Symbol:
LCN2
Name:
lipocalin 2
RGD ID:
18378717
Description:
ENCODES a protein that exhibits enterobactin binding (ortholog); identical protein binding (ortholog); protease binding (ortholog); INVOLVED IN acute-phase response (ortholog); cellular response to amyloid-beta (ortholog); cellular response to hydrogen peroxide (ortholog); ASSOCIATED WITH Abscess (ortholog); acute cystitis (ortholog); acute kidney failure (ortholog); FOUND IN extracellular space (ortholog)
Type:
protein-coding
RefSeq Status:
MODEL
Previously known as:
neutrophil gelatinase-associated lipocalin
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Species
Gene symbol and name
Data Source
Assertion derived from
less info ...
Orthologs 1
Homo sapiens (human):
LCN2 (lipocalin 2) NCBI
Ortholog
Mus musculus (house mouse):
Lcn2 (lipocalin 2) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Rattus norvegicus (Norway rat):
Lcn2 (lipocalin 2) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Pan paniscus (bonobo/pygmy chimpanzee):
LCN2 (lipocalin 2) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Canis lupus familiaris (dog):
LCN2 (lipocalin 2) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Ictidomys tridecemlineatus (thirteen-lined ground squirrel):
Lcn2 (lipocalin 2) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Sus scrofa (pig):
LCN2 (lipocalin 2) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Latest Assembly:
ChlSab1.1 - Green Monkey 1.1 Assembly
Position:
Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 12 9,976,278 - 9,981,087 (-) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 12 9,976,614 - 9,980,870 (-) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666079 6,251,600 - 6,256,754 (+) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
JBrowse:
View Region in Genome Browser (JBrowse)
Model
LCN2 Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 12 9,976,278 - 9,981,087 (-) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 12 9,976,614 - 9,980,870 (-) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666079 6,251,600 - 6,256,754 (+) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
LCN2 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 9 128,149,453 - 128,153,453 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 9 128,149,071 - 128,153,453 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 9 130,911,732 - 130,915,732 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 9 129,951,553 - 129,955,555 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 9 127,991,271 - 127,995,288 NCBI Celera 9 101,562,624 - 101,566,626 (+) NCBI Celera Cytogenetic Map 9 q34.11 NCBI HuRef 9 100,525,402 - 100,529,404 (+) NCBI HuRef CHM1_1 9 131,062,742 - 131,066,744 (+) NCBI CHM1_1 T2T-CHM13v2.0 9 140,356,542 - 140,360,542 (+) NCBI T2T-CHM13v2.0
Lcn2 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 2 32,274,649 - 32,277,751 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 2 32,274,645 - 32,278,264 (-) Ensembl GRCm39 Ensembl GRCm38 2 32,384,637 - 32,387,739 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 2 32,384,633 - 32,388,252 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 2 32,240,157 - 32,243,259 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 2 32,206,646 - 32,209,748 (-) NCBI MGSCv36 mm8 Celera 2 32,090,046 - 32,093,150 (-) NCBI Celera Cytogenetic Map 2 B NCBI cM Map 2 22.09 NCBI
Lcn2 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 3 36,078,432 - 36,081,851 (-) NCBI GRCr8 mRatBN7.2 3 15,680,688 - 15,684,033 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 3 15,680,687 - 15,684,095 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 3 18,749,510 - 18,752,856 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 3 27,334,505 - 27,337,851 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 3 25,585,359 - 25,588,705 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 3 11,414,189 - 11,417,534 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 3 11,414,186 - 11,417,546 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 3 16,763,059 - 16,766,404 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 3 11,511,402 - 11,514,747 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 3 11,407,773 - 11,411,119 (-) NCBI Celera 3 10,423,569 - 10,426,914 (-) NCBI Celera Cytogenetic Map 3 p12 NCBI
LCN2 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 11 11,199,073 - 11,214,309 (-) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 9 11,201,421 - 11,216,652 (-) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 9 99,259,278 - 99,274,494 (+) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 9 127,940,799 - 127,944,798 (+) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 9 127,940,799 - 127,944,798 (+) Ensembl panpan1.1 panPan2
LCN2 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 9 55,328,118 - 55,342,535 (-) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 9 55,328,133 - 55,332,038 (-) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 9 54,522,898 - 54,537,231 (-) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 9 56,250,316 - 56,264,670 (-) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 9 56,250,331 - 56,254,237 (-) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 9 55,010,191 - 55,024,522 (-) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 9 55,324,906 - 55,339,237 (-) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 9 55,416,588 - 55,430,934 (-) NCBI UU_Cfam_GSD_1.0
Lcn2 Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024404947 195,953,204 - 195,956,869 (+) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936487 15,721,684 - 15,728,221 (+) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936487 15,721,752 - 15,725,396 (+) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
LCN2 Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 1 268,609,887 - 268,614,644 (+) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 1 268,609,975 - 268,614,651 (+) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 1 302,600,679 - 302,609,836 (+) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
.
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
Ensembl Acc Id:
ENSCSAT00000012119 ⟹ ENSCSAP00000010167
Type:
CODING
Position:
Green Monkey Assembly Chr Position (strand) Source ChlSab1.1 Ensembl 12 9,976,614 - 9,980,870 (-) Ensembl
RefSeq Acc Id:
XM_008006094 ⟹ XP_008004285
Type:
CODING
Position:
Green Monkey Assembly Chr Position (strand) Source ChlSab1.1 12 9,976,278 - 9,981,087 (-) NCBI Vero_WHO_p1.0 NW_023666079 6,251,600 - 6,256,754 (+) NCBI
Sequence:
CCATCCCTCTGTCTTGCCCAATCCTGACCAGGGGCAGAAATCTTGCCAAGTGTTTCCGCGTGAGTTGCTGGCAATTGCCTCACCTTCCTGGTCTTGGCAAAGGATGAATCAGCCCACGCTACAGCCCA
hide sequence
RefSeq Acc Id:
XP_008004285 ⟸ XM_008006094
- UniProtKB:
A0A0D9RNH8 (UniProtKB/TrEMBL)
Ensembl Acc Id:
ENSCSAP00000010167 ⟸ ENSCSAT00000012119
