Symbol:
Trps1
Name:
transcriptional repressor GATA binding 1
RGD ID:
1311883
Description:
Predicted to enable DNA-binding transcription repressor activity, RNA polymerase II-specific; RNA polymerase II transcription regulatory region sequence-specific DNA binding activity; and protein domain specific binding activity. Predicted to be involved in several processes, including hair follicle development; negative regulation of transcription by RNA polymerase II; and regulation of chondrocyte differentiation. Predicted to act upstream of or within several processes, including cell surface receptor protein serine/threonine kinase signaling pathway; chondrocyte differentiation; and positive regulation of extrinsic apoptotic signaling pathway via death domain receptors. Predicted to be located in chromatin and nucleoplasm. Predicted to be part of protein-containing complex. Human ortholog(s) of this gene implicated in osteochondrodysplasia; trichorhinophalangeal syndrome type I; and trichorhinophalangeal syndrome type III. Orthologous to human TRPS1 (transcriptional repressor GATA binding 1); INTERACTS WITH 2,3,7,8-Tetrachlorodibenzofuran; 3,4-methylenedioxymethamphetamine; acetamide.
Type:
protein-coding
RefSeq Status:
PROVISIONAL
Previously known as:
LOC299897; trichorhinophalangeal syndrome I; trichorhinophalangeal syndrome I (human); trichorhinophalangeal syndrome I homolog; trichorhinophalangeal syndrome I homolog (human); zinc finger transcription factor Trps1
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 7 83,806,121 - 84,032,609 (-) NCBI GRCr8 mRatBN7.2 7 81,916,668 - 82,142,733 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 7 81,921,601 - 82,141,905 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 7 83,803,208 - 84,022,882 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 7 86,005,758 - 86,225,442 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 7 85,848,280 - 86,067,966 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 7 90,085,895 - 90,320,430 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 7 90,090,828 - 90,318,221 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 7 90,113,508 - 90,343,325 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 7 86,855,378 - 87,076,668 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 7 86,876,430 - 87,097,949 (-) NCBI Celera 7 78,810,727 - 79,029,498 (-) NCBI Celera Cytogenetic Map 7 q31 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Trps1 Rat 1,2-dichloroethane increases expression ISO Trps1 (Mus musculus) 6480464 ethylene dichloride results in increased expression of TRPS1 mRNA CTD PMID:28960355 Trps1 Rat 17beta-hydroxy-17-methylestra-4,9,11-trien-3-one decreases expression ISO TRPS1 (Homo sapiens) 6480464 Metribolone results in decreased expression of TRPS1 mRNA CTD PMID:19759027 Trps1 Rat 2,3,7,8-tetrachlorodibenzodioxine affects expression ISO Trps1 (Mus musculus) 6480464 Tetrachlorodibenzodioxin affects the expression of TRPS1 mRNA CTD PMID:21570461 and PMID:24058054 Trps1 Rat 2,3,7,8-tetrachlorodibenzodioxine increases expression ISO Trps1 (Mus musculus) 6480464 Tetrachlorodibenzodioxin results in increased expression of TRPS1 mRNA CTD PMID:21354282 and PMID:37172768 Trps1 Rat 2,3,7,8-Tetrachlorodibenzofuran decreases expression EXP 6480464 2 more ... CTD PMID:32109520 Trps1 Rat 3,4-methylenedioxymethamphetamine decreases expression EXP 6480464 N-Methyl-3 and 4-methylenedioxyamphetamine results in decreased expression of TRPS1 mRNA CTD PMID:30071829 Trps1 Rat 4-hydroxyphenyl retinamide decreases expression ISO Trps1 (Mus musculus) 6480464 Fenretinide results in decreased expression of TRPS1 mRNA CTD PMID:28973697 Trps1 Rat acetamide increases expression EXP 6480464 acetamide results in increased expression of TRPS1 mRNA CTD PMID:31881176 Trps1 Rat aflatoxin B1 decreases methylation ISO TRPS1 (Homo sapiens) 6480464 Aflatoxin B1 results in decreased methylation of TRPS1 gene CTD PMID:27153756 Trps1 Rat all-trans-retinoic acid increases expression ISO TRPS1 (Homo sapiens) 6480464 Tretinoin results in increased expression of TRPS1 mRNA CTD PMID:21934132 Trps1 Rat all-trans-retinoic acid increases expression EXP 6480464 Tretinoin results in increased expression of TRPS1 mRNA CTD PMID:20488242 Trps1 Rat alpha-Zearalanol multiple interactions EXP 6480464 [Zeranol co-treated with perfluorooctanoic acid] results in decreased expression of TRPS1 mRNA CTD PMID:35163327 Trps1 Rat amphotericin B decreases expression ISO TRPS1 (Homo sapiens) 6480464 Amphotericin B analog results in decreased expression of TRPS1 mRNA CTD PMID:28534445 Trps1 Rat aristolochic acid A decreases expression ISO TRPS1 (Homo sapiens) 6480464 aristolochic acid I results in decreased expression of TRPS1 mRNA CTD PMID:33212167 Trps1 Rat Aroclor 1254 decreases expression ISO Trps1 (Mus musculus) 6480464 Chlorodiphenyl (54% Chlorine) results in decreased expression of TRPS1 mRNA CTD PMID:23650126 Trps1 Rat arsenite(3-) multiple interactions ISO TRPS1 (Homo sapiens) 6480464 arsenite inhibits the reaction [G3BP1 protein binds to TRPS1 mRNA] CTD PMID:32406909 Trps1 Rat benzo[a]pyrene decreases expression ISO TRPS1 (Homo sapiens) 6480464 Benzo(a)pyrene results in decreased expression of TRPS1 mRNA CTD PMID:20064835 Trps1 Rat benzo[a]pyrene increases methylation ISO TRPS1 (Homo sapiens) 6480464 Benzo(a)pyrene results in increased methylation of TRPS1 3' UTR CTD PMID:27901495 Trps1 Rat benzo[a]pyrene affects methylation ISO TRPS1 (Homo sapiens) 6480464 Benzo(a)pyrene affects the methylation of TRPS1 5' UTR CTD PMID:27901495 Trps1 Rat benzo[a]pyrene increases expression ISO TRPS1 (Homo sapiens) 6480464 Benzo(a)pyrene results in increased expression of TRPS1 mRNA CTD PMID:22316170 Trps1 Rat bis(2-ethylhexyl) phthalate multiple interactions EXP 6480464 [bisphenol A co-treated with Diethylhexyl Phthalate co-treated with Dibutyl Phthalate] affects the methylation of TRPS1 promoter CTD PMID:23359474 Trps1 Rat bisphenol A multiple interactions EXP 6480464 [bisphenol A co-treated with Diethylhexyl Phthalate co-treated with Dibutyl Phthalate] affects the methylation of TRPS1 promoter CTD PMID:23359474 Trps1 Rat bisphenol A increases expression ISO Trps1 (Mus musculus) 6480464 bisphenol A results in increased expression of TRPS1 mRNA CTD PMID:35479511 Trps1 Rat bisphenol A increases expression ISO TRPS1 (Homo sapiens) 6480464 bisphenol A results in increased expression of TRPS1 mRNA CTD PMID:29275510 Trps1 Rat bisphenol A affects methylation ISO Trps1 (Mus musculus) 6480464 bisphenol A affects the methylation of TRPS1 promoter CTD PMID:27334623 Trps1 Rat bisphenol A increases expression EXP 6480464 bisphenol A results in increased expression of TRPS1 mRNA CTD PMID:29097150 Trps1 Rat bisphenol A decreases expression EXP 6480464 bisphenol A results in decreased expression of TRPS1 mRNA CTD PMID:25181051 more ... Trps1 Rat calciol decreases expression EXP 6480464 Cholecalciferol results in decreased expression of TRPS1 mRNA CTD PMID:19759027 Trps1 Rat chloroprene increases expression EXP 6480464 Chloroprene results in increased expression of TRPS1 mRNA CTD PMID:23125180 Trps1 Rat chlorpyrifos decreases expression ISO Trps1 (Mus musculus) 6480464 Chlorpyrifos results in decreased expression of TRPS1 mRNA CTD PMID:37019170 Trps1 Rat choline multiple interactions ISO Trps1 (Mus musculus) 6480464 [Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in increased expression of TRPS1 mRNA CTD PMID:20938992 Trps1 Rat cobalt dichloride decreases expression EXP 6480464 cobaltous chloride results in decreased expression of TRPS1 mRNA CTD PMID:24386269 Trps1 Rat coumarin decreases phosphorylation ISO TRPS1 (Homo sapiens) 6480464 coumarin results in decreased phosphorylation of TRPS1 protein CTD PMID:35688186 Trps1 Rat DDE decreases expression ISO TRPS1 (Homo sapiens) 6480464 Dichlorodiphenyl Dichloroethylene results in decreased expression of TRPS1 mRNA CTD PMID:38568856 Trps1 Rat dexamethasone decreases expression ISO TRPS1 (Homo sapiens) 6480464 Dexamethasone results in decreased expression of TRPS1 mRNA CTD PMID:25047013 Trps1 Rat Dibutyl phosphate affects expression ISO TRPS1 (Homo sapiens) 6480464 di-n-butylphosphoric acid affects the expression of TRPS1 mRNA CTD PMID:37042841 Trps1 Rat dibutyl phthalate decreases expression EXP 6480464 Dibutyl Phthalate results in decreased expression of TRPS1 mRNA CTD PMID:24893172 Trps1 Rat dibutyl phthalate multiple interactions EXP 6480464 [bisphenol A co-treated with Diethylhexyl Phthalate co-treated with Dibutyl Phthalate] affects the methylation of TRPS1 promoter CTD PMID:23359474 Trps1 Rat dichloromethane increases expression ISO Trps1 (Mus musculus) 6480464 Methylene Chloride results in increased expression of TRPS1 mRNA CTD PMID:28392392 Trps1 Rat diquat decreases expression ISO Trps1 (Mus musculus) 6480464 Diquat results in decreased expression of TRPS1 mRNA CTD PMID:36851058 Trps1 Rat dorsomorphin multiple interactions ISO TRPS1 (Homo sapiens) 6480464 [NOG protein co-treated with entinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1 more ... CTD PMID:27188386 Trps1 Rat doxorubicin multiple interactions ISO Trps1 (Mus musculus) 6480464 [Doxorubicin co-treated with Folic Acid] results in increased expression of TRPS1 mRNA CTD PMID:28608983 Trps1 Rat endosulfan decreases expression EXP 6480464 Endosulfan results in decreased expression of TRPS1 mRNA CTD PMID:29391264 Trps1 Rat entinostat increases expression ISO TRPS1 (Homo sapiens) 6480464 entinostat results in increased expression of TRPS1 mRNA CTD PMID:26272509 Trps1 Rat entinostat multiple interactions ISO TRPS1 (Homo sapiens) 6480464 [NOG protein co-treated with entinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of TRPS1 mRNA CTD PMID:27188386 Trps1 Rat fenvalerate increases expression EXP 6480464 fenvalerate results in increased expression of TRPS1 mRNA CTD PMID:30307764 Trps1 Rat folic acid multiple interactions ISO Trps1 (Mus musculus) 6480464 [Doxorubicin co-treated with Folic Acid] results in increased expression of TRPS1 mRNA and [Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in increased expression of TRPS1 mRNA CTD PMID:20938992 and PMID:28608983 Trps1 Rat folic acid decreases expression ISO Trps1 (Mus musculus) 6480464 Folic Acid results in decreased expression of TRPS1 mRNA CTD PMID:25629700 Trps1 Rat formaldehyde decreases expression ISO TRPS1 (Homo sapiens) 6480464 Formaldehyde results in decreased expression of TRPS1 mRNA CTD PMID:20655997 Trps1 Rat FR900359 affects phosphorylation ISO TRPS1 (Homo sapiens) 6480464 FR900359 affects the phosphorylation of TRPS1 protein CTD PMID:37730182 Trps1 Rat gentamycin increases expression EXP 6480464 Gentamicins results in increased expression of TRPS1 mRNA CTD PMID:33387578 Trps1 Rat geraniol increases expression ISO TRPS1 (Homo sapiens) 6480464 geraniol results in increased expression of TRPS1 mRNA CTD PMID:27683099 Trps1 Rat L-methionine multiple interactions ISO Trps1 (Mus musculus) 6480464 [Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in increased expression of TRPS1 mRNA CTD PMID:20938992 Trps1 Rat mercury dibromide increases expression ISO TRPS1 (Homo sapiens) 6480464 mercuric bromide results in increased expression of TRPS1 mRNA CTD PMID:26272509 Trps1 Rat mercury dibromide multiple interactions ISO TRPS1 (Homo sapiens) 6480464 [NOG protein co-treated with mercuric bromide co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of TRPS1 mRNA CTD PMID:27188386 Trps1 Rat methylmercury chloride increases expression ISO TRPS1 (Homo sapiens) 6480464 methylmercuric chloride results in increased expression of TRPS1 mRNA CTD PMID:28001369 Trps1 Rat nickel atom decreases expression ISO TRPS1 (Homo sapiens) 6480464 Nickel results in decreased expression of TRPS1 mRNA CTD PMID:25583101 Trps1 Rat panobinostat multiple interactions ISO TRPS1 (Homo sapiens) 6480464 [NOG protein co-treated with Panobinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of TRPS1 mRNA CTD PMID:27188386 Trps1 Rat panobinostat increases expression ISO TRPS1 (Homo sapiens) 6480464 panobinostat results in increased expression of TRPS1 mRNA CTD PMID:26272509 Trps1 Rat paracetamol affects expression ISO Trps1 (Mus musculus) 6480464 Acetaminophen affects the expression of TRPS1 mRNA CTD PMID:17562736 Trps1 Rat paracetamol decreases expression EXP 6480464 Acetaminophen results in decreased expression of TRPS1 mRNA CTD PMID:33387578 Trps1 Rat perfluorooctanoic acid multiple interactions EXP 6480464 [Zeranol co-treated with perfluorooctanoic acid] results in decreased expression of TRPS1 mRNA CTD PMID:35163327 Trps1 Rat phenylmercury acetate increases expression ISO TRPS1 (Homo sapiens) 6480464 Phenylmercuric Acetate results in increased expression of TRPS1 mRNA CTD PMID:26272509 Trps1 Rat phenylmercury acetate multiple interactions ISO TRPS1 (Homo sapiens) 6480464 [NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of TRPS1 mRNA CTD PMID:27188386 Trps1 Rat pregnenolone 16alpha-carbonitrile decreases expression ISO Trps1 (Mus musculus) 6480464 Pregnenolone Carbonitrile results in decreased expression of TRPS1 mRNA CTD PMID:22698814 Trps1 Rat SB 431542 multiple interactions ISO TRPS1 (Homo sapiens) 6480464 [NOG protein co-treated with entinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1 more ... CTD PMID:27188386 Trps1 Rat silver atom decreases expression ISO Trps1 (Mus musculus) 6480464 Silver results in decreased expression of TRPS1 mRNA CTD PMID:27131904 Trps1 Rat silver(0) decreases expression ISO Trps1 (Mus musculus) 6480464 Silver results in decreased expression of TRPS1 mRNA CTD PMID:27131904 Trps1 Rat sodium arsenate increases expression ISO Trps1 (Mus musculus) 6480464 sodium arsenate results in increased expression of TRPS1 mRNA CTD PMID:21795629 Trps1 Rat sodium arsenite increases expression ISO TRPS1 (Homo sapiens) 6480464 sodium arsenite results in increased expression of TRPS1 mRNA CTD PMID:22714537 Trps1 Rat sodium arsenite decreases expression ISO Trps1 (Mus musculus) 6480464 sodium arsenite results in decreased expression of TRPS1 mRNA CTD PMID:36209798 and PMID:37682722 Trps1 Rat sodium arsenite affects methylation ISO TRPS1 (Homo sapiens) 6480464 sodium arsenite affects the methylation of TRPS1 gene CTD PMID:28589171 Trps1 Rat succimer multiple interactions ISO Trps1 (Mus musculus) 6480464 [Succimer binds to Magnetite Nanoparticles] which results in decreased expression of TRPS1 mRNA and [Succimer co-treated with Magnetite Nanoparticles] results in decreased expression of TRPS1 mRNA CTD PMID:21641980 and PMID:26378955 Trps1 Rat sulforaphane increases expression ISO TRPS1 (Homo sapiens) 6480464 sulforaphane results in increased expression of TRPS1 mRNA CTD PMID:26833863 Trps1 Rat sunitinib decreases expression ISO TRPS1 (Homo sapiens) 6480464 Sunitinib results in decreased expression of TRPS1 mRNA CTD PMID:31533062 Trps1 Rat tetrachloroethene decreases expression ISO Trps1 (Mus musculus) 6480464 Tetrachloroethylene results in decreased expression of TRPS1 mRNA CTD PMID:28973375 Trps1 Rat thioacetamide increases expression EXP 6480464 Thioacetamide results in increased expression of TRPS1 mRNA CTD PMID:34492290 Trps1 Rat titanium dioxide decreases methylation ISO Trps1 (Mus musculus) 6480464 titanium dioxide results in decreased methylation of TRPS1 promoter CTD PMID:35295148 Trps1 Rat topotecan decreases expression EXP 6480464 Topotecan results in decreased expression of TRPS1 mRNA CTD PMID:25729387 Trps1 Rat trichostatin A increases expression ISO TRPS1 (Homo sapiens) 6480464 trichostatin A results in increased expression of TRPS1 mRNA CTD PMID:24935251 and PMID:26272509 Trps1 Rat trichostatin A multiple interactions ISO TRPS1 (Homo sapiens) 6480464 [NOG protein co-treated with trichostatin A co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of TRPS1 mRNA CTD PMID:27188386 Trps1 Rat triptonide decreases expression ISO Trps1 (Mus musculus) 6480464 triptonide results in decreased expression of TRPS1 mRNA CTD PMID:33045310 Trps1 Rat valproic acid affects expression ISO TRPS1 (Homo sapiens) 6480464 Valproic Acid affects the expression of TRPS1 mRNA CTD PMID:25979313 Trps1 Rat valproic acid affects splicing EXP 6480464 Valproic Acid affects the splicing of TRPS1 mRNA CTD PMID:29427782 Trps1 Rat valproic acid decreases expression EXP 6480464 Valproic Acid results in decreased expression of TRPS1 mRNA CTD PMID:29427782 Trps1 Rat valproic acid multiple interactions ISO TRPS1 (Homo sapiens) 6480464 [NOG protein co-treated with Valproic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of TRPS1 mRNA CTD PMID:27188386 Trps1 Rat valproic acid increases expression ISO TRPS1 (Homo sapiens) 6480464 Valproic Acid results in increased expression of TRPS1 mRNA CTD PMID:23179753 more ... Trps1 Rat vinclozolin affects expression EXP 6480464 vinclozolin affects the expression of TRPS1 mRNA CTD PMID:19015723 Trps1 Rat vorinostat increases expression ISO TRPS1 (Homo sapiens) 6480464 vorinostat results in increased expression of TRPS1 mRNA CTD PMID:26272509 Trps1 Rat vorinostat multiple interactions ISO TRPS1 (Homo sapiens) 6480464 [NOG protein co-treated with Vorinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of TRPS1 mRNA CTD PMID:27188386
1,2-dichloroethane (ISO) 17beta-hydroxy-17-methylestra-4,9,11-trien-3-one (ISO) 2,3,7,8-tetrachlorodibenzodioxine (ISO) 2,3,7,8-Tetrachlorodibenzofuran (EXP) 3,4-methylenedioxymethamphetamine (EXP) 4-hydroxyphenyl retinamide (ISO) acetamide (EXP) aflatoxin B1 (ISO) all-trans-retinoic acid (EXP,ISO) alpha-Zearalanol (EXP) amphotericin B (ISO) aristolochic acid A (ISO) Aroclor 1254 (ISO) arsenite(3-) (ISO) benzo[a]pyrene (ISO) bis(2-ethylhexyl) phthalate (EXP) bisphenol A (EXP,ISO) calciol (EXP) chloroprene (EXP) chlorpyrifos (ISO) choline (ISO) cobalt dichloride (EXP) coumarin (ISO) DDE (ISO) dexamethasone (ISO) Dibutyl phosphate (ISO) dibutyl phthalate (EXP) dichloromethane (ISO) diquat (ISO) dorsomorphin (ISO) doxorubicin (ISO) endosulfan (EXP) entinostat (ISO) fenvalerate (EXP) folic acid (ISO) formaldehyde (ISO) FR900359 (ISO) gentamycin (EXP) geraniol (ISO) L-methionine (ISO) mercury dibromide (ISO) methylmercury chloride (ISO) nickel atom (ISO) panobinostat (ISO) paracetamol (EXP,ISO) perfluorooctanoic acid (EXP) phenylmercury acetate (ISO) pregnenolone 16alpha-carbonitrile (ISO) SB 431542 (ISO) silver atom (ISO) silver(0) (ISO) sodium arsenate (ISO) sodium arsenite (ISO) succimer (ISO) sulforaphane (ISO) sunitinib (ISO) tetrachloroethene (ISO) thioacetamide (EXP) titanium dioxide (ISO) topotecan (EXP) trichostatin A (ISO) triptonide (ISO) valproic acid (EXP,ISO) vinclozolin (EXP) vorinostat (ISO)
Trps1 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 7 83,806,121 - 84,032,609 (-) NCBI GRCr8 mRatBN7.2 7 81,916,668 - 82,142,733 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 7 81,921,601 - 82,141,905 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 7 83,803,208 - 84,022,882 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 7 86,005,758 - 86,225,442 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 7 85,848,280 - 86,067,966 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 7 90,085,895 - 90,320,430 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 7 90,090,828 - 90,318,221 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 7 90,113,508 - 90,343,325 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 7 86,855,378 - 87,076,668 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 7 86,876,430 - 87,097,949 (-) NCBI Celera 7 78,810,727 - 79,029,498 (-) NCBI Celera Cytogenetic Map 7 q31 NCBI
TRPS1 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 8 115,408,496 - 115,668,975 (-) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 8 115,408,496 - 115,809,673 (-) Ensembl GRCh38 hg38 GRCh38 GRCh37 8 116,420,724 - 116,681,202 (-) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 8 116,489,900 - 116,750,402 (-) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 8 116,489,899 - 116,750,429 NCBI Celera 8 112,607,772 - 112,867,949 (-) NCBI Celera Cytogenetic Map 8 q23.3 NCBI HuRef 8 111,746,115 - 111,962,229 (-) NCBI HuRef CHM1_1 8 116,461,345 - 116,721,859 (-) NCBI CHM1_1 T2T-CHM13v2.0 8 116,535,995 - 116,796,128 (-) NCBI T2T-CHM13v2.0
Trps1 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 15 50,518,149 - 50,754,027 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 15 50,518,148 - 50,753,859 (-) Ensembl GRCm39 Ensembl GRCm38 15 50,654,757 - 50,890,631 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 15 50,654,752 - 50,890,463 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 15 50,486,303 - 50,721,587 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 15 50,490,516 - 50,720,115 (-) NCBI MGSCv36 mm8 Celera 15 52,221,354 - 52,433,937 (-) NCBI Celera Cytogenetic Map 15 C NCBI cM Map 15 19.18 NCBI
Trps1 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955417 21,680,116 - 21,913,173 (-) Ensembl ChiLan1.0 ChiLan1.0 NW_004955417 21,674,545 - 21,913,137 (-) NCBI ChiLan1.0 ChiLan1.0
TRPS1 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 7 132,802,726 - 133,069,136 (-) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 8 108,326,565 - 108,588,056 (-) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 8 112,079,147 - 112,339,567 (-) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 8 114,626,357 - 114,854,222 (-) NCBI panpan1.1 PanPan1.1 panPan2
TRPS1 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 13 15,017,180 - 15,273,177 (-) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 13 15,022,652 - 15,273,666 (-) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 13 15,005,955 - 15,263,461 (-) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 13 15,305,244 - 15,563,018 (-) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 13 15,308,610 - 15,562,778 (-) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 13 15,053,664 - 15,309,547 (-) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 13 15,150,277 - 15,407,958 (-) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 13 15,394,399 - 15,652,945 (-) NCBI UU_Cfam_GSD_1.0
Trps1 Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024405303 23,004,744 - 23,244,503 (+) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936470 30,432,625 - 30,665,091 (+) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936470 30,475,779 - 30,666,546 (+) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
TRPS1
TRPS1 Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 8 110,048,277 - 110,306,342 (-) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 8 110,050,705 - 110,260,394 (-) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666039 30,041,925 - 30,303,926 (+) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Trps1
.
Predicted Target Of
Count of predictions: 158 Count of miRNA genes: 131 Interacting mature miRNAs: 133 Transcripts: ENSRNOT00000050774 Prediction methods: Microtar, Miranda, Rnahybrid Result types: miRGate_prediction
1300179 Kidm5 Kidney mass QTL 5 3.51 kidney mass (VT:0002707) left kidney wet weight (CMO:0000083) 7 43747012 135012528 Rat 2293667 Bss42 Bone structure and strength QTL 42 7.25 0.0001 lumbar vertebra size trait (VT:0010518) lumbar vertebra cross-sectional area (CMO:0001689) 7 47651439 92651439 Rat 10053722 Scort27 Serum corticosterone level QTL 27 2.41 0.0083 blood corticosterone amount (VT:0005345) plasma corticosterone level (CMO:0001173) 7 43228750 88228750 Rat 1331728 Bp214 Blood pressure QTL 214 2.825 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 7 80221299 124373579 Rat 2317035 Aia16 Adjuvant induced arthritis QTL 16 2.71 joint integrity trait (VT:0010548) right rear ankle joint diameter (CMO:0002150) 7 59238038 104238038 Rat 1300127 Srn1 Serum renin concentration QTL 1 3.87 blood renin amount (VT:0003349) plasma renin activity level (CMO:0000116) 7 29409683 84928080 Rat 2293678 Bss24 Bone structure and strength QTL 24 6.71 0.0001 femur morphology trait (VT:0000559) femur cross-sectional area (CMO:0001661) 7 47651439 92651439 Rat 1358361 Sradr5 Stress Responsive Adrenal Weight QTL 5 5.55 adrenal gland mass (VT:0010420) both adrenal glands wet weight (CMO:0000164) 7 43747012 108555253 Rat 1357338 Stl17 Serum triglyceride level QTL 17 3.23 blood triglyceride amount (VT:0002644) serum triglyceride level (CMO:0000360) 7 69736356 112729554 Rat 631513 Scl7 Serum cholesterol level QTL 7 4.1 blood cholesterol amount (VT:0000180) serum total cholesterol level (CMO:0000363) 7 37960569 82960569 Rat 634331 Pia17 Pristane induced arthritis QTL 17 4.7 joint integrity trait (VT:0010548) arthritic paw count (CMO:0001460) 7 73829340 130221005 Rat 2293685 Bmd21 Bone mineral density QTL 21 4.2 0.0003 femur mineral mass (VT:0010011) total volumetric bone mineral density (CMO:0001728) 7 47651439 92651439 Rat 631504 Cm27 Cardiac mass QTL 27 3.45 heart left ventricle mass (VT:0007031) heart left ventricle wet weight (CMO:0000071) 7 44421311 118198041 Rat 70173 Niddm19 Non-insulin dependent diabetes mellitus QTL 19 4.33 0.00005 blood glucose amount (VT:0000188) blood glucose level area under curve (AUC) (CMO:0000350) 7 64002457 135012528 Rat 634326 Hc3 Hypercalciuria QTL 3 2.1 urine calcium amount (VT:0002985) urine calcium excretion rate (CMO:0000763) 7 42787314 87787314 Rat 2317052 Aia17 Adjuvant induced arthritis QTL 17 2.13 joint integrity trait (VT:0010548) left rear ankle joint diameter (CMO:0002149) 7 81737938 126737938 Rat 631529 Tls2 T-lymphoma susceptibility QTL 2 0 0.001 thymus integrity trait (VT:0010555) percentage of study population developing T-cell lymphomas during a period of time (CMO:0001911) 7 80221299 109401111 Rat 2293696 Bmd32 Bone mineral density QTL 32 5.1 0.0001 femur strength trait (VT:0010010) femoral neck polar moment of inertia (CMO:0001670) 7 47651439 92651439 Rat 1300151 Bp181 Blood pressure QTL 181 3.36 arterial blood pressure trait (VT:2000000) diastolic blood pressure (CMO:0000005) 7 53612714 103945643 Rat 1559283 Emca4 Estrogen-induced mammary cancer QTL 4 3.7 mammary gland integrity trait (VT:0010552) percentage of study population developing mammary tumors during a period of time (CMO:0000948) 7 62004452 101773158 Rat 1643004 Pain2 Pain QTL 2 1 mechanical nociception trait (VT:0002734) self mutilation severity score (CMO:0002145) 7 9462246 98011544 Rat 738030 Anxrr8 Anxiety related response QTL 8 4.1 exploratory behavior trait (VT:0010471) number of entries into a discrete space in an experimental apparatus (CMO:0000960) 7 46590070 91590070 Rat 1300149 Cm6 Cardiac mass QTL 6 4.09 heart mass (VT:0007028) heart left ventricle weight to body weight ratio (CMO:0000530) 7 43747099 102228765 Rat 7411607 Foco15 Food consumption QTL 15 0.001 eating behavior trait (VT:0001431) feed conversion ratio (CMO:0001312) 7 75918751 120918751 Rat 634336 Anxrr17 Anxiety related response QTL 17 3.66 locomotor behavior trait (VT:0001392) number of entries into a discrete space in an experimental apparatus (CMO:0000960) 7 924703 115097879 Rat 2293707 Bss32 Bone structure and strength QTL 32 7.64 0.0001 femur strength trait (VT:0010010) femur midshaft polar moment of inertia (CMO:0001669) 7 47651439 92651439 Rat 1331768 Kidm10 Kidney mass QTL 10 4.62096 kidney mass (VT:0002707) left kidney wet weight (CMO:0000083) 7 80221299 125221299 Rat 61357 Bp38 Blood pressure QTL 38 1.6 0.052 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 7 41333674 119109060 Rat 1641908 Teswt1 Testicular weight QTL 1 3.28 testis mass (VT:1000644) both testes wet weight (CMO:0000175) 7 80221299 94811326 Rat 2293644 Bmd29 Bone mineral density QTL 29 5.4 0.0001 femur size trait (VT:1000369) femoral neck cross-sectional area (CMO:0001697) 7 47651439 92651439 Rat 2316947 Rf58 Renal function QTL 58 7.8 kidney glomerulus morphology trait (VT:0005325) index of glomerular damage (CMO:0001135) 7 68938720 113886318 Rat 2300178 Bmd54 Bone mineral density QTL 54 5.3 0.0001 femur mineral mass (VT:0010011) volumetric bone mineral density (CMO:0001553) 7 47651439 92651439 Rat 724537 Niddm52 Non-insulin dependent diabetes mellitus QTL 52 0.02 blood glucose amount (VT:0000188) blood glucose level area under curve (AUC) (CMO:0000350) 7 80221299 93595843 Rat 1298528 Bp169 Blood pressure QTL 169 0.0001 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 7 61074194 106074194 Rat 61428 Scl3 Serum cholesterol level QTL 3 3.2 blood cholesterol amount (VT:0000180) serum total cholesterol level (CMO:0000363) 7 44867533 89867533 Rat 1331746 Kidm9 Kidney mass QTL 9 3.934 kidney mass (VT:0002707) right kidney wet weight (CMO:0000082) 7 80221299 112308525 Rat 1300132 Bp182 Blood pressure QTL 182 3.49 arterial blood pressure trait (VT:2000000) blood pressure time series experimental set point of the baroreceptor response (CMO:0002593) 7 19654317 84928080 Rat 1576303 Ept7 Estrogen-induced pituitary tumorigenesis QTL 7 3.7 pituitary gland mass (VT:0010496) pituitary gland wet weight (CMO:0000853) 7 62004452 101773158 Rat 7411654 Foco25 Food consumption QTL 25 9.3 0.001 eating behavior trait (VT:0001431) feed conversion ratio (CMO:0001312) 7 75918751 120918751 Rat 2316955 Stl24 Serum triglyceride level QTL 24 7.1 blood triglyceride amount (VT:0002644) plasma triglyceride level (CMO:0000548) 7 68938720 113886318 Rat 2316952 Pur22 Proteinuria QTL 22 5.2 urine protein amount (VT:0005160) urine protein level (CMO:0000591) 7 68938720 113886318 Rat 631540 Bw9 Body weight QTL 9 4.5 body mass (VT:0001259) body weight (CMO:0000012) 7 69736226 117455174 Rat
AI447310
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 7 81,919,710 - 81,919,825 (+) MAPPER mRatBN7.2 Rnor_6.0 7 90,088,938 - 90,089,052 NCBI Rnor6.0 Rnor_5.0 7 90,116,994 - 90,117,108 UniSTS Rnor5.0 RGSC_v3.4 7 86,853,488 - 86,853,602 UniSTS RGSC3.4 Celera 7 78,808,837 - 78,808,951 UniSTS Cytogenetic Map 7 q31 UniSTS
AU046994
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 7 82,131,965 - 82,132,073 (+) MAPPER mRatBN7.2 Rnor_6.0 7 90,308,833 - 90,308,940 NCBI Rnor6.0 Rnor_5.0 7 90,333,937 - 90,334,044 UniSTS Rnor5.0 RGSC_v3.4 7 87,067,280 - 87,067,387 UniSTS RGSC3.4 Celera 7 79,020,126 - 79,020,217 UniSTS Cytogenetic Map 7 q31 UniSTS
BM384689
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 7 81,921,484 - 81,921,643 (+) MAPPER mRatBN7.2 Rnor_6.0 7 90,090,712 - 90,090,870 NCBI Rnor6.0 Rnor_5.0 7 90,118,768 - 90,118,926 UniSTS Rnor5.0 RGSC_v3.4 7 86,855,262 - 86,855,420 UniSTS RGSC3.4 Celera 7 78,810,611 - 78,810,769 UniSTS RH 3.4 Map 7 537.4 UniSTS Cytogenetic Map 7 q31 UniSTS
Trps1
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 7 82,099,874 - 82,100,574 (+) MAPPER mRatBN7.2 Rnor_6.0 7 90,276,663 - 90,277,362 NCBI Rnor6.0 Rnor_5.0 7 90,301,767 - 90,302,466 UniSTS Rnor5.0 Celera 7 78,988,051 - 78,988,750 UniSTS Cytogenetic Map 7 q31 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
11
49
113
91
90
59
25
59
6
218
97
93
45
60
31
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000050774 ⟹ ENSRNOP00000039913
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 7 81,921,601 - 82,141,354 (-) Ensembl Rnor_6.0 Ensembl 7 90,090,828 - 90,318,221 (-) Ensembl
Ensembl Acc Id:
ENSRNOT00000094294 ⟹ ENSRNOP00000077022
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 7 81,921,601 - 82,141,551 (-) Ensembl
Ensembl Acc Id:
ENSRNOT00000097264 ⟹ ENSRNOP00000088310
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 7 81,921,601 - 82,141,905 (-) Ensembl
Ensembl Acc Id:
ENSRNOT00000106247 ⟹ ENSRNOP00000083606
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 7 81,921,601 - 82,141,551 (-) Ensembl
Ensembl Acc Id:
ENSRNOT00000110775 ⟹ ENSRNOP00000096700
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 7 81,921,601 - 82,100,639 (-) Ensembl
RefSeq Acc Id:
NM_001134837 ⟹ NP_001128309
RefSeq Status:
PROVISIONAL
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 7 83,811,497 - 84,031,235 (-) NCBI mRatBN7.2 7 81,921,601 - 82,141,354 (-) NCBI Rnor_6.0 7 90,090,828 - 90,318,221 (-) NCBI Rnor_5.0 7 90,113,508 - 90,343,325 (-) NCBI RGSC_v3.4 7 86,855,378 - 87,076,668 (-) RGD Celera 7 78,810,727 - 79,029,498 (-) RGD
Sequence:
CCCCACTCCCCCTCGCTGTCTCTTGCTGGCTGATTTTAATTCTCTCCTACCGGGAGCAGCAGAGGATCTGGAGGTGGCTGGACCCGAGGGGCCGCCGCCGCCGCCGCTGCAAGTTTTCTGGGGGCTCC
hide sequence
RefSeq Acc Id:
XM_039078760 ⟹ XP_038934688
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 7 83,806,121 - 84,031,020 (-) NCBI mRatBN7.2 7 81,916,668 - 82,141,137 (-) NCBI
RefSeq Acc Id:
XM_039078761 ⟹ XP_038934689
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 7 83,806,121 - 84,031,019 (-) NCBI mRatBN7.2 7 81,916,668 - 82,141,137 (-) NCBI
RefSeq Acc Id:
XM_039078762 ⟹ XP_038934690
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 7 83,806,121 - 84,031,677 (-) NCBI mRatBN7.2 7 81,916,668 - 82,141,686 (-) NCBI
RefSeq Acc Id:
XM_039078764 ⟹ XP_038934692
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 7 83,806,121 - 84,001,792 (-) NCBI mRatBN7.2 7 81,916,668 - 82,105,530 (-) NCBI
RefSeq Acc Id:
XM_039078765 ⟹ XP_038934693
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 7 83,806,121 - 84,032,609 (-) NCBI mRatBN7.2 7 81,916,668 - 82,142,733 (-) NCBI
RefSeq Acc Id:
XM_039078767 ⟹ XP_038934695
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 7 83,806,121 - 84,030,447 (-) NCBI mRatBN7.2 7 81,916,668 - 82,140,568 (-) NCBI
RefSeq Acc Id:
XM_039078768 ⟹ XP_038934696
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 7 83,806,121 - 84,031,020 (-) NCBI mRatBN7.2 7 81,916,668 - 82,141,138 (-) NCBI
RefSeq Acc Id:
XM_063263244 ⟹ XP_063119314
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 7 83,806,121 - 84,031,675 (-) NCBI
RefSeq Acc Id:
NP_001128309 ⟸ NM_001134837
- UniProtKB:
A6HRD1 (UniProtKB/TrEMBL), A0A8I5Y133 (UniProtKB/TrEMBL)
- Sequence:
MVRKKNPPLRNVASEGEGQTLEPTATESKASGKNKEFSADQMSENTDQSDVAELNTKEEHSTHGQEPSSSSKKDLQISGLSEKAGFNYESPSKGGNLASFPHDEVTDRNMLAFSSPAAGGVCEPLKSP
hide sequence
Ensembl Acc Id:
ENSRNOP00000039913 ⟸ ENSRNOT00000050774
RefSeq Acc Id:
XP_038934693 ⟸ XM_039078765
- Peptide Label:
isoform X4
- UniProtKB:
D3ZEM6 (UniProtKB/TrEMBL), A0A8I5Y133 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_038934690 ⟸ XM_039078762
- Peptide Label:
isoform X3
- UniProtKB:
A0A8I5Y133 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_038934696 ⟸ XM_039078768
- Peptide Label:
isoform X6
- UniProtKB:
A0A8I5Y133 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_038934689 ⟸ XM_039078761
- Peptide Label:
isoform X2
- UniProtKB:
A0A8I5Y133 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_038934688 ⟸ XM_039078760
- Peptide Label:
isoform X1
- UniProtKB:
A0A8I5Y133 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_038934695 ⟸ XM_039078767
- Peptide Label:
isoform X4
- UniProtKB:
D3ZEM6 (UniProtKB/TrEMBL), A0A8I5Y133 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_038934692 ⟸ XM_039078764
- Peptide Label:
isoform X4
- UniProtKB:
D3ZEM6 (UniProtKB/TrEMBL), A0A8I5Y133 (UniProtKB/TrEMBL)
Ensembl Acc Id:
ENSRNOP00000083606 ⟸ ENSRNOT00000106247
Ensembl Acc Id:
ENSRNOP00000096700 ⟸ ENSRNOT00000110775
Ensembl Acc Id:
ENSRNOP00000077022 ⟸ ENSRNOT00000094294
Ensembl Acc Id:
ENSRNOP00000088310 ⟸ ENSRNOT00000097264
RefSeq Acc Id:
XP_063119314 ⟸ XM_063263244
- Peptide Label:
isoform X5
- UniProtKB:
A0A8I5ZWX6 (UniProtKB/TrEMBL), A0A8I5Y133 (UniProtKB/TrEMBL)
RGD ID: 13695321 Promoter ID: EPDNEW_R5846 Type: multiple initiation site Name: Trps1_1 Description: transcriptional repressor GATA binding 1 SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Rat Assembly Chr Position (strand) Source Rnor_6.0 7 90,318,190 - 90,318,250 EPDNEW
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2016-02-19
Trps1
transcriptional repressor GATA binding 1
Trps1
trichorhinophalangeal syndrome I
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2011-09-29
Trps1
trichorhinophalangeal syndrome I
Trps1
trichorhinophalangeal syndrome I homolog (human)
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2008-12-15
Trps1
trichorhinophalangeal syndrome I homolog (human)
Trps1
trichorhinophalangeal syndrome I (human)
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2008-03-04
Trps1
trichorhinophalangeal syndrome I (human)
Trps1_predicted
trichorhinophalangeal syndrome I (predicted)
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2005-01-12
Trps1_predicted
trichorhinophalangeal syndrome I (predicted)
Symbol and Name status set to approved
70820 APPROVED
