Symbol:
Atp8b1
Name:
ATPase phospholipid transporting 8B1
RGD ID:
1308488
Description:
Enables phosphatidylserine flippase activity. Predicted to be involved in several processes, including apical protein localization; nervous system development; and phospholipid transport. Predicted to act upstream of or within bile acid metabolic process. Located in brush border membrane. Human ortholog(s) of this gene implicated in benign recurrent intrahepatic cholestasis 1; intrahepatic cholestasis; intrahepatic cholestasis of pregnancy 1; and progressive familial intrahepatic cholestasis 1. Orthologous to human ATP8B1 (ATPase phospholipid transporting 8B1); INTERACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; 2,3,7,8-Tetrachlorodibenzofuran; acetamide.
Type:
protein-coding
RefSeq Status:
PROVISIONAL
Previously known as:
ATPase, aminophospholipid transporter, class I, type 8B, member 1; ATPase, Class I, type 8B, member 1; LOC291555; P4-ATPase flippase complex alpha subunit ATP8B1; phospholipid-transporting ATPase IC; probable phospholipid-transporting ATPase IC
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Species
Gene symbol and name
Data Source
Assertion derived from
less info ...
Orthologs 1
Homo sapiens (human):
ATP8B1 (ATPase phospholipid transporting 8B1) HGNC
Ensembl, HomoloGene, Inparanoid, NCBI, OMA, OrthoDB, OrthoMCL, Panther, Treefam
Mus musculus (house mouse):
Atp8b1 (ATPase, class I, type 8B, member 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chinchilla lanigera (long-tailed chinchilla):
Atp8b1 (ATPase phospholipid transporting 8B1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Pan paniscus (bonobo/pygmy chimpanzee):
ATP8B1 (ATPase phospholipid transporting 8B1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Canis lupus familiaris (dog):
ATP8B1 (ATPase phospholipid transporting 8B1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Ictidomys tridecemlineatus (thirteen-lined ground squirrel):
Atp8b1 (ATPase phospholipid transporting 8B1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Sus scrofa (pig):
ATP8B1 (ATPase phospholipid transporting 8B1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chlorocebus sabaeus (green monkey):
ATP8B1 (ATPase phospholipid transporting 8B1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Heterocephalus glaber (naked mole-rat):
Atp8b1 (ATPase phospholipid transporting 8B1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Alliance orthologs 3
Homo sapiens (human):
ATP8B1 (ATPase phospholipid transporting 8B1)
Alliance
DIOPT (Ensembl Compara|HGNC|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Mus musculus (house mouse):
Atp8b1 (ATPase, class I, type 8B, member 1)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Danio rerio (zebrafish):
atp8b1 (ATPase phospholipid transporting 8B1)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Saccharomyces cerevisiae (baker's yeast):
DNF1
Alliance
DIOPT (Ensembl Compara|OMA|PANTHER)
Drosophila melanogaster (fruit fly):
ATP8B
Alliance
DIOPT (Ensembl Compara|Hieranoid|OrthoFinder|PANTHER|SonicParanoid)
Caenorhabditis elegans (roundworm):
tat-2
Alliance
DIOPT (Ensembl Compara|Hieranoid|OrthoFinder|PANTHER)
Xenopus tropicalis (tropical clawed frog):
atp8b1
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 18 60,286,605 - 60,427,862 (-) NCBI GRCr8 mRatBN7.2 18 58,016,382 - 58,157,213 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 18 58,018,268 - 58,157,396 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 18 60,100,745 - 60,181,408 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 18 60,812,277 - 60,893,191 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 18 58,641,968 - 58,722,898 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 18 60,013,388 - 60,152,920 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 18 60,013,382 - 60,095,354 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 18 59,223,547 - 59,362,294 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 18 60,748,738 - 60,829,650 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 18 60,822,079 - 60,960,656 (-) NCBI Celera 18 56,155,326 - 56,236,232 (-) NCBI Celera Cytogenetic Map 18 q12.1 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Atp8b1 Rat (-)-epigallocatechin 3-gallate multiple interactions ISO ATP8B1 (Homo sapiens) 6480464 [potassium chromate(VI) co-treated with epigallocatechin gallate] results in decreased expression of ATP8B1 mRNA CTD PMID:22079256 Atp8b1 Rat 1,2-dimethylhydrazine affects expression ISO Atp8b1 (Mus musculus) 6480464 1 and 2-Dimethylhydrazine affects the expression of ATP8B1 mRNA CTD PMID:22206623 Atp8b1 Rat 1-naphthyl isothiocyanate increases expression ISO Atp8b1 (Mus musculus) 6480464 1-Naphthylisothiocyanate results in increased expression of ATP8B1 mRNA CTD PMID:19407337 and PMID:28549656 Atp8b1 Rat 1-naphthyl isothiocyanate multiple interactions ISO Atp8b1 (Mus musculus) 6480464 18alpha-glycyrrhetinic acid inhibits the reaction [1-Naphthylisothiocyanate results in increased expression of ATP8B1 mRNA] CTD PMID:28549656 Atp8b1 Rat 1-nitropyrene increases expression ISO ATP8B1 (Homo sapiens) 6480464 1-nitropyrene results in increased expression of ATP8B1 mRNA CTD PMID:19041380 Atp8b1 Rat 17beta-estradiol affects expression ISO ATP8B1 (Homo sapiens) 6480464 Estradiol affects the expression of ATP8B1 mRNA CTD PMID:22574217 Atp8b1 Rat 17beta-estradiol increases expression ISO ATP8B1 (Homo sapiens) 6480464 Estradiol results in increased expression of ATP8B1 mRNA CTD PMID:31614463 Atp8b1 Rat 17beta-estradiol increases expression ISO Atp8b1 (Mus musculus) 6480464 Estradiol results in increased expression of ATP8B1 mRNA CTD PMID:39298647 Atp8b1 Rat 17beta-estradiol multiple interactions ISO ATP8B1 (Homo sapiens) 6480464 [Estradiol co-treated with Progesterone] results in decreased expression of ATP8B1 mRNA and [Estradiol co-treated with TGFB1 protein] results in decreased expression of ATP8B1 mRNA CTD PMID:20660070 and PMID:30165855 Atp8b1 Rat 17beta-estradiol decreases expression ISO ATP8B1 (Homo sapiens) 6480464 Estradiol results in decreased expression of ATP8B1 mRNA CTD PMID:19167446 Atp8b1 Rat 2,3,7,8-tetrachlorodibenzodioxine affects expression EXP 6480464 Tetrachlorodibenzodioxin affects the expression of ATP8B1 mRNA CTD PMID:22298810 and PMID:34747641 Atp8b1 Rat 2,3,7,8-Tetrachlorodibenzofuran decreases expression EXP 6480464 2 more ... CTD PMID:32109520 Atp8b1 Rat 3,4-methylenedioxymethamphetamine decreases expression ISO Atp8b1 (Mus musculus) 6480464 N-Methyl-3 and 4-methylenedioxyamphetamine results in decreased expression of ATP8B1 mRNA CTD PMID:26251327 Atp8b1 Rat 4,4'-diaminodiphenylmethane affects expression ISO Atp8b1 (Mus musculus) 6480464 4 and 4'-diaminodiphenylmethane affects the expression of ATP8B1 mRNA CTD PMID:18648102 Atp8b1 Rat 4,4'-sulfonyldiphenol increases expression ISO Atp8b1 (Mus musculus) 6480464 bisphenol S results in increased expression of ATP8B1 mRNA CTD PMID:39298647 Atp8b1 Rat 4-hydroxyphenyl retinamide increases expression ISO Atp8b1 (Mus musculus) 6480464 Fenretinide results in increased expression of ATP8B1 mRNA CTD PMID:28973697 Atp8b1 Rat acetamide decreases expression EXP 6480464 acetamide results in decreased expression of ATP8B1 mRNA CTD PMID:31881176 Atp8b1 Rat acrylamide decreases expression EXP 6480464 Acrylamide results in decreased expression of ATP8B1 mRNA CTD PMID:28959563 Atp8b1 Rat aflatoxin B1 affects expression ISO ATP8B1 (Homo sapiens) 6480464 Aflatoxin B1 affects the expression of ATP8B1 protein CTD PMID:20106945 Atp8b1 Rat all-trans-retinoic acid increases expression ISO ATP8B1 (Homo sapiens) 6480464 Tretinoin results in increased expression of ATP8B1 mRNA CTD PMID:21934132 Atp8b1 Rat all-trans-retinoic acid increases expression ISO Atp8b1 (Mus musculus) 6480464 Tretinoin results in increased expression of ATP8B1 mRNA CTD PMID:36189433 Atp8b1 Rat all-trans-retinoic acid multiple interactions ISO Atp8b1 (Mus musculus) 6480464 [mono-(2-ethylhexyl)phthalate co-treated with Tretinoin] results in increased expression of ATP8B1 mRNA CTD PMID:36189433 Atp8b1 Rat atazanavir sulfate multiple interactions ISO ATP8B1 (Homo sapiens) 6480464 [Glycochenodeoxycholic Acid co-treated with Deoxycholic Acid co-treated with Chenodeoxycholic Acid co-treated with Glycodeoxycholic Acid co-treated with Glycocholic Acid co-treated with Atazanavir Sulfate] results in decreased expression of ATP8B1 mRNA CTD PMID:33819548 Atp8b1 Rat ATP increases hydrolysis EXP 6480464 ATP8B1 protein results in increased hydrolysis of Adenosine Triphosphate CTD PMID:11584374 Atp8b1 Rat Azoxymethane multiple interactions ISO Atp8b1 (Mus musculus) 6480464 [titanium dioxide co-treated with Azoxymethane co-treated with Dextran Sulfate] results in increased expression of ATP8B1 mRNA CTD PMID:29950665 Atp8b1 Rat belinostat increases expression ISO ATP8B1 (Homo sapiens) 6480464 belinostat results in increased expression of ATP8B1 mRNA CTD PMID:26272509 Atp8b1 Rat belinostat multiple interactions ISO ATP8B1 (Homo sapiens) 6480464 [NOG protein co-treated with belinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of ATP8B1 mRNA CTD PMID:27188386 Atp8b1 Rat benzo[a]pyrene increases expression ISO Atp8b1 (Mus musculus) 6480464 Benzo(a)pyrene results in increased expression of ATP8B1 mRNA CTD PMID:20127859 and PMID:22228805 Atp8b1 Rat benzo[a]pyrene increases methylation ISO ATP8B1 (Homo sapiens) 6480464 Benzo(a)pyrene results in increased methylation of ATP8B1 promoter CTD PMID:27901495 Atp8b1 Rat benzo[a]pyrene decreases expression ISO ATP8B1 (Homo sapiens) 6480464 Benzo(a)pyrene results in decreased expression of ATP8B1 mRNA CTD PMID:20106945 and PMID:21632981 Atp8b1 Rat benzo[a]pyrene diol epoxide I decreases expression ISO ATP8B1 (Homo sapiens) 6480464 7 more ... CTD PMID:20018196 Atp8b1 Rat beta-carotene multiple interactions ISO Atp8b1 (Mus musculus) 6480464 [BCO1 protein affects the susceptibility to beta Carotene] which affects the expression of ATP8B1 mRNA CTD PMID:24657404 Atp8b1 Rat beta-lapachone decreases expression ISO ATP8B1 (Homo sapiens) 6480464 beta-lapachone results in decreased expression of ATP8B1 mRNA CTD PMID:38218311 Atp8b1 Rat bisphenol A affects expression EXP 6480464 bisphenol A affects the expression of ATP8B1 mRNA CTD PMID:25181051 Atp8b1 Rat bisphenol A decreases methylation ISO ATP8B1 (Homo sapiens) 6480464 bisphenol A results in decreased methylation of ATP8B1 gene CTD PMID:31601247 Atp8b1 Rat bisphenol A increases expression EXP 6480464 bisphenol A results in increased expression of ATP8B1 mRNA CTD PMID:32145629 and PMID:34947998 Atp8b1 Rat bisphenol A decreases expression ISO ATP8B1 (Homo sapiens) 6480464 bisphenol A results in decreased expression of ATP8B1 mRNA CTD PMID:29275510 Atp8b1 Rat bisphenol A increases methylation EXP 6480464 bisphenol A results in increased methylation of ATP8B1 gene CTD PMID:28505145 Atp8b1 Rat bisphenol A decreases expression EXP 6480464 bisphenol A results in decreased expression of ATP8B1 mRNA CTD PMID:30816183 and PMID:32528016 Atp8b1 Rat buta-1,3-diene decreases expression ISO Atp8b1 (Mus musculus) 6480464 1 and 3-butadiene results in decreased expression of ATP8B1 mRNA CTD PMID:21147608 Atp8b1 Rat cadmium atom multiple interactions ISO Atp8b1 (Mus musculus) 6480464 [Cadmium Chloride results in increased abundance of Cadmium] which results in increased expression of ATP8B1 mRNA CTD PMID:37325564 Atp8b1 Rat cadmium dichloride multiple interactions ISO Atp8b1 (Mus musculus) 6480464 [Cadmium Chloride results in increased abundance of Cadmium] which results in increased expression of ATP8B1 mRNA CTD PMID:37325564 Atp8b1 Rat calcitriol increases expression ISO ATP8B1 (Homo sapiens) 6480464 Calcitriol results in increased expression of ATP8B1 mRNA CTD PMID:16002434 Atp8b1 Rat calcium atom multiple interactions EXP 6480464 Calcium inhibits the reaction [ATP8B1 protein results in increased transport of Phosphatidylserines] CTD PMID:11584374 Atp8b1 Rat calcium(0) multiple interactions EXP 6480464 Calcium inhibits the reaction [ATP8B1 protein results in increased transport of Phosphatidylserines] CTD PMID:11584374 Atp8b1 Rat cannabidiol decreases expression ISO Atp8b1 (Mus musculus) 6480464 Cannabidiol results in decreased expression of ATP8B1 mRNA CTD PMID:31052254 Atp8b1 Rat carbon nanotube increases expression ISO Atp8b1 (Mus musculus) 6480464 Nanotubes more ... CTD PMID:25554681 and PMID:25620056 Atp8b1 Rat chenodeoxycholic acid multiple interactions ISO ATP8B1 (Homo sapiens) 6480464 [Glycochenodeoxycholic Acid co-treated with Deoxycholic Acid co-treated with Chenodeoxycholic Acid co-treated with Glycodeoxycholic Acid co-treated with Glycocholic Acid co-treated with Acetaminophen] results in decreased expression of ATP8B1 mRNA more ... CTD PMID:33819548 Atp8b1 Rat chloroprene decreases expression ISO Atp8b1 (Mus musculus) 6480464 Chloroprene results in decreased expression of ATP8B1 mRNA CTD PMID:23125180 Atp8b1 Rat chloroprene increases expression EXP 6480464 Chloroprene results in increased expression of ATP8B1 mRNA CTD PMID:23125180 Atp8b1 Rat cholic acid multiple interactions ISO Atp8b1 (Mus musculus) 6480464 [NR1H4 protein mutant form inhibits the reaction [Cholic Acid results in increased phosphorylation of NR1H4 protein]] which results in decreased expression of ATP8B1 mRNA CTD PMID:30996006 Atp8b1 Rat choline multiple interactions ISO Atp8b1 (Mus musculus) 6480464 [Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in decreased methylation of ATP8B1 gene CTD PMID:20938992 Atp8b1 Rat cobalt dichloride decreases expression ISO ATP8B1 (Homo sapiens) 6480464 cobaltous chloride results in decreased expression of ATP8B1 mRNA CTD PMID:19320972 Atp8b1 Rat coumestrol decreases expression ISO ATP8B1 (Homo sapiens) 6480464 Coumestrol results in decreased expression of ATP8B1 mRNA CTD PMID:19167446 Atp8b1 Rat crocidolite asbestos increases expression ISO ATP8B1 (Homo sapiens) 6480464 Asbestos and Crocidolite results in increased expression of ATP8B1 mRNA CTD PMID:18687144 Atp8b1 Rat cyclosporin A decreases expression ISO ATP8B1 (Homo sapiens) 6480464 Cyclosporine results in decreased expression of ATP8B1 mRNA CTD PMID:20106945 Atp8b1 Rat cyclosporin A multiple interactions ISO ATP8B1 (Homo sapiens) 6480464 [Glycochenodeoxycholic Acid co-treated with Deoxycholic Acid co-treated with Chenodeoxycholic Acid co-treated with Glycodeoxycholic Acid co-treated with Glycocholic Acid co-treated with Cyclosporine] results in decreased expression of ATP8B1 mRNA CTD PMID:33819548 Atp8b1 Rat cyproconazole increases expression EXP 6480464 cyproconazole results in increased expression of ATP8B1 mRNA CTD PMID:29038839 Atp8b1 Rat cyproconazole multiple interactions EXP 6480464 [cyproconazole co-treated with epoxiconazole] results in increased expression of ATP8B1 mRNA CTD PMID:29038839 Atp8b1 Rat deoxycholic acid multiple interactions ISO ATP8B1 (Homo sapiens) 6480464 [Glycochenodeoxycholic Acid co-treated with Deoxycholic Acid co-treated with Chenodeoxycholic Acid co-treated with Glycodeoxycholic Acid co-treated with Glycocholic Acid co-treated with Acetaminophen] results in decreased expression of ATP8B1 mRNA more ... CTD PMID:33819548 Atp8b1 Rat dextran sulfate multiple interactions ISO Atp8b1 (Mus musculus) 6480464 [titanium dioxide co-treated with Azoxymethane co-treated with Dextran Sulfate] results in increased expression of ATP8B1 mRNA CTD PMID:29950665 Atp8b1 Rat Dibutyl phosphate affects expression ISO ATP8B1 (Homo sapiens) 6480464 di-n-butylphosphoric acid affects the expression of ATP8B1 mRNA CTD PMID:37042841 Atp8b1 Rat dibutyl phthalate increases expression EXP 6480464 Dibutyl Phthalate results in increased expression of ATP8B1 mRNA CTD PMID:21266533 Atp8b1 Rat dibutyl phthalate increases expression ISO Atp8b1 (Mus musculus) 6480464 Dibutyl Phthalate results in increased expression of ATP8B1 mRNA CTD PMID:17361019 and PMID:21266533 Atp8b1 Rat diquat decreases expression ISO Atp8b1 (Mus musculus) 6480464 Diquat results in decreased expression of ATP8B1 protein CTD PMID:36851058 Atp8b1 Rat disodium selenite decreases expression ISO ATP8B1 (Homo sapiens) 6480464 Sodium Selenite results in decreased expression of ATP8B1 mRNA CTD PMID:18175754 Atp8b1 Rat diuron decreases expression EXP 6480464 Diuron results in decreased expression of ATP8B1 mRNA CTD PMID:25152437 Atp8b1 Rat dorsomorphin multiple interactions ISO ATP8B1 (Homo sapiens) 6480464 [NOG protein co-treated with belinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1 more ... CTD PMID:27188386 Atp8b1 Rat doxorubicin decreases expression ISO ATP8B1 (Homo sapiens) 6480464 Doxorubicin results in decreased expression of ATP8B1 mRNA CTD PMID:29803840 Atp8b1 Rat endosulfan decreases expression EXP 6480464 Endosulfan results in decreased expression of ATP8B1 mRNA CTD PMID:29391264 Atp8b1 Rat enilconazole increases expression ISO ATP8B1 (Homo sapiens) 6480464 enilconazole results in increased expression of ATP8B1 mRNA CTD PMID:32201337 Atp8b1 Rat entinostat increases expression ISO ATP8B1 (Homo sapiens) 6480464 entinostat results in increased expression of ATP8B1 mRNA CTD PMID:26272509 Atp8b1 Rat entinostat multiple interactions ISO ATP8B1 (Homo sapiens) 6480464 [NOG protein co-treated with entinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of ATP8B1 mRNA CTD PMID:27188386 Atp8b1 Rat epoxiconazole multiple interactions EXP 6480464 [cyproconazole co-treated with epoxiconazole] results in increased expression of ATP8B1 mRNA CTD PMID:29038839 Atp8b1 Rat epoxiconazole decreases expression ISO Atp8b1 (Mus musculus) 6480464 epoxiconazole results in decreased expression of ATP8B1 mRNA CTD PMID:35436446 Atp8b1 Rat epoxiconazole increases expression EXP 6480464 epoxiconazole results in increased expression of ATP8B1 mRNA CTD PMID:29038839 Atp8b1 Rat fenthion decreases expression ISO Atp8b1 (Mus musculus) 6480464 Fenthion results in decreased expression of ATP8B1 mRNA CTD PMID:34813904 Atp8b1 Rat flutamide decreases expression EXP 6480464 Flutamide results in decreased expression of ATP8B1 mRNA CTD PMID:24136188 and PMID:24793618 Atp8b1 Rat folic acid multiple interactions ISO Atp8b1 (Mus musculus) 6480464 [Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in decreased methylation of ATP8B1 gene CTD PMID:20938992 Atp8b1 Rat formaldehyde increases expression ISO ATP8B1 (Homo sapiens) 6480464 Formaldehyde results in increased expression of ATP8B1 mRNA CTD PMID:23649840 Atp8b1 Rat furan decreases methylation EXP 6480464 furan results in decreased methylation of ATP8B1 gene CTD PMID:22079235 Atp8b1 Rat gadodiamide hydrate increases expression ISO ATP8B1 (Homo sapiens) 6480464 gadodiamide results in increased expression of ATP8B1 mRNA CTD PMID:20959327 Atp8b1 Rat glycochenodeoxycholic acid multiple interactions ISO ATP8B1 (Homo sapiens) 6480464 [Glycochenodeoxycholic Acid co-treated with Deoxycholic Acid co-treated with Chenodeoxycholic Acid co-treated with Glycodeoxycholic Acid co-treated with Glycocholic Acid co-treated with Acetaminophen] results in decreased expression of ATP8B1 mRNA more ... CTD PMID:33819548 Atp8b1 Rat glycocholic acid multiple interactions ISO ATP8B1 (Homo sapiens) 6480464 [Glycochenodeoxycholic Acid co-treated with Deoxycholic Acid co-treated with Chenodeoxycholic Acid co-treated with Glycodeoxycholic Acid co-treated with Glycocholic Acid co-treated with Acetaminophen] results in decreased expression of ATP8B1 mRNA more ... CTD PMID:33819548 Atp8b1 Rat glycodeoxycholic acid multiple interactions ISO ATP8B1 (Homo sapiens) 6480464 [Glycochenodeoxycholic Acid co-treated with Deoxycholic Acid co-treated with Chenodeoxycholic Acid co-treated with Glycodeoxycholic Acid co-treated with Glycocholic Acid co-treated with Acetaminophen] results in decreased expression of ATP8B1 mRNA more ... CTD PMID:33819548 Atp8b1 Rat glycyrrhetinate multiple interactions ISO Atp8b1 (Mus musculus) 6480464 18alpha-glycyrrhetinic acid inhibits the reaction [1-Naphthylisothiocyanate results in increased expression of ATP8B1 mRNA] CTD PMID:28549656 Atp8b1 Rat glycyrrhetinic acid multiple interactions ISO Atp8b1 (Mus musculus) 6480464 18alpha-glycyrrhetinic acid inhibits the reaction [1-Naphthylisothiocyanate results in increased expression of ATP8B1 mRNA] CTD PMID:28549656 Atp8b1 Rat heptachlor multiple interactions ISO ATP8B1 (Homo sapiens) 6480464 [Insecticides results in increased abundance of Heptachlor] which affects the methylation of ATP8B1 gene CTD PMID:34516295 Atp8b1 Rat indometacin decreases expression ISO ATP8B1 (Homo sapiens) 6480464 Indomethacin results in decreased expression of ATP8B1 mRNA CTD PMID:16984733 Atp8b1 Rat irinotecan affects expression EXP 6480464 Irinotecan affects the expression of ATP8B1 mRNA CTD PMID:20097248 Atp8b1 Rat isoprenaline increases expression ISO Atp8b1 (Mus musculus) 6480464 Isoproterenol results in increased expression of ATP8B1 mRNA CTD PMID:20003209 Atp8b1 Rat L-methionine multiple interactions ISO Atp8b1 (Mus musculus) 6480464 [Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in decreased methylation of ATP8B1 gene CTD PMID:20938992 Atp8b1 Rat lead(0) decreases expression ISO ATP8B1 (Homo sapiens) 6480464 Lead results in decreased expression of ATP8B1 mRNA CTD PMID:19921347 Atp8b1 Rat lipopolysaccharide multiple interactions ISO ATP8B1 (Homo sapiens) 6480464 [S-(1 more ... CTD PMID:35811015 Atp8b1 Rat manganese atom multiple interactions ISO ATP8B1 (Homo sapiens) 6480464 [manganese chloride results in increased abundance of Manganese] which results in increased expression of ATP8B1 mRNA CTD PMID:39836092 Atp8b1 Rat manganese(0) multiple interactions ISO ATP8B1 (Homo sapiens) 6480464 [manganese chloride results in increased abundance of Manganese] which results in increased expression of ATP8B1 mRNA CTD PMID:39836092 Atp8b1 Rat manganese(II) chloride multiple interactions ISO ATP8B1 (Homo sapiens) 6480464 [manganese chloride results in increased abundance of Manganese] which results in increased expression of ATP8B1 mRNA CTD PMID:39836092 Atp8b1 Rat mercury dibromide increases expression ISO ATP8B1 (Homo sapiens) 6480464 mercuric bromide results in increased expression of ATP8B1 mRNA CTD PMID:26272509 Atp8b1 Rat mercury dibromide multiple interactions ISO ATP8B1 (Homo sapiens) 6480464 [NOG protein co-treated with mercuric bromide co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of ATP8B1 mRNA CTD PMID:27188386 Atp8b1 Rat methapyrilene increases expression EXP 6480464 Methapyrilene results in increased expression of ATP8B1 mRNA CTD PMID:28935588 Atp8b1 Rat methidathion decreases expression ISO Atp8b1 (Mus musculus) 6480464 methidathion results in decreased expression of ATP8B1 mRNA CTD PMID:34813904 Atp8b1 Rat methylmercury chloride increases expression ISO ATP8B1 (Homo sapiens) 6480464 methylmercuric chloride results in increased expression of ATP8B1 mRNA CTD PMID:28001369 Atp8b1 Rat mono(2-ethylhexyl) phthalate multiple interactions ISO Atp8b1 (Mus musculus) 6480464 [mono-(2-ethylhexyl)phthalate co-treated with Tretinoin] results in increased expression of ATP8B1 mRNA CTD PMID:36189433 Atp8b1 Rat N-ethylmaleimide multiple interactions EXP 6480464 Ethylmaleimide inhibits the reaction [ATP8B1 protein results in increased transport of Phosphatidylserines] CTD PMID:11584374 Atp8b1 Rat N-methyl-4-phenylpyridinium decreases expression ISO ATP8B1 (Homo sapiens) 6480464 1-Methyl-4-phenylpyridinium results in decreased expression of ATP8B1 mRNA CTD PMID:24810058 Atp8b1 Rat oxaliplatin multiple interactions EXP 6480464 [oxaliplatin co-treated with Topotecan] results in increased expression of ATP8B1 mRNA CTD PMID:25729387 Atp8b1 Rat p-chloromercuribenzoic acid increases expression ISO ATP8B1 (Homo sapiens) 6480464 p-Chloromercuribenzoic Acid results in increased expression of ATP8B1 mRNA CTD PMID:26272509 Atp8b1 Rat p-chloromercuribenzoic acid multiple interactions ISO ATP8B1 (Homo sapiens) 6480464 [NOG protein co-treated with p-Chloromercuribenzoic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of ATP8B1 mRNA CTD PMID:27188386 Atp8b1 Rat panobinostat multiple interactions ISO ATP8B1 (Homo sapiens) 6480464 [NOG protein co-treated with Panobinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of ATP8B1 mRNA CTD PMID:27188386 Atp8b1 Rat panobinostat increases expression ISO ATP8B1 (Homo sapiens) 6480464 panobinostat results in increased expression of ATP8B1 mRNA CTD PMID:26272509 Atp8b1 Rat paracetamol decreases expression ISO ATP8B1 (Homo sapiens) 6480464 Acetaminophen results in decreased expression of ATP8B1 mRNA CTD PMID:21420995 Atp8b1 Rat paracetamol multiple interactions ISO ATP8B1 (Homo sapiens) 6480464 [Glycochenodeoxycholic Acid co-treated with Deoxycholic Acid co-treated with Chenodeoxycholic Acid co-treated with Glycodeoxycholic Acid co-treated with Glycocholic Acid co-treated with Acetaminophen] results in decreased expression of ATP8B1 mRNA CTD PMID:33819548 Atp8b1 Rat paraquat increases expression EXP 6480464 Paraquat results in increased expression of ATP8B1 mRNA CTD PMID:32680482 Atp8b1 Rat parathion decreases expression ISO Atp8b1 (Mus musculus) 6480464 Parathion results in decreased expression of ATP8B1 mRNA CTD PMID:34813904 Atp8b1 Rat perfluorohexanesulfonic acid increases expression ISO Atp8b1 (Mus musculus) 6480464 perfluorohexanesulfonic acid results in increased expression of ATP8B1 mRNA CTD PMID:37995155 Atp8b1 Rat perfluorooctanoic acid decreases expression ISO Atp8b1 (Mus musculus) 6480464 perfluorooctanoic acid results in decreased expression of ATP8B1 mRNA CTD PMID:17681415 Atp8b1 Rat phenobarbital affects expression ISO Atp8b1 (Mus musculus) 6480464 Phenobarbital affects the expression of ATP8B1 mRNA CTD PMID:23091169 Atp8b1 Rat phenylmercury acetate increases expression ISO ATP8B1 (Homo sapiens) 6480464 Phenylmercuric Acetate results in increased expression of ATP8B1 mRNA CTD PMID:26272509 Atp8b1 Rat phenylmercury acetate multiple interactions ISO ATP8B1 (Homo sapiens) 6480464 [NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of ATP8B1 mRNA CTD PMID:27188386 Atp8b1 Rat pirinixic acid multiple interactions ISO Atp8b1 (Mus musculus) 6480464 [pirinixic acid binds to and results in increased activity of PPARA protein] which results in decreased expression of ATP8B1 mRNA CTD PMID:19710929 Atp8b1 Rat pirinixic acid decreases expression ISO Atp8b1 (Mus musculus) 6480464 pirinixic acid results in decreased expression of ATP8B1 mRNA CTD PMID:23811191 Atp8b1 Rat potassium chromate decreases expression ISO ATP8B1 (Homo sapiens) 6480464 potassium chromate(VI) results in decreased expression of ATP8B1 mRNA CTD PMID:22079256 Atp8b1 Rat potassium chromate multiple interactions ISO ATP8B1 (Homo sapiens) 6480464 [potassium chromate(VI) co-treated with epigallocatechin gallate] results in decreased expression of ATP8B1 mRNA CTD PMID:22079256 Atp8b1 Rat potassium dichromate decreases expression ISO Atp8b1 (Mus musculus) 6480464 Potassium Dichromate results in decreased expression of ATP8B1 mRNA CTD PMID:23608068 Atp8b1 Rat prochloraz increases expression EXP 6480464 prochloraz results in increased expression of ATP8B1 mRNA CTD PMID:29038839 Atp8b1 Rat progesterone multiple interactions ISO ATP8B1 (Homo sapiens) 6480464 [Estradiol co-treated with Progesterone] results in decreased expression of ATP8B1 mRNA CTD PMID:20660070 Atp8b1 Rat progesterone decreases expression ISO ATP8B1 (Homo sapiens) 6480464 Progesterone results in decreased expression of ATP8B1 mRNA CTD PMID:20864642 Atp8b1 Rat quercetin decreases expression ISO ATP8B1 (Homo sapiens) 6480464 Quercetin results in decreased expression of ATP8B1 mRNA CTD PMID:21632981 Atp8b1 Rat resveratrol multiple interactions ISO ATP8B1 (Homo sapiens) 6480464 [Plant Extracts co-treated with Resveratrol] results in decreased expression of ATP8B1 mRNA CTD PMID:23557933 Atp8b1 Rat rotenone increases expression EXP 6480464 Rotenone results in increased expression of ATP8B1 mRNA CTD PMID:28374803 Atp8b1 Rat S-(1,2-dichlorovinyl)-L-cysteine decreases expression ISO ATP8B1 (Homo sapiens) 6480464 S-(1 and 2-dichlorovinyl)cysteine results in decreased expression of ATP8B1 mRNA CTD PMID:35811015 Atp8b1 Rat S-(1,2-dichlorovinyl)-L-cysteine multiple interactions ISO ATP8B1 (Homo sapiens) 6480464 [S-(1 more ... CTD PMID:35811015 Atp8b1 Rat SB 431542 multiple interactions ISO ATP8B1 (Homo sapiens) 6480464 [NOG protein co-treated with belinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1 more ... CTD PMID:27188386 Atp8b1 Rat sodium azide multiple interactions EXP 6480464 Sodium Azide inhibits the reaction [ATP8B1 protein results in increased transport of Phosphatidylserines] CTD PMID:11584374 Atp8b1 Rat tartrazine multiple interactions ISO ATP8B1 (Homo sapiens) 6480464 [Glycochenodeoxycholic Acid co-treated with Deoxycholic Acid co-treated with Chenodeoxycholic Acid co-treated with Glycodeoxycholic Acid co-treated with Glycocholic Acid co-treated with Tartrazine] results in decreased expression of ATP8B1 mRNA CTD PMID:33819548 Atp8b1 Rat testosterone enanthate affects expression ISO ATP8B1 (Homo sapiens) 6480464 testosterone enanthate affects the expression of ATP8B1 mRNA CTD PMID:17440010 Atp8b1 Rat tetrachloromethane decreases expression ISO Atp8b1 (Mus musculus) 6480464 Carbon Tetrachloride results in decreased expression of ATP8B1 mRNA CTD PMID:17484886 and PMID:31919559 Atp8b1 Rat thapsigargin decreases expression EXP 6480464 Thapsigargin results in decreased expression of ATP8B1 protein CTD PMID:35544339 Atp8b1 Rat thioacetamide decreases expression EXP 6480464 Thioacetamide results in decreased expression of ATP8B1 mRNA CTD PMID:26222700 Atp8b1 Rat titanium dioxide increases expression ISO Atp8b1 (Mus musculus) 6480464 titanium dioxide results in increased expression of ATP8B1 mRNA CTD PMID:27760801 Atp8b1 Rat titanium dioxide decreases methylation ISO Atp8b1 (Mus musculus) 6480464 titanium dioxide results in decreased methylation of ATP8B1 gene CTD PMID:35295148 Atp8b1 Rat titanium dioxide multiple interactions ISO Atp8b1 (Mus musculus) 6480464 [titanium dioxide co-treated with Azoxymethane co-treated with Dextran Sulfate] results in increased expression of ATP8B1 mRNA CTD PMID:29950665 Atp8b1 Rat topotecan increases expression EXP 6480464 Topotecan results in increased expression of ATP8B1 mRNA CTD PMID:25729387 Atp8b1 Rat topotecan multiple interactions EXP 6480464 [oxaliplatin co-treated with Topotecan] results in increased expression of ATP8B1 mRNA CTD PMID:25729387 Atp8b1 Rat triadimefon decreases expression ISO ATP8B1 (Homo sapiens) 6480464 triadimefon results in decreased expression of ATP8B1 mRNA CTD PMID:26705709 Atp8b1 Rat trichostatin A increases expression ISO ATP8B1 (Homo sapiens) 6480464 trichostatin A results in increased expression of ATP8B1 mRNA CTD PMID:24935251 more ... Atp8b1 Rat trichostatin A multiple interactions ISO ATP8B1 (Homo sapiens) 6480464 [NOG protein co-treated with trichostatin A co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of ATP8B1 mRNA CTD PMID:27188386 Atp8b1 Rat triphenyl phosphate affects expression EXP 6480464 triphenyl phosphate affects the expression of ATP8B1 mRNA CTD PMID:30589522 Atp8b1 Rat triptonide increases expression ISO Atp8b1 (Mus musculus) 6480464 triptonide results in increased expression of ATP8B1 mRNA CTD PMID:33045310 Atp8b1 Rat ursodeoxycholic acid decreases expression ISO Atp8b1 (Mus musculus) 6480464 Ursodeoxycholic Acid results in decreased expression of ATP8B1 mRNA CTD PMID:25582706 Atp8b1 Rat valproic acid affects expression ISO ATP8B1 (Homo sapiens) 6480464 Valproic Acid affects the expression of ATP8B1 mRNA CTD PMID:25979313 Atp8b1 Rat valproic acid multiple interactions ISO ATP8B1 (Homo sapiens) 6480464 [NOG protein co-treated with Valproic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of ATP8B1 mRNA CTD PMID:27188386 Atp8b1 Rat valproic acid increases expression ISO ATP8B1 (Homo sapiens) 6480464 Valproic Acid results in increased expression of ATP8B1 mRNA CTD PMID:23179753 more ... Atp8b1 Rat vitamin E decreases expression ISO ATP8B1 (Homo sapiens) 6480464 Vitamin E results in decreased expression of ATP8B1 mRNA CTD PMID:19244175 Atp8b1 Rat vorinostat multiple interactions ISO ATP8B1 (Homo sapiens) 6480464 [NOG protein co-treated with Vorinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of ATP8B1 mRNA CTD PMID:27188386 Atp8b1 Rat zidovudine decreases expression ISO ATP8B1 (Homo sapiens) 6480464 Zidovudine results in decreased expression of ATP8B1 mRNA CTD PMID:16894629
(-)-epigallocatechin 3-gallate (ISO) 1,2-dimethylhydrazine (ISO) 1-naphthyl isothiocyanate (ISO) 1-nitropyrene (ISO) 17beta-estradiol (ISO) 2,3,7,8-tetrachlorodibenzodioxine (EXP) 2,3,7,8-Tetrachlorodibenzofuran (EXP) 3,4-methylenedioxymethamphetamine (ISO) 4,4'-diaminodiphenylmethane (ISO) 4,4'-sulfonyldiphenol (ISO) 4-hydroxyphenyl retinamide (ISO) acetamide (EXP) acrylamide (EXP) aflatoxin B1 (ISO) all-trans-retinoic acid (ISO) atazanavir sulfate (ISO) ATP (EXP) Azoxymethane (ISO) belinostat (ISO) benzo[a]pyrene (ISO) benzo[a]pyrene diol epoxide I (ISO) beta-carotene (ISO) beta-lapachone (ISO) bisphenol A (EXP,ISO) buta-1,3-diene (ISO) cadmium atom (ISO) cadmium dichloride (ISO) calcitriol (ISO) calcium atom (EXP) calcium(0) (EXP) cannabidiol (ISO) carbon nanotube (ISO) chenodeoxycholic acid (ISO) chloroprene (EXP,ISO) cholic acid (ISO) choline (ISO) cobalt dichloride (ISO) coumestrol (ISO) crocidolite asbestos (ISO) cyclosporin A (ISO) cyproconazole (EXP) deoxycholic acid (ISO) dextran sulfate (ISO) Dibutyl phosphate (ISO) dibutyl phthalate (EXP,ISO) diquat (ISO) disodium selenite (ISO) diuron (EXP) dorsomorphin (ISO) doxorubicin (ISO) endosulfan (EXP) enilconazole (ISO) entinostat (ISO) epoxiconazole (EXP,ISO) fenthion (ISO) flutamide (EXP) folic acid (ISO) formaldehyde (ISO) furan (EXP) gadodiamide hydrate (ISO) glycochenodeoxycholic acid (ISO) glycocholic acid (ISO) glycodeoxycholic acid (ISO) glycyrrhetinate (ISO) glycyrrhetinic acid (ISO) heptachlor (ISO) indometacin (ISO) irinotecan (EXP) isoprenaline (ISO) L-methionine (ISO) lead(0) (ISO) lipopolysaccharide (ISO) manganese atom (ISO) manganese(0) (ISO) manganese(II) chloride (ISO) mercury dibromide (ISO) methapyrilene (EXP) methidathion (ISO) methylmercury chloride (ISO) mono(2-ethylhexyl) phthalate (ISO) N-ethylmaleimide (EXP) N-methyl-4-phenylpyridinium (ISO) oxaliplatin (EXP) p-chloromercuribenzoic acid (ISO) panobinostat (ISO) paracetamol (ISO) paraquat (EXP) parathion (ISO) perfluorohexanesulfonic acid (ISO) perfluorooctanoic acid (ISO) phenobarbital (ISO) phenylmercury acetate (ISO) pirinixic acid (ISO) potassium chromate (ISO) potassium dichromate (ISO) prochloraz (EXP) progesterone (ISO) quercetin (ISO) resveratrol (ISO) rotenone (EXP) S-(1,2-dichlorovinyl)-L-cysteine (ISO) SB 431542 (ISO) sodium azide (EXP) tartrazine (ISO) testosterone enanthate (ISO) tetrachloromethane (ISO) thapsigargin (EXP) thioacetamide (EXP) titanium dioxide (ISO) topotecan (EXP) triadimefon (ISO) trichostatin A (ISO) triphenyl phosphate (EXP) triptonide (ISO) ursodeoxycholic acid (ISO) valproic acid (ISO) vitamin E (ISO) vorinostat (ISO) zidovudine (ISO)
Biological Process
aminophospholipid translocation (IEA) aminophospholipid transport (IEA,ISO) apical protein localization (IEA,ISO) bile acid and bile salt transport (IEA,ISO) bile acid metabolic process (IEA,ISO) biological_process (ND) Golgi organization (IBA) inner ear receptor cell development (IEA,ISO) negative regulation of DNA-templated transcription (IEA,ISO) organic anion transport (IEA,ISO) phospholipid translocation (IBA,IEA,ISO) phospholipid transport (IEA) regulation of chloride transport (IEA,ISO) regulation of microvillus assembly (IEA,ISO) regulation of plasma membrane organization (IEA,ISO) sensory perception of sound (IEA,ISO) vestibulocochlear nerve formation (IEA,ISO) xenobiotic transmembrane transport (IEA,ISO)
Cellular Component
apical plasma membrane (IEA,ISO) brush border membrane (IDA) cell projection (IEA) cytosol (IEA,ISO) endoplasmic reticulum (IEA,ISO) Golgi apparatus (IEA,ISO) membrane (IEA) nuclear body (IEA,ISO) nucleoplasm (IEA,ISO) phospholipid-translocating ATPase complex (IEA,ISO,ISS) plasma membrane (IBA,IEA,ISO) stereocilium (IEA,ISO) trans-Golgi network (IBA)
1.
A gene encoding a P-type ATPase mutated in two forms of hereditary cholestasis.
Bull LN, etal., Nat Genet. 1998 Mar;18(3):219-24.
2.
ATP8B1 deficiency disrupts the bile canalicular membrane bilayer structure in hepatocytes, but FXR expression and activity are maintained.
Cai SY, etal., Gastroenterology. 2009 Mar;136(3):1060-9. doi: 10.1053/j.gastro.2008.10.025. Epub 2008 Nov 1.
3.
FIC1, the protein affected in two forms of hereditary cholestasis, is localized in the cholangiocyte and the canalicular membrane of the hepatocyte.
Eppens EF, etal., J Hepatol. 2001 Oct;35(4):436-43.
4.
Phylogenetic-based propagation of functional annotations within the Gene Ontology consortium.
Gaudet P, etal., Brief Bioinform. 2011 Sep;12(5):449-62. doi: 10.1093/bib/bbr042. Epub 2011 Aug 27.
5.
Rat ISS GO annotations from GOA human gene data--August 2006
GOA data from the GO Consortium
6.
Rat ISS GO annotations from MGI mouse gene data--August 2006
MGD data from the GO Consortium
7.
OMIM Disease Annotation Pipeline
OMIM Disease Annotation Pipeline
8.
ClinVar Automated Import and Annotation Pipeline
RGD automated import pipeline for ClinVar variants, variant-to-disease annotations and gene-to-disease annotations
9.
Data Import for Chemical-Gene Interactions
RGD automated import pipeline for gene-chemical interactions
10.
Comprehensive gene review and curation
RGD comprehensive gene curation
11.
Recurrent familial intrahepatic cholestasis in the Faeroe Islands. Phenotypic heterogeneity but genetic homogeneity.
Tygstrup N, etal., Hepatology. 1999 Feb;29(2):506-8. doi: 10.1002/hep.510290214.
12.
Familial intrahepatic cholestasis 1: studies of localization and function.
Ujhazy P, etal., Hepatology. 2001 Oct;34(4 Pt 1):768-75.
Atp8b1 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 18 60,286,605 - 60,427,862 (-) NCBI GRCr8 mRatBN7.2 18 58,016,382 - 58,157,213 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 18 58,018,268 - 58,157,396 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 18 60,100,745 - 60,181,408 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 18 60,812,277 - 60,893,191 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 18 58,641,968 - 58,722,898 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 18 60,013,388 - 60,152,920 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 18 60,013,382 - 60,095,354 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 18 59,223,547 - 59,362,294 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 18 60,748,738 - 60,829,650 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 18 60,822,079 - 60,960,656 (-) NCBI Celera 18 56,155,326 - 56,236,232 (-) NCBI Celera Cytogenetic Map 18 q12.1 NCBI
ATP8B1 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 18 57,646,426 - 57,803,315 (-) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 18 57,646,426 - 57,803,315 (-) Ensembl GRCh38 hg38 GRCh38 GRCh37 18 55,313,658 - 55,470,547 (-) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 18 53,464,656 - 53,550,037 (-) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 18 53,466,585 - 53,550,037 NCBI Celera 18 52,031,466 - 52,187,934 (-) NCBI Celera Cytogenetic Map 18 q21.31 ENTREZGENE HuRef 18 52,024,999 - 52,180,652 (-) NCBI HuRef CHM1_1 18 55,309,031 - 55,466,164 (-) NCBI CHM1_1 T2T-CHM13v2.0 18 57,847,030 - 58,003,571 (-) NCBI T2T-CHM13v2.0
Atp8b1 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 18 64,662,050 - 64,794,342 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 18 64,662,038 - 64,794,338 (-) Ensembl GRCm39 Ensembl GRCm38 18 64,528,979 - 64,661,272 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 18 64,528,967 - 64,661,267 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 18 64,688,633 - 64,820,654 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 18 64,654,348 - 64,786,369 (-) NCBI MGSCv36 mm8 Celera 18 65,795,381 - 65,929,579 (-) NCBI Celera Cytogenetic Map 18 E1 NCBI cM Map 18 37.49 NCBI
Atp8b1 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955402 41,996,001 - 42,113,895 (-) Ensembl ChiLan1.0 ChiLan1.0 NW_004955402 41,994,993 - 42,113,380 (-) NCBI ChiLan1.0 ChiLan1.0
ATP8B1 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 17 75,183,233 - 75,337,189 (-) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 18 60,875,498 - 61,029,604 (-) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 18 51,035,483 - 51,187,461 (-) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 18 54,370,844 - 54,522,158 (-) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 18 54,370,447 - 54,522,196 (-) Ensembl panpan1.1 panPan2
ATP8B1 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 1 18,156,664 - 18,279,131 (+) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 1 18,156,410 - 18,277,904 (+) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 1 19,140,072 - 19,262,621 (+) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 1 18,037,713 - 18,160,586 (+) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 1 18,037,170 - 18,160,558 (+) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 1 18,094,570 - 18,217,205 (+) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 1 17,992,383 - 18,114,996 (+) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 1 18,261,266 - 18,383,909 (+) NCBI UU_Cfam_GSD_1.0
Atp8b1 Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024404944 31,413,185 - 31,471,774 (+) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936497 6,652,185 - 6,713,034 (+) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936497 6,652,240 - 6,712,960 (+) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
ATP8B1
ATP8B1 Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 18 21,930,150 - 22,086,371 (+) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 18 21,930,837 - 22,088,480 (+) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666060 3,481,874 - 3,637,247 (-) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Atp8b1
.
Predicted Target Of
Count of predictions: 64 Count of miRNA genes: 51 Interacting mature miRNAs: 58 Transcripts: ENSRNOT00000038652 Prediction methods: Miranda, Rnahybrid, Targetscan Result types: miRGate_prediction
1331733 Bp233 Blood pressure QTL 233 3.97196 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 18 24796977 79788953 Rat 1358358 Sradr6 Stress Responsive Adrenal Weight QTL 6 2.49 adrenal gland mass (VT:0010420) both adrenal glands wet weight (CMO:0000164) 18 11944299 59330563 Rat 1331730 Scl27 Serum cholesterol level QTL 27 3.826 blood HDL cholesterol amount (VT:0000184) serum high density lipoprotein cholesterol level (CMO:0000361) 18 52292875 59796643 Rat 1331741 Bp232 Blood pressure QTL 232 3.59112 arterial blood pressure trait (VT:2000000) diastolic blood pressure (CMO:0000005) 18 21372893 83213037 Rat 1331742 Bp228 Blood pressure QTL 228 3.88752 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 18 31359408 59796643 Rat 1298072 Cia26 Collagen induced arthritis QTL 26 3.6 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 18 54709769 83828827 Rat 1331736 Bp227 Blood pressure QTL 227 2.791 arterial blood pressure trait (VT:2000000) diastolic blood pressure (CMO:0000005) 18 46718763 59796643 Rat 1300125 Rf26 Renal function QTL 26 3.2 urine potassium amount (VT:0010539) urine potassium excretion rate (CMO:0000761) 18 52539863 65844950 Rat 6893683 Bw110 Body weight QTL 110 2.7 0.002 body mass (VT:0001259) body weight (CMO:0000012) 18 43345022 83828827 Rat 1331727 Bp237 Blood pressure QTL 237 3.053 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 18 31359408 61698465 Rat 9589041 Epfw12 Epididymal fat weight QTL 12 17.08 0.001 epididymal fat pad mass (VT:0010421) epididymal fat pad weight to body weight ratio (CMO:0000658) 18 46640675 83828827 Rat 8694432 Bw165 Body weight QTL 165 3.81 0.001 body lean mass (VT:0010483) lean tissue morphological measurement (CMO:0002184) 18 46640675 83828827 Rat 9589816 Gluco68 Glucose level QTL 68 7.25 0.001 blood glucose amount (VT:0000188) plasma glucose level (CMO:0000042) 18 29792965 74792965 Rat 1331774 Bp226 Blood pressure QTL 226 4.41065 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 18 31359408 59796643 Rat 61360 Eaey Experimental allergic encephalomyelitis QTL y 3 nervous system integrity trait (VT:0010566) experimental autoimmune encephalomyelitis duration (CMO:0001424) 18 46988939 60377753 Rat 2300177 Bmd65 Bone mineral density QTL 65 19.7 0.0001 femur mineral mass (VT:0010011) volumetric bone mineral density (CMO:0001553) 18 28964853 73964853 Rat 1578667 Bss21 Bone structure and strength QTL 21 3.5 femur morphology trait (VT:0000559) femoral neck cortical cross-sectional area (CMO:0001702) 18 11791518 83218561 Rat 2303120 Mamtr8 Mammary tumor resistance QTL 8 0.001 mammary gland integrity trait (VT:0010552) mammary tumor growth rate (CMO:0000344) 18 31359408 83218561 Rat 12880368 Bw187 Body weight QTL 187 0.045 body mass (VT:0001259) body weight (CMO:0000012) 18 52539763 76104388 Rat 61367 Iddm4 Insulin dependent diabetes mellitus QTL 4 2.33 0.0074 blood glucose amount (VT:0000188) plasma glucose level (CMO:0000042) 18 38192455 83192455 Rat 2293658 Bmd23 Bone mineral density QTL 23 7.3 0.0001 femur mineral mass (VT:0010011) total volumetric bone mineral density (CMO:0001728) 18 51464733 63636873 Rat 1359020 Ppulsi2 Prepulse inhibition QTL 2 2.71 prepulse inhibition trait (VT:0003088) acoustic startle response measurement (CMO:0001519) 18 52292875 73997283 Rat 2299160 Iddm35 Insulin dependent diabetes mellitus QTL 35 2.79 blood glucose amount (VT:0000188) age at onset/diagnosis of type 1 diabetes mellitus (CMO:0001140) 18 4207941 60377792 Rat 9590318 Scort22 Serum corticosterone level QTL 22 7.64 0.001 blood corticosterone amount (VT:0005345) plasma corticosterone level (CMO:0001173) 18 29792965 74792965 Rat 1331752 Bw27 Body weight QTL 27 2.963 body mass (VT:0001259) body weight (CMO:0000012) 18 52292875 65845095 Rat 1578661 Bss20 Bone structure and strength QTL 20 3.7 femur morphology trait (VT:0000559) femoral neck cross-sectional area (CMO:0001697) 18 11791518 83218561 Rat 1331754 Bp230 Blood pressure QTL 230 4.61609 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 18 29792965 74792965 Rat 12904069 Cm123 Cardiac mass QTL 123 0.001 heart left ventricle mass (VT:0007031) heart left ventricle weight to body weight ratio (CMO:0000530) 18 52539763 76104388 Rat 1331798 Bp224 Blood pressure QTL 224 3.53873 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 18 31359408 59796643 Rat 12904070 Cm124 Cardiac mass QTL 124 0.01 heart right ventricle mass (VT:0007033) heart right ventricle weight to body weight ratio (CMO:0000914) 18 52539763 76104388 Rat 2303584 Gluco55 Glucose level QTL 55 2 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 18 48520044 83828827 Rat 12904071 Am18 Aortic mass QTL 18 0.001 aorta mass (VT:0002845) aorta weight to aorta length to body weight ratio (CMO:0002722) 18 52539763 76104388 Rat 61383 Bp47 Blood pressure QTL 47 17.3 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 18 31271681 60377755 Rat 12904067 Cm122 Cardiac mass QTL 122 0.001 heart mass (VT:0007028) heart wet weight to body weight ratio (CMO:0002408) 18 52539763 76104388 Rat 2301417 Bp319 Blood pressure QTL 319 0.002 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 18 52539763 76104388 Rat 12904073 Kidm71 Kidney mass QTL 71 0.001 kidney mass (VT:0002707) both kidneys wet weight to body weight ratio (CMO:0000340) 18 52539763 76104388 Rat 1331780 Bp238 Blood pressure QTL 238 3.269 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 18 46718763 59796643 Rat 738008 Hcar14 Hepatocarcinoma resistance QTL 14 4.3 liver integrity trait (VT:0010547) liver nonremodeling tumorous lesion number (CMO:0001462) 18 51464733 83218561 Rat 1331776 Bp225 Blood pressure QTL 225 2.829 arterial blood pressure trait (VT:2000000) diastolic blood pressure (CMO:0000005) 18 31359408 59796643 Rat 6903359 Bp355 Blood pressure QTL 355 3.6 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 18 11944544 59796478 Rat 631518 Bw11 Body weight QTL 11 2.8 body mass (VT:0001259) body weight (CMO:0000012) 18 35870723 80870723 Rat 6903345 Bp349 Blood pressure QTL 349 3.9 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 18 46718935 59796478 Rat 2313082 Bss85 Bone structure and strength QTL 85 0.8 0.0001 long bone metaphysis morphology trait (VT:0000133) tibia midshaft total cross-sectional area (CMO:0001715) 18 14951337 59951337 Rat 6903347 Bp350 Blood pressure QTL 350 4.4 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 18 31359530 59796478 Rat 8694366 Abfw8 Abdominal fat weight QTL 8 6.38 0.001 visceral adipose mass (VT:0010063) abdominal fat pad weight to body weight ratio (CMO:0000095) 18 46640675 83828827 Rat 6903349 Bp351 Blood pressure QTL 351 3.5 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 18 46718935 59796478 Rat 631509 Sald2 Serum aldosterone level QTL 2 2.9 blood aldosterone amount (VT:0005346) serum aldosterone level (CMO:0000487) 18 52539763 69140759 Rat 2300157 Bmd66 Bone mineral density QTL 66 13.1 0.0001 lumbar vertebra mineral mass (VT:0010511) volumetric bone mineral density (CMO:0001553) 18 28964853 73964853 Rat 738005 Anxrr11 Anxiety related response QTL 11 3.4 exploratory behavior trait (VT:0010471) number of entries into a discrete space in an experimental apparatus (CMO:0000960) 18 30039813 75039813 Rat 6903351 Bp352 Blood pressure QTL 352 3.3 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 18 46718935 59796478 Rat 631274 Sprol1 Serum protein level QTL 1 5.3 blood total protein amount (VT:0005567) serum total protein level (CMO:0000661) 18 31393320 77209694 Rat 1358193 Emca2 Estrogen-induced mammary cancer QTL 2 1.6 mammary gland integrity trait (VT:0010552) post-insult time to mammary tumor formation (CMO:0000345) 18 18007599 63571040 Rat 2293704 Bss35 Bone structure and strength QTL 35 4.59 0.0002 femur strength trait (VT:0010010) femur midshaft polar moment of inertia (CMO:0001669) 18 28964853 73964853 Rat 2325839 Bp348 Blood pressure QTL 348 0.001 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 18 25570985 70570985 Rat 1600373 Mamtr6 Mammary tumor resistance QTL 6 mammary gland integrity trait (VT:0010552) mammary tumor number (CMO:0000343) 18 19278901 83218561 Rat 2293708 Bss46 Bone structure and strength QTL 46 8.8 0.0001 lumbar vertebra morphology trait (VT:0010494) lumbar vertebra cortical cross-sectional area (CMO:0001690) 18 11791518 63636873 Rat 8694378 Bw157 Body weight QTL 157 3.59 0.001 body lean mass (VT:0010483) lean tissue morphological measurement (CMO:0002184) 18 29792965 74792965 Rat 1600375 Mcs22 Mammary carcinoma susceptibility QTL 22 3.3 mammary gland integrity trait (VT:0010552) mammary tumor growth rate (CMO:0000344) 18 52539763 63933058 Rat 2303571 Bw92 Body weight QTL 92 3 body mass (VT:0001259) body weight (CMO:0000012) 18 48520044 83828827 Rat 1598826 Anxrr20 Anxiety related response QTL 20 3.04 body movement coordination trait (VT:0005424) number of rearing movements in an experimental apparatus (CMO:0001752) 18 41432971 83828827 Rat 61429 Cia17 Collagen induced arthritis QTL 17 4.6 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 18 31359408 70263868 Rat 7411719 Strs5 Sensitivity to stroke QTL 5 9.4 cerebrum integrity trait (VT:0010549) percentage of study population developing cerebrovascular lesions during a period of time (CMO:0000932) 18 49999958 65845095 Rat
D18Chm97
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 18 58,085,512 - 58,085,730 (+) MAPPER mRatBN7.2 Rnor_6.0 18 60,081,657 - 60,081,874 NCBI Rnor6.0 Rnor_5.0 18 59,291,816 - 59,292,033 UniSTS Rnor5.0 RGSC_v3.4 18 60,815,969 - 60,816,186 UniSTS RGSC3.4 Celera 18 56,222,551 - 56,222,768 UniSTS Cytogenetic Map 18 q12.1 UniSTS
RH140076
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 18 58,018,069 - 58,018,280 (+) MAPPER mRatBN7.2 Rnor_6.0 18 60,015,049 - 60,015,259 NCBI Rnor6.0 Rnor_5.0 18 59,225,208 - 59,225,418 UniSTS Rnor5.0 RGSC_v3.4 18 60,748,540 - 60,748,750 UniSTS RGSC3.4 Celera 18 56,155,128 - 56,155,338 UniSTS RH 3.4 Map 18 569.2 UniSTS Cytogenetic Map 18 q12.1 UniSTS
AU049633
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 18 58,046,279 - 58,046,462 (+) MAPPER mRatBN7.2 Rnor_6.0 18 60,042,430 - 60,042,612 NCBI Rnor6.0 Rnor_5.0 18 59,252,589 - 59,252,771 UniSTS Rnor5.0 RGSC_v3.4 18 60,776,742 - 60,776,924 UniSTS RGSC3.4 Celera 18 56,183,329 - 56,183,513 UniSTS Cytogenetic Map 18 q12.1 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
11
49
113
91
90
59
25
59
6
218
97
93
45
60
31
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000038652 ⟹ ENSRNOP00000038207
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 18 58,018,268 - 58,157,396 (-) Ensembl Rnor_6.0 Ensembl 18 60,013,382 - 60,095,354 (-) Ensembl
RefSeq Acc Id:
NM_001106140 ⟹ NP_001099610
RefSeq Status:
PROVISIONAL
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 18 60,288,464 - 60,369,384 (-) NCBI mRatBN7.2 18 58,018,268 - 58,099,197 (-) NCBI Rnor_6.0 18 60,015,247 - 60,095,334 (-) NCBI Rnor_5.0 18 59,223,547 - 59,362,294 (-) NCBI RGSC_v3.4 18 60,748,738 - 60,829,650 (-) RGD Celera 18 56,155,326 - 56,236,232 (-) RGD
Sequence:
ATGAACACAGAAAGGGACTCGGAAACAACATTTGATGAGGATTCCCAGCCCAATGATGAAGTGGTTCCCTACAGTGATGATGAAACCGAAGACGAACTTGAAGACCAGGGGCCTGCAGTTGAACCAGA
hide sequence
RefSeq Acc Id:
XM_006254842 ⟹ XP_006254904
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 18 60,286,605 - 60,427,862 (-) NCBI mRatBN7.2 18 58,016,382 - 58,157,213 (-) NCBI Rnor_6.0 18 60,013,388 - 60,152,920 (-) NCBI Rnor_5.0 18 59,223,547 - 59,362,294 (-) NCBI
Sequence:
GTGGCCAGGTGCGCACCAGCCTCGGAAGAGCCTCGGAGCGCCGCGCACCCCGCGGATGCCCAAACCCGGGCCCAGAGAGCACCAGGTAGTTCCAATTTGCCAGCAGAATGAACACAGAAAGGGACTCG
hide sequence
RefSeq Acc Id:
NP_001099610 ⟸ NM_001106140
- UniProtKB:
A0A8L2QJ69 (UniProtKB/TrEMBL), A6IXP4 (UniProtKB/TrEMBL)
- Sequence:
MNTERDSETTFDEDSQPNDEVVPYSDDETEDELEDQGPAVEPEQNRVNREVEKKKETFRKDCTWQVKANDRKFHEQPHFMNTKFFCIKESKYASNAIKTYKYNALTFLPMNLFEQFKRAANFYFLILL
hide sequence
RefSeq Acc Id:
XP_006254904 ⟸ XM_006254842
- Peptide Label:
isoform X1
- UniProtKB:
D4AA47 (UniProtKB/TrEMBL)
- Sequence:
MNTERDSETTFDEDSQPNDEVVPYSDDETEDELEDQGPAVEPEQNRVNREVEKKKETFRKDCTWQVKANDRKFHEQPHFMNTKFFCIKESKYASNAIKTYKYNALTFLPMNLFEQFKRAANFYFLILL
hide sequence
Ensembl Acc Id:
ENSRNOP00000038207 ⟸ ENSRNOT00000038652
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2016-02-17
Atp8b1
ATPase phospholipid transporting 8B1
Atp8b1
ATPase, aminophospholipid transporter, class I, type 8B, member 1
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2012-07-30
Atp8b1
ATPase, aminophospholipid transporter, class I, type 8B, member 1
Atp8b1
ATPase, Class I, type 8B, member 1
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2008-04-30
Atp8b1
ATPase, Class I, type 8B, member 1
Atp8b1_predicted
ATPase, Class I, type 8B, member 1 (predicted)
'predicted' is removed
2292626 APPROVED
2005-01-12
Atp8b1_predicted
ATPase, Class I, type 8B, member 1 (predicted)
Symbol and Name status set to approved
70820 APPROVED
