Symbol:
Mir106b
Name:
microRNA 106b
RGD ID:
2325388
Description:
Predicted to enable mRNA 3'-UTR binding activity and mRNA base-pairing translational repressor activity. Predicted to be involved in cellular response to amyloid-beta; miRNA-mediated post-transcriptional gene silencing; and negative regulation of angiogenesis. Predicted to act upstream of or within several processes, including cellular response to forskolin; long-term synaptic potentiation; and negative regulation of B cell apoptotic process. Predicted to be located in extracellular exosome. Predicted to be part of RISC complex. Biomarker of hepatocellular carcinoma. Orthologous to human MIR106B (microRNA 106b); INTERACTS WITH 2-acetamidofluorene; 2-methoxyethanol; atrazine.
Type:
ncrna (Ensembl: miRNA)
RefSeq Status:
PROVISIONAL
Previously known as:
rno-mir-106b
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 12 22,157,053 - 22,157,134 (-) NCBI GRCr8 mRatBN7.2 12 17,043,344 - 17,043,425 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 12 17,043,344 - 17,043,425 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 12 17,866,725 - 17,866,806 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 12 18,490,469 - 18,490,550 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 12 17,543,875 - 17,543,956 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 12 19,307,752 - 19,307,833 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 12 19,307,752 - 19,307,833 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 12 21,365,382 - 21,365,463 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 Celera 12 18,973,514 - 18,973,595 (-) NCBI Celera Cytogenetic Map 12 q11 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
1.
Crosstalk between liver-related microRNAs and Wnt/β-catenin pathway in hepatocellular carcinoma patients.
Ashmawy AM, etal., Arab J Gastroenterol. 2017 Sep;18(3):144-150. doi: 10.1016/j.ajg.2017.09.001. Epub 2017 Sep 27.
2.
Plasma microRNA might as a potential biomarker for hepatocellular carcinoma and chronic liver disease screening.
Jiang L, etal., Tumour Biol. 2015 Sep;36(9):7167-74. doi: 10.1007/s13277-015-3446-7. Epub 2015 Apr 17.
3.
Involvement of methylation of MicroRNA-122, -125b and -106b in regulation of Cyclin G1, CAT-1 and STAT3 target genes in isoniazid-induced liver injury.
Li Y, etal., BMC Pharmacol Toxicol. 2018 Mar 20;19(1):11. doi: 10.1186/s40360-018-0201-x.
4.
Data Import for Chemical-Gene Interactions
RGD automated import pipeline for gene-chemical interactions
5.
Study on the value of serum miR-106b for the early diagnosis of hepatocellular carcinoma.
Shi BM, etal., World J Gastroenterol. 2017 May 28;23(20):3713-3720. doi: 10.3748/wjg.v23.i20.3713.
6.
miR-106b promotes cancer progression in hepatitis B virus-associated hepatocellular carcinoma.
Yen CS, etal., World J Gastroenterol. 2016 Jun 14;22(22):5183-92. doi: 10.3748/wjg.v22.i22.5183.
7.
MicroRNA-106b-5p promotes hepatocellular carcinoma development via modulating FOG2.
Yu LX, etal., Onco Targets Ther. 2019 Jul 15;12:5639-5647. doi: 10.2147/OTT.S203382. eCollection 2019.
Mir106b (Rattus norvegicus - Norway rat)
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 12 22,157,053 - 22,157,134 (-) NCBI GRCr8 mRatBN7.2 12 17,043,344 - 17,043,425 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 12 17,043,344 - 17,043,425 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 12 17,866,725 - 17,866,806 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 12 18,490,469 - 18,490,550 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 12 17,543,875 - 17,543,956 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 12 19,307,752 - 19,307,833 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 12 19,307,752 - 19,307,833 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 12 21,365,382 - 21,365,463 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 Celera 12 18,973,514 - 18,973,595 (-) NCBI Celera Cytogenetic Map 12 q11 NCBI
MIR106B (Homo sapiens - human)
Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 7 100,093,993 - 100,094,074 (-) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 7 100,093,993 - 100,094,074 (-) Ensembl GRCh38 hg38 GRCh38 GRCh37 7 99,691,616 - 99,691,697 (-) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 7 99,529,551 - 99,529,632 (-) NCBI NCBI36 Build 36 hg18 NCBI36 Celera 7 94,426,275 - 94,426,356 (-) NCBI Celera Cytogenetic Map 7 q22.1 NCBI HuRef 7 94,327,267 - 94,327,348 (-) NCBI HuRef CHM1_1 7 99,621,773 - 99,621,854 (-) NCBI CHM1_1 T2T-CHM13v2.0 7 101,333,839 - 101,333,920 (-) NCBI T2T-CHM13v2.0 CRA_TCAGchr7v2 7 99,051,736 - 99,051,817 (-) NCBI
Mir106b (Mus musculus - house mouse)
Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 5 138,163,999 - 138,164,080 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 5 138,163,999 - 138,164,080 (-) Ensembl GRCm39 Ensembl GRCm38 5 138,165,737 - 138,165,818 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 5 138,165,737 - 138,165,818 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 5 138,606,965 - 138,607,046 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 Celera 5 135,145,069 - 135,145,150 (-) NCBI Celera Cytogenetic Map 5 G2 NCBI cM Map 5 76.97 NCBI
MIR106B (Canis lupus familiaris - dog)
Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 6 9,498,558 - 9,498,616 (+) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 6 9,498,558 - 9,498,616 (+) Ensembl CanFam3.1 canFam3 CanFam3.1 ROS_Cfam_1.0 6 9,435,559 - 9,435,617 (+) NCBI ROS_Cfam_1.0 UMICH_Zoey_3.1 6 9,284,885 - 9,284,943 (+) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 6 9,265,181 - 9,265,239 (+) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 6 9,444,796 - 9,444,854 (+) NCBI UU_Cfam_GSD_1.0
.
Predicted Targets
Count of predictions: 9390 Count of gene targets: 5611 Count of transcripts: 6071 Interacting mature miRNAs: rno-miR-106b-3p, rno-miR-106b-5p Prediction methods: Microtar, Miranda, Pita, Pita,Targetscan, Rnahybrid, Targetscan Result types: miRGate_prediction
61443 Btemp2 Thermal response to stress QTL 2 3.3 0.000094 body temperature trait (VT:0005535) core body temperature (CMO:0001036) 12 15025183 20794014 Rat 8552964 Pigfal17 Plasma insulin-like growth factor 1 level QTL 17 3.5 blood insulin-like growth factor amount (VT:0010479) plasma insulin-like growth factor 1 level (CMO:0001299) 12 5564495 46669029 Rat 9590147 Scort7 Serum corticosterone level QTL 7 13.61 0.001 blood corticosterone amount (VT:0005345) plasma corticosterone level (CMO:0001173) 12 1 42110980 Rat 1549829 Scl48 Serum cholesterol level QTL 48 5 blood cholesterol amount (VT:0000180) serum total cholesterol level (CMO:0000363) 12 9603277 46669029 Rat 61331 Eau2 Experimental allergic uveoretinitis QTL 2 0.0005 uvea integrity trait (VT:0010551) experimental autoimmune uveitis score (CMO:0001504) 12 8525423 28064601 Rat 2293684 Bmd26 Bone mineral density QTL 26 4.4 0.0002 femur mineral mass (VT:0010011) total volumetric bone mineral density (CMO:0001728) 12 15872653 32974238 Rat 6893681 Bw109 Body weight QTL 109 2.3 0.004 body mass (VT:0001259) body weight (CMO:0000012) 12 1 23297788 Rat 1302792 Scl21 Serum cholesterol level QTL 21 3.8 0.0011 blood cholesterol amount (VT:0000180) plasma total cholesterol level (CMO:0000585) 12 7196730 46669029 Rat 1598855 Bp294 Blood pressure QTL 294 3.5 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 12 1 34851688 Rat 1600391 Edcs2 Endometrial carcinoma susceptibility QTL2 3.5 0.01 uterus morphology trait (VT:0001120) percentage of study population developing endometrioid carcinoma during a period of time (CMO:0001759) 12 6833190 17870186 Rat 10755457 Coatc14 Coat color QTL 14 0.01759 coat/hair pigmentation trait (VT:0010463) pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812) 12 1 22591684 Rat 1331761 Bp218 Blood pressure QTL 218 2.973 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 12 11073825 45055165 Rat 8694179 Bw150 Body weight QTL 150 2.9 0.001 body mass (VT:0001259) body weight gain (CMO:0000420) 12 1 42110980 Rat 7411545 Bw128 Body weight QTL 128 5.2 0.001 body mass (VT:0001259) body weight gain (CMO:0000420) 12 1 42110980 Rat 7411547 Bw129 Body weight QTL 129 0.001 body mass (VT:0001259) body weight gain (CMO:0000420) 6 5564495 46669029 Rat 1300157 Rf21 Renal function QTL 21 4.4 renal blood flow trait (VT:2000006) absolute change in renal blood flow rate (CMO:0001168) 12 9318216 32103380 Rat 737979 Pia22 Pristane induced arthritis QTL 22 53.1 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 12 1 44465750 Rat 2300186 Bmd59 Bone mineral density QTL 59 7.1 0.0001 lumbar vertebra mineral mass (VT:0010511) volumetric bone mineral density (CMO:0001553) 12 10474137 46669029 Rat 7411660 Foco28 Food consumption QTL 28 10.9 0.001 eating behavior trait (VT:0001431) feed conversion ratio (CMO:0001312) 12 1 42110980 Rat 1331755 Bp219 Blood pressure QTL 219 3.041 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 12 11073825 28064557 Rat 2312418 Kidm41 Kidney mass QTL 41 3.7 0.0001 kidney mass (VT:0002707) single kidney wet weight to body weight ratio (CMO:0000622) 12 1 19611090 Rat 7411641 Foco19 Food consumption QTL 19 27.7 0.001 eating behavior trait (VT:0001431) feed conversion ratio (CMO:0001312) 12 5564495 46669029 Rat 1549912 Bp268 Blood pressure QTL 268 arterial blood pressure trait (VT:2000000) diastolic blood pressure (CMO:0000005) 10 13182736 46669029 Rat 2302060 Pia37 Pristane induced arthritis QTL 37 6.1 0.001 blood immunoglobulin amount (VT:0002460) serum immunoglobulin G1 level (CMO:0002115) 12 13198157 46669029 Rat 1641928 Alcrsp5 Alcohol response QTL 5 response to alcohol trait (VT:0010489) duration of loss of righting reflex (CMO:0002289) 12 12812385 46669029 Rat 8552912 Pigfal6 Plasma insulin-like growth factor 1 level QTL 6 5 blood insulin-like growth factor amount (VT:0010479) plasma insulin-like growth factor 1 level (CMO:0001299) 12 5564498 46669029 Rat 10059594 Kidm46 Kidney mass QTL 46 3.79 0.025 kidney mass (VT:0002707) both kidneys wet weight to body weight ratio (CMO:0000340) 12 6107579 46669029 Rat 1581516 Cm56 Cardiac mass QTL 56 4.2 0.05 heart left ventricle mass (VT:0007031) heart left ventricle weight to body weight ratio (CMO:0000530) 12 1 29333307 Rat 9590086 Insglur6 Insulin/glucose ratio QTL 6 18.97 0.001 blood insulin amount (VT:0001560) calculated plasma insulin level (CMO:0002170) 12 1 42110980 Rat 8552918 Pigfal7 Plasma insulin-like growth factor 1 level QTL 7 blood insulin-like growth factor amount (VT:0010479) plasma insulin-like growth factor 1 level (CMO:0001299) 12 5564495 46669029 Rat 1549902 Bp269 Blood pressure QTL 269 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 12 13182736 46669029 Rat 61404 Bw120 Body weight QTL 120 5.1 body mass (VT:0001259) body mass index (BMI) (CMO:0000105) 12 12351619 46669029 Rat 1331786 Kidm11 Kidney mass QTL 11 3.571 kidney mass (VT:0002707) right kidney wet weight (CMO:0000082) 12 11073825 24234895 Rat 2293699 Bss49 Bone structure and strength QTL 49 5.61 0.0001 lumbar vertebra size trait (VT:0010518) lumbar vertebra trabecular cross-sectional area (CMO:0001692) 12 10474137 46669029 Rat 634351 Apr5 Acute phase response QTL 5 6.7 blood interleukin-6 amount (VT:0008595) plasma interleukin-6 level (CMO:0001927) 12 1 44503507 Rat 634350 Apr4 Acute phase response QTL 4 6 orosomucoid 1 amount (VT:0010541) plasma orosomucoid 1 level (CMO:0001467) 12 1172005 46172005 Rat 61416 Pia4 Pristane induced arthritis QTL 4 8.4 joint integrity trait (VT:0010548) arthritic paw count (CMO:0001460) 12 13635523 30827399 Rat 7204484 Bp358 Blood pressure QTL 358 0.001 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 12 13008296 19212979 Rat 7387292 Kidm42 Kidney mass QTL 42 3.03 0.0004 kidney mass (VT:0002707) left kidney wet weight (CMO:0000083) 12 1 36247923 Rat 61421 Cia12 Collagen induced arthritis QTL 12 4.6 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 12 13635523 35682913 Rat 2303569 Gluco44 Glucose level QTL 44 2 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 12 12812385 46669029 Rat 7411586 Foco5 Food consumption QTL 5 5.4 0.001 eating behavior trait (VT:0001431) feed conversion ratio (CMO:0001312) 12 1 42110980 Rat 2303575 Insul14 Insulin level QTL 14 4 blood insulin amount (VT:0001560) blood insulin level (CMO:0000349) 12 1 42450532 Rat 7411588 Foco6 Food consumption QTL 6 0.001 eating behavior trait (VT:0001431) feed conversion ratio (CMO:0001312) 12 5564495 46669029 Rat 2302042 Pia38 Pristane induced arthritis QTL 38 3.5 0.001 blood immunoglobulin amount (VT:0002460) serum immunoglobulin G1 level (CMO:0002115) 12 1 44503507 Rat 7411595 Foco9 Food consumption QTL 9 4 0.001 eating behavior trait (VT:0001431) feed conversion ratio (CMO:0001312) 12 1 42110980 Rat 7411597 Foco10 Food consumption QTL 10 0.001 eating behavior trait (VT:0001431) feed conversion ratio (CMO:0001312) 12 5564495 46669029 Rat 2293086 Iddm30 Insulin dependent diabetes mellitus QTL 30 3.82 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 12 8449490 28302290 Rat 631543 Bp83 Blood pressure QTL 83 5.8 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 12 15550826 38478808 Rat
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
2
7
28
84
36
36
13
21
13
2
110
64
71
25
45
23
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000053663
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 12 17,043,344 - 17,043,425 (-) Ensembl Rnor_6.0 Ensembl 12 19,307,752 - 19,307,833 (-) Ensembl
RefSeq Acc Id:
NR_031862
RefSeq Status:
PROVISIONAL
Type:
NON-CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 12 22,157,053 - 22,157,134 (-) NCBI mRatBN7.2 12 17,043,344 - 17,043,425 (-) NCBI Rnor_6.0 12 19,307,752 - 19,307,833 (-) NCBI Rnor_5.0 12 21,365,382 - 21,365,463 (-) NCBI Celera 12 18,973,514 - 18,973,595 (-) NCBI
Sequence:
CCTGCTGGGACTAAAGTGCTGACAGTGCAGATAGTGGTCCTCTCTGTGCTACCGCACTGTGGGTACTTGCTGCTCCAGCAGG
hide sequence
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2015-04-09
Mir106b
microRNA 106b
Mir106b
microRNA mir-106b
Name updated
61478
APPROVED
2010-06-02
Mir106b
microRNA mir-106b
Symbol and Name status set to provisional
70820
PROVISIONAL