No known orthologs.
Symbol: |
Pilrb-ps1 (Ensembl: LOC100910801) |
Name: |
paired immunoglobin-like type 2 receptor beta, pseudogene 1 (Ensembl:paired immunoglobulin-like type 2 receptor alpha-like) |
RGD ID: |
6496729 |
Description: |
|
Type: |
pseudo (Ensembl: protein-coding)
|
RefSeq Status: |
MODEL |
Previously known as: |
LOC100910801; LOC108348155; paired immunoglobulin-like type 2 receptor alpha-like; paired immunoglobulin-like type 2 receptor beta; paired immunoglobulin-like type 2 receptor beta-2 |
RGD Orthologs |
|
Alliance Orthologs |
|
More Info |
homologs ...
|
More Info |
|
Latest Assembly: |
GRCr8 - GRCr8 Assembly |
Position: |
Rat Assembly | Chr | Position (strand) | Source | Genome Browsers |
---|
JBrowse | NCBI | UCSC | Ensembl |
---|
GRCr8 | 12 | 22,990,576 - 22,996,529 (-) | NCBI | | GRCr8 | | | mRatBN7.2 | 12 | 18,601,156 - 18,607,655 (-) | NCBI | mRatBN7.2 | mRatBN7.2 | | | Rnor_6.0 | 12 | 21,659,175 - 21,670,430 (-) | NCBI | Rnor6.0 | Rnor_6.0 | rn6 | Rnor6.0 | Rnor_6.0 Ensembl | 12 | 21,661,512 - 21,670,269 (-) | Ensembl | Rnor6.0 | | rn6 | Rnor6.0 | Rnor_5.0 | 12 | 23,689,924 - 23,691,274 (-) | NCBI | Rnor5.0 | Rnor_5.0 | rn5 | Rnor5.0 | Celera | 12 | 20,656,789 - 20,663,962 (-) | NCBI | | Celera | | | Cytogenetic Map | 12 | q12 | NCBI | | | | |
|
JBrowse: |
View Region in Genome Browser (JBrowse)
|
Model |
|
.
Assembly: Rnor_6.0
Chromosome |
Start Pos |
End Pos |
Reference Nucleotide |
Variant Nucleotide |
Variant Type |
Strain |
Variant Page |
12 |
21661963 |
21661964 |
T |
C |
snv |
LEXF2B/Stm (2019), F344/NCrl (2019), FXLE18/Stm (2020) |
View more Information |
12 |
21669513 |
21669514 |
A |
G |
snv |
LH/MavRrrcAek (2020), HXB4/IpcvMcwi (2020) |
View more Information |
12 |
21669521 |
21669522 |
T |
A |
snv |
LH/MavRrrcAek (2020), HXB4/IpcvMcwi (2020) |
View more Information |
12 |
21669544 |
21669545 |
C |
T |
snv |
MR/N (MCW) |
View more Information |
12 |
21669639 |
21669640 |
G |
C |
snv |
ACI/EurMcwi (MCW), GK/FarMcwi (2019), F344/Stm (2019), BXH3/CubMcwi (2020), LEW/Crl (2019), SR/JrHsd (MCW), WKY/N (2020), SHRSP/A3NCrl (2019), M520/NRrrcMcwi (2019), LEXF10A/StmMcwi (2020), LL/MavRrrcAek (2020), LEXF4/Stm (2020), LEXF2B/Stm (2019) |
View more Information |
12 |
21669670 |
21669671 |
G |
A |
snv |
COP/CrCrl (MCW & UW) |
View more Information |
12 |
21669674 |
21669675 |
C |
A |
snv |
COP/CrCrl (MCW & UW) |
View more Information |
12 |
21669723 |
21669724 |
C |
T |
snv |
M520/N (2020), MWF/Hsd (2019), PVG/Seac (2019), SHRSP/A3NCrl (2019), SHR/OlalpcvMcwi (2019), SS/JrHsdMcwi (2019), WKY/NCrl (2019), WKY/N (2020), WN/N (2020), SS/JrHsdMcwi (MCW), SBN/Ygl (MCW), M520/NRrrcMcwi (2019), LN/MavRrrcAek (2020), LL/MavRrrcAek (2020), LH/MavRrrcAek (2020), LEXF4/Stm (2020), LEXF3/Stm (2020), LEXF2B/Stm (2019), LEW/Crl (2019), GK/FarMcwi (2019), FHH/EurMcwi (2019), F344/Stm (2019), F344/NCrl (2019), F344/DuCrl (2019), BXH3/CubMcwi (2020), BXH2/CubMcwi (2020), ACI/N (2020), ACI/EurMcwi (2019), SBH/Ygl (MCW), GH/OmrMcwi (MCW), FHL/EurMcwi (MCW), FHH/EurMcwi (MCW), ACI/EurMcwi (MCW), CDR, SR/JrHsd (MCW) |
View more Information |
12 |
21669765 |
21669766 |
T |
A |
snv |
ACI/EurMcwi (MCW), ACI/EurMcwi (2019), ACI/N (2020), BXH3/CubMcwi (2020), F344/NCrl (2019), FHH/EurMcwi (2019), LEW/Crl (2019), LEXF2B/Stm (2019), LEXF3/Stm (2020), LL/MavRrrcAek (2020), LN/MavRrrcAek (2020), M520/NRrrcMcwi (2019), M520/N (2020), MWF/Hsd (2019), PVG/Seac (2019), SHRSP/A3NCrl (2019), SHR/OlalpcvMcwi (2019), SS/JrHsdMcwi (2019), WKY/NCrl (2019), WN/N (2020), CDR, FHH/EurMcwi (MCW), FHL/EurMcwi (MCW), GH/OmrMcwi (MCW), SBH/Ygl (MCW), SR/JrHsd (MCW), BXH2/CubMcwi (2020), F344/DuCrl (2019), F344/Stm (2019), GK/FarMcwi (2019), LEXF4/Stm (2020), LH/MavRrrcAek (2020), WKY/N (2020) |
View more Information |
12 |
21669768 |
21669769 |
T |
G |
snv |
ACI/N (2020), WKY/N (2020), WKY/NCrl (2019), SS/JrHsdMcwi (2019), SR/JrHsd (2020), SHR/OlalpcvMcwi (2019), SHRSP/A3NCrl (2019), PVG/Seac (2019), MWF/Hsd (2019), MR/N (2020), M520/N (2020), M520/NRrrcMcwi (2019), LEXF10A/StmMcwi (2020), LN/MavRrrcAek (2020), LL/MavRrrcAek (2020), LH/MavRrrcAek (2020), LEXF4/Stm (2020), LEXF3/Stm (2020), LEXF2B/Stm (2019), LEW/Crl (2019), HXB4/IpcvMcwi (2020), GK/FarMcwi (2019), FXLE18/Stm (2020), FHH/EurMcwi (2019), F344/Stm (2019), F344/N (2020), F344/NCrl (2019), F344/DuCrl (2019), ACI/EurMcwi (MCW), ACI/EurMcwi (2019), WN/N (2020), BUF/N (2020), BXH3/CubMcwi (2020), DA/OlaHsd (2019) |
View more Information |
12 |
21669802 |
21669803 |
G |
A |
snv |
SBH/Ygl (MCW), SR/JrHsd (MCW) |
View more Information |
12 |
21669817 |
21669818 |
C |
T |
snv |
LN/MavRrrcAek (2020), ACI/N (2020), SS/JrHsdMcwi (2019), SR/JrHsd (2020), SHR/OlalpcvMcwi (2019), SHRSP/A3NCrl (2019), PVG/Seac (2019), MWF/Hsd (2019), MR/N (2020), M520/N (2020), M520/NRrrcMcwi (2019), ACI/EurMcwi (2019), LL/MavRrrcAek (2020), LEXF3/Stm (2020), LEXF2B/Stm (2019), LEW/Crl (2019), HXB4/IpcvMcwi (2020), FXLE18/Stm (2020), F344/Stm (2019), F344/NCrl (2019), BXH3/CubMcwi (2020), WKY/NCrl (2019), FHH/EurMcwi (2019), BUF/N (2020) |
View more Information |
12 |
21669844 |
21669845 |
G |
T |
snv |
M520/NRrrcMcwi (2019), ACI/EurMcwi (2019) |
View more Information |
12 |
21670199 |
21670200 |
G |
C |
snv |
MWF/Hsd (2019), MR/N (2020), LEW/Crl (2019), F344/Stm (2019), ACI/EurMcwi (2019), SHR/OlalpcvMcwi (2019) |
View more Information |
12 |
21670215 |
21670216 |
G |
T |
snv |
F344/Stm (2019), FHH/EurMcwi (2019), FXLE18/Stm (2020), GK/FarMcwi (2019), HXB4/IpcvMcwi (2020), LEW/Crl (2019), LEXF2B/Stm (2019), LEXF3/Stm (2020), LEXF4/Stm (2020), LH/MavRrrcAek (2020), LL/MavRrrcAek (2020), LN/MavRrrcAek (2020), M520/N (2020), MR/N (2020), MWF/Hsd (2019), PVG/Seac (2019), SHRSP/A3NCrl (2019), SHR/OlalpcvMcwi (2019), SR/JrHsd (2020), SS/JrHsdMcwi (2019), WKY/NCrl (2019), WKY/N (2020), WN/N (2020), M520/NRrrcMcwi (2019), DA/OlaHsd (2019), F344/N (2020), LEXF10A/StmMcwi (2020), F344/NCrl (2019), F344/DuCrl (2019), BXH3/CubMcwi (2020), BXH2/CubMcwi (2020), BUF/N (2020), ACI/EurMcwi (2019), ACI/N (2020) |
View more Information |
Predicted Target Of
Count of predictions: | 52 | Count of miRNA genes: | 48 | Interacting mature miRNAs: | 48 | Transcripts: | ENSRNOT00000074863 | Prediction methods: | Miranda, Rnahybrid | Result types: | miRGate_prediction |
2312418 | Kidm41 | Kidney mass QTL 41 | 3.7 | 0.0001 | kidney mass (VT:0002707) | single kidney wet weight to body weight ratio (CMO:0000622) | 12 | 1 | 19611090 | Rat | 61443 | Btemp2 | Thermal response to stress QTL 2 | 3.3 | 0.000094 | body temperature trait (VT:0005535) | core body temperature (CMO:0001036) | 12 | 15025183 | 20794014 | Rat | 8552964 | Pigfal17 | Plasma insulin-like growth factor 1 level QTL 17 | 3.5 | | blood insulin-like growth factor amount (VT:0010479) | plasma insulin-like growth factor 1 level (CMO:0001299) | 12 | 5564495 | 46669029 | Rat | 7411641 | Foco19 | Food consumption QTL 19 | 27.7 | 0.001 | eating behavior trait (VT:0001431) | feed conversion ratio (CMO:0001312) | 12 | 5564495 | 46669029 | Rat | 1549912 | Bp268 | Blood pressure QTL 268 | | | arterial blood pressure trait (VT:2000000) | diastolic blood pressure (CMO:0000005) | 10 | 13182736 | 46669029 | Rat | 2302060 | Pia37 | Pristane induced arthritis QTL 37 | 6.1 | 0.001 | blood immunoglobulin amount (VT:0002460) | serum immunoglobulin G1 level (CMO:0002115) | 12 | 13198157 | 46669029 | Rat | 9590147 | Scort7 | Serum corticosterone level QTL 7 | 13.61 | 0.001 | blood corticosterone amount (VT:0005345) | plasma corticosterone level (CMO:0001173) | 12 | 1 | 42110980 | Rat | 1641928 | Alcrsp5 | Alcohol response QTL 5 | | | response to alcohol trait (VT:0010489) | duration of loss of righting reflex (CMO:0002289) | 12 | 12812385 | 46669029 | Rat | 8552912 | Pigfal6 | Plasma insulin-like growth factor 1 level QTL 6 | 5 | | blood insulin-like growth factor amount (VT:0010479) | plasma insulin-like growth factor 1 level (CMO:0001299) | 12 | 5564498 | 46669029 | Rat | 1549829 | Scl48 | Serum cholesterol level QTL 48 | 5 | | blood cholesterol amount (VT:0000180) | serum total cholesterol level (CMO:0000363) | 12 | 9603277 | 46669029 | Rat | 10059594 | Kidm46 | Kidney mass QTL 46 | 3.79 | 0.025 | kidney mass (VT:0002707) | both kidneys wet weight to body weight ratio (CMO:0000340) | 12 | 6107579 | 46669029 | Rat | 61331 | Eau2 | Experimental allergic uveoretinitis QTL 2 | | 0.0005 | uvea integrity trait (VT:0010551) | experimental autoimmune uveitis score (CMO:0001504) | 12 | 8525423 | 28064601 | Rat | 1581516 | Cm56 | Cardiac mass QTL 56 | 4.2 | 0.05 | heart left ventricle mass (VT:0007031) | heart left ventricle weight to body weight ratio (CMO:0000530) | 12 | 1 | 29333307 | Rat | 9590086 | Insglur6 | Insulin/glucose ratio QTL 6 | 18.97 | 0.001 | blood insulin amount (VT:0001560) | calculated plasma insulin level (CMO:0002170) | 12 | 1 | 42110980 | Rat | 8552918 | Pigfal7 | Plasma insulin-like growth factor 1 level QTL 7 | | | blood insulin-like growth factor amount (VT:0010479) | plasma insulin-like growth factor 1 level (CMO:0001299) | 12 | 5564495 | 46669029 | Rat | 2293684 | Bmd26 | Bone mineral density QTL 26 | 4.4 | 0.0002 | femur mineral mass (VT:0010011) | total volumetric bone mineral density (CMO:0001728) | 12 | 15872653 | 32974238 | Rat | 6893681 | Bw109 | Body weight QTL 109 | 2.3 | 0.004 | body mass (VT:0001259) | body weight (CMO:0000012) | 12 | 1 | 23297788 | Rat | 1549902 | Bp269 | Blood pressure QTL 269 | | | arterial blood pressure trait (VT:2000000) | systolic blood pressure (CMO:0000004) | 12 | 13182736 | 46669029 | Rat | 1302792 | Scl21 | Serum cholesterol level QTL 21 | 3.8 | 0.0011 | blood cholesterol amount (VT:0000180) | plasma total cholesterol level (CMO:0000585) | 12 | 7196730 | 46669029 | Rat | 61404 | Bw120 | Body weight QTL 120 | 5.1 | | body mass (VT:0001259) | body mass index (BMI) (CMO:0000105) | 12 | 12351619 | 46669029 | Rat | 1331786 | Kidm11 | Kidney mass QTL 11 | 3.571 | | kidney mass (VT:0002707) | right kidney wet weight (CMO:0000082) | 12 | 11073825 | 24234895 | Rat | 1598855 | Bp294 | Blood pressure QTL 294 | 3.5 | | arterial blood pressure trait (VT:2000000) | systolic blood pressure (CMO:0000004) | 12 | 1 | 34851688 | Rat | 2293699 | Bss49 | Bone structure and strength QTL 49 | 5.61 | 0.0001 | lumbar vertebra size trait (VT:0010518) | lumbar vertebra trabecular cross-sectional area (CMO:0001692) | 12 | 10474137 | 46669029 | Rat | 10755457 | Coatc14 | Coat color QTL 14 | | 0.01759 | coat/hair pigmentation trait (VT:0010463) | pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812) | 12 | 1 | 22591684 | Rat | 1331761 | Bp218 | Blood pressure QTL 218 | 2.973 | | arterial blood pressure trait (VT:2000000) | mean arterial blood pressure (CMO:0000009) | 12 | 11073825 | 45055165 | Rat | 634351 | Apr5 | Acute phase response QTL 5 | 6.7 | | blood interleukin-6 amount (VT:0008595) | plasma interleukin-6 level (CMO:0001927) | 12 | 1 | 44503507 | Rat | 8694179 | Bw150 | Body weight QTL 150 | 2.9 | 0.001 | body mass (VT:0001259) | body weight gain (CMO:0000420) | 12 | 1 | 42110980 | Rat | 634350 | Apr4 | Acute phase response QTL 4 | 6 | | orosomucoid 1 amount (VT:0010541) | plasma orosomucoid 1 level (CMO:0001467) | 12 | 1172005 | 46172005 | Rat | 7411545 | Bw128 | Body weight QTL 128 | 5.2 | 0.001 | body mass (VT:0001259) | body weight gain (CMO:0000420) | 12 | 1 | 42110980 | Rat | 61416 | Pia4 | Pristane induced arthritis QTL 4 | 8.4 | | joint integrity trait (VT:0010548) | arthritic paw count (CMO:0001460) | 12 | 13635523 | 30827399 | Rat | 7204484 | Bp358 | Blood pressure QTL 358 | | 0.001 | arterial blood pressure trait (VT:2000000) | mean arterial blood pressure (CMO:0000009) | 12 | 13008296 | 19212979 | Rat | 7411547 | Bw129 | Body weight QTL 129 | | 0.001 | body mass (VT:0001259) | body weight gain (CMO:0000420) | 6 | 5564495 | 46669029 | Rat | 7387292 | Kidm42 | Kidney mass QTL 42 | 3.03 | 0.0004 | kidney mass (VT:0002707) | left kidney wet weight (CMO:0000083) | 12 | 1 | 36247923 | Rat | 61421 | Cia12 | Collagen induced arthritis QTL 12 | 4.6 | | joint integrity trait (VT:0010548) | joint inflammation composite score (CMO:0000919) | 12 | 13635523 | 35682913 | Rat | 1300157 | Rf21 | Renal function QTL 21 | 4.4 | | renal blood flow trait (VT:2000006) | absolute change in renal blood flow rate (CMO:0001168) | 12 | 9318216 | 32103380 | Rat | 737979 | Pia22 | Pristane induced arthritis QTL 22 | 53.1 | | joint integrity trait (VT:0010548) | joint inflammation composite score (CMO:0000919) | 12 | 1 | 44465750 | Rat | 2303569 | Gluco44 | Glucose level QTL 44 | 2 | | blood glucose amount (VT:0000188) | blood glucose level (CMO:0000046) | 12 | 12812385 | 46669029 | Rat | 7411586 | Foco5 | Food consumption QTL 5 | 5.4 | 0.001 | eating behavior trait (VT:0001431) | feed conversion ratio (CMO:0001312) | 12 | 1 | 42110980 | Rat | 2303575 | Insul14 | Insulin level QTL 14 | 4 | | blood insulin amount (VT:0001560) | blood insulin level (CMO:0000349) | 12 | 1 | 42450532 | Rat | 7411588 | Foco6 | Food consumption QTL 6 | | 0.001 | eating behavior trait (VT:0001431) | feed conversion ratio (CMO:0001312) | 12 | 5564495 | 46669029 | Rat | 2302042 | Pia38 | Pristane induced arthritis QTL 38 | 3.5 | 0.001 | blood immunoglobulin amount (VT:0002460) | serum immunoglobulin G1 level (CMO:0002115) | 12 | 1 | 44503507 | Rat | 2300186 | Bmd59 | Bone mineral density QTL 59 | 7.1 | 0.0001 | lumbar vertebra mineral mass (VT:0010511) | volumetric bone mineral density (CMO:0001553) | 12 | 10474137 | 46669029 | Rat | 7411595 | Foco9 | Food consumption QTL 9 | 4 | 0.001 | eating behavior trait (VT:0001431) | feed conversion ratio (CMO:0001312) | 12 | 1 | 42110980 | Rat | 7411597 | Foco10 | Food consumption QTL 10 | | 0.001 | eating behavior trait (VT:0001431) | feed conversion ratio (CMO:0001312) | 12 | 5564495 | 46669029 | Rat | 2293086 | Iddm30 | Insulin dependent diabetes mellitus QTL 30 | 3.82 | | blood glucose amount (VT:0000188) | blood glucose level (CMO:0000046) | 12 | 8449490 | 28302290 | Rat | 7411660 | Foco28 | Food consumption QTL 28 | 10.9 | 0.001 | eating behavior trait (VT:0001431) | feed conversion ratio (CMO:0001312) | 12 | 1 | 42110980 | Rat | 631543 | Bp83 | Blood pressure QTL 83 | 5.8 | | arterial blood pressure trait (VT:2000000) | systolic blood pressure (CMO:0000004) | 12 | 15550826 | 38478808 | Rat | 1331755 | Bp219 | Blood pressure QTL 219 | 3.041 | | arterial blood pressure trait (VT:2000000) | mean arterial blood pressure (CMO:0000009) | 12 | 11073825 | 28064557 | Rat |
alimentary part of gastrointestinal system
| | | | | | | | | | | | | | |
9
|
11
|
26
|
42
|
45
|
17
|
22
|
17
|
6
|
80
|
49
|
10
|
5
|
19
|
28
|
Ensembl Acc Id: |
ENSRNOT00000064787 ⟹ ENSRNOP00000061816 |
Type: |
CODING |
Position: |
Rat Assembly | Chr | Position (strand) | Source |
---|
Rnor_6.0 Ensembl | 12 | 21,356,475 - 21,362,205 (-) | Ensembl |
|
Ensembl Acc Id: |
ENSRNOT00000074863 ⟹ ENSRNOP00000064190 |
Type: |
CODING |
Position: |
Rat Assembly | Chr | Position (strand) | Source |
---|
Rnor_6.0 Ensembl | 12 | 21,661,512 - 21,670,269 (-) | Ensembl |
|
RefSeq Acc Id: |
XM_008769104 ⟹ XP_008767326 |
Type: |
CODING |
Position: |
Rat Assembly | Chr | Position (strand) | Source |
---|
Rnor_6.0 | 12 | 21,659,175 - 21,670,430 (-) | NCBI |
|
Sequence: |
AGATCAGTAAAGGAAGTTGCTGGCCACAAGGAGGTAGAGATGGCCGTGCTCAACTCAGTCTTCCCCTGGAGAATGTCTGAGCATGTGTTTTTATTTACCCTGATTCTCTCTGGACTGCTGAGTGCCCC AGTGTCCCTAGTCAGGGCATCCTCGACTTCCTGACGGCCCTGCTGGTCTCACTTCCTGAACAGAATCTGGCTATGGCTCGGATCCTCCTTCTTTTGCTGTCGGCGGCATGTCTGCACACTGGGAATTC AGCAGGATATCCAAAAAAGTATGACTATGGTGTCGACCAACCAGCTGTCCTCTCTGGAGTCCAGAGCGGCTCCATCGAGATCCCCTTCTCTTTCTACTTCCCCTGGGAGTTGGCCAAGGATCCGCAGA TGAGAATAGCCTGGAGATGGAAGGTCTTCCATGGGGAATTCATCTACAACTCCACCCAGCCTTTCATTCATGAGCATTTTAAGGGCCGGCTCATCATGAATTGGACACAGGGTCAGACATCTGGAGTC CTCAGAATCCTGAACCTGAAGGAGAATGACCAGGCCACATACTTCAGCCGAGTTTTTCTCAGAACAACAGAAGGCATGAAGTCGTGGCAGTCAATCCCTGGCACCCAACTCATCATTCATGCTCTCAA TACTACAATAGAGAGCCCCTCCATCATCCCCTTTGCAGTCCCCTCAGCTGGCCTGGAGGACACAAGGGACCAGAGGAATCCTTCACTGCTGAACTTGGGAGTCATGGTTGGGATGGTCATGGCCAAAG TTGTGGTCATCATGCCCCTCTGTGGATGGATGATCTTCCTGTGGTGGAAACAAAGGCCAGCAGAGTAAAGCCTAAAGCCTAGTAAGGCTCCCCTGCTAGGATCTCTCACCAGGGAGGCAAGTTTACAT CAAAGTAGTTATTGGTGATTACACACCCTGCATCCCACAGCCATCCATGTATTCTCTCTGGGAGTCAGAGCTAATGGCTGCAGGATTCTCCTGTGAAAGTCATTCTTGGATAACCCCCACTTCTGCCA TGGGGACTCCGACATGCTCTCCTTGGAACCAAGGTCCTCCTGTGTGTCTCTGGGCCTGAGAGCCTGACTGTGCTTGCTTTTCTCTCTCTGTTCATGGCGTTATTGACACTTTTAATAAATATCTTACT CCCAGGAATCCAGAT
hide sequence
|
Date |
Current Symbol |
Current Name |
Previous Symbol |
Previous Name |
Description |
Reference |
Status |
2022-06-10 |
Pilrb-ps1 |
paired immunoglobin-like type 2 receptor beta, pseudogene 1 |
LOC100910801 |
paired immunoglobulin-like type 2 receptor alpha-like |
Symbol and Name Changed |
1299863 |
APPROVED |
2021-03-09 |
LOC100910801 |
paired immunoglobulin-like type 2 receptor alpha-like |
LOC108348155 |
paired immunoglobulin-like type 2 receptor beta-2 |
Data merged from RGD:11434352 |
737654 |
PROVISIONAL |
2016-08-02 |
LOC108348155 |
paired immunoglobulin-like type 2 receptor beta-2 |
|
|
Symbol and Name status set to provisional |
70820 |
PROVISIONAL |
2012-07-05 |
LOC100910801 |
paired immunoglobulin-like type 2 receptor alpha-like |
|
|
Symbol and Name status set to provisional |
70820 |
PROVISIONAL |
|
|