNQTAVYEELEDETRRLCDVRPFLPVLKLVTRSCDPAEKLDSKIGV
hide sequence
RefSeq Acc Id:
XP_017451432 ⟸ XM_017595943
- Peptide Label:
isoform X1
- UniProtKB:
G3V839 (UniProtKB/TrEMBL), A6I2C5 (UniProtKB/TrEMBL)
- Sequence:
MCFRSIMPPAMADTLDIWAVDSQIASDGSISVDFLLPTGIYIQLEVPREATISYIKQMLWKQVH
hide sequence
RefSeq Acc Id:
XP_017451435 ⟸ XM_017595946
- Peptide Label:
isoform X1
- UniProtKB:
G3V839 (UniProtKB/TrEMBL), A6I2C5 (UniProtKB/TrEMBL)
- Sequence:
MCFRSIMPPAMADTLDIWAVDSQIASDGSISVDFLLPTGIYIQLEVPREATISYIKQMLWKQVHNYPMFNLLMDIDSYMFACVNQTAVYEELEDETRRLCDVRPFLPVLKLVTRSCDPAEKLDSKIGV
hide sequence
RefSeq Acc Id:
XP_017451436 ⟸ XM_017595947
- Peptide Label:
isoform X1
- UniProtKB:
G3V839 (UniProtKB/TrEMBL), A6I2C5 (UniProtKB/TrEMBL)
- Sequence:
MCFRSIMPPAMADTLDIWAVDSQIASDGSISVDFLLPTGIYIQLEVPREATISYIKQMLWKQVH
hide sequence
Ensembl Acc Id:
ENSRNOP00000022179 ⟸ ENSRNOT00000022179
Ensembl Acc Id:
ENSRNOP00000035786 ⟸ ENSRNOT00000039271
Ensembl Acc Id:
ENSRNOP00000089360 ⟸ ENSRNOT00000112462
RGD ID: 13696208 Promoter ID: EPDNEW_R6732 Type: multiple initiation site Name: Pik3cb_1 Description: phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunitbeta SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Rat Assembly Chr Position (strand) Source Rnor_6.0 8 107,380,849 - 107,380,909 EPDNEW
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2021-03-09
Pik3cb
phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit beta
LOC100910021
phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit beta isoform-like
Data merged from RGD:6500836
737654 PROVISIONAL
2012-10-10
Pik3cb
phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit beta
Pik3cb
phosphoinositide-3-kinase, catalytic, beta polypeptide
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2012-07-05
LOC100910021
phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit beta isoform-like
Symbol and Name status set to provisional
70820 PROVISIONAL
2008-09-09
Pik3cb
phosphoinositide-3-kinase, catalytic, beta polypeptide
Pik3cb
phosphatidylinositol 3-kinase, catalytic, beta polypeptide
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2004-12-14
Pik3cb
phosphatidylinositol 3-kinase, catalytic, beta polypeptide
phosphatidylinositol 3-kinase, catalytic subunit, beta isoform
Name updated
1299863 APPROVED
2002-08-07
Pik3cb
phosphatidylinositol 3-kinase, catalytic subunit, beta isoform
Symbol and Name status set to provisional
70820 PROVISIONAL
