Symbol:
Tspan31
Name:
tetraspanin 31
RGD ID:
1309876
Description:
Predicted to be located in membrane. Orthologous to human TSPAN31 (tetraspanin 31); INTERACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; amphetamine; bisphenol A.
Type:
protein-coding
RefSeq Status:
PROVISIONAL
Previously known as:
LOC362890; MGC105551; sarcoma amplified sequence; sarcoma-amplified sequence homolog; Sas; tetraspanin-31; tspan-31
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Species
Gene symbol and name
Data Source
Assertion derived from
less info ...
Orthologs 1
Homo sapiens (human):
TSPAN31 (tetraspanin 31) HGNC
EggNOG, Ensembl, HomoloGene, Inparanoid, NCBI, OMA, OrthoDB, OrthoMCL, Panther, PhylomeDB, Treefam
Mus musculus (house mouse):
Tspan31 (tetraspanin 31) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chinchilla lanigera (long-tailed chinchilla):
Tspan31 (tetraspanin 31) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Pan paniscus (bonobo/pygmy chimpanzee):
TSPAN31 (tetraspanin 31) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Canis lupus familiaris (dog):
TSPAN31 (tetraspanin 31) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Ictidomys tridecemlineatus (thirteen-lined ground squirrel):
Tspan31 (tetraspanin 31) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Sus scrofa (pig):
TSPAN31 (tetraspanin 31) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chlorocebus sabaeus (green monkey):
TSPAN31 (tetraspanin 31) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Heterocephalus glaber (naked mole-rat):
Tspan31 (tetraspanin 31) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Alliance orthologs 3
Homo sapiens (human):
TSPAN31 (tetraspanin 31)
Alliance
DIOPT (Ensembl Compara|HGNC|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Mus musculus (house mouse):
Tspan31 (tetraspanin 31)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Danio rerio (zebrafish):
tspan31 (tetraspanin 31)
Alliance
DIOPT (Ensembl Compara|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Drosophila melanogaster (fruit fly):
Tsp97E
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Xenopus tropicalis (tropical clawed frog):
tspan31
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB)
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 7 64,774,881 - 64,783,534 (-) NCBI GRCr8 mRatBN7.2 7 62,889,552 - 62,892,428 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 7 62,889,552 - 62,898,388 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 7 64,778,864 - 64,781,738 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 7 66,981,266 - 66,984,140 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 7 66,782,317 - 66,785,191 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 7 70,352,679 - 70,355,555 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 7 70,352,251 - 70,355,619 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 7 70,530,381 - 70,533,257 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 7 67,019,168 - 67,022,042 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 7 67,039,898 - 67,042,772 (-) NCBI Celera 7 60,032,790 - 60,035,664 (-) NCBI Celera Cytogenetic Map 7 q22 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Tspan31 Rat (1->4)-beta-D-glucan multiple interactions ISO Tspan31 (Mus musculus) 6480464 [perfluorooctane sulfonic acid co-treated with Cellulose] results in decreased expression of TSPAN31 mRNA CTD PMID:36331819 Tspan31 Rat 1,2-dimethylhydrazine multiple interactions ISO Tspan31 (Mus musculus) 6480464 [1 and 2-Dimethylhydrazine co-treated with Folic Acid] results in decreased expression of TSPAN31 mRNA CTD PMID:22206623 Tspan31 Rat 17alpha-ethynylestradiol multiple interactions ISO Tspan31 (Mus musculus) 6480464 [Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of TSPAN31 mRNA CTD PMID:17942748 Tspan31 Rat 17beta-estradiol increases expression ISO Tspan31 (Mus musculus) 6480464 Estradiol results in increased expression of TSPAN31 mRNA CTD PMID:39298647 Tspan31 Rat 2,3,7,8-tetrachlorodibenzodioxine increases expression ISO Tspan31 (Mus musculus) 6480464 Tetrachlorodibenzodioxin results in increased expression of TSPAN31 mRNA CTD PMID:19770486 Tspan31 Rat 2,3,7,8-tetrachlorodibenzodioxine decreases expression EXP 6480464 Tetrachlorodibenzodioxin results in decreased expression of TSPAN31 mRNA CTD PMID:34747641 Tspan31 Rat 2,3,7,8-tetrachlorodibenzodioxine multiple interactions ISO Tspan31 (Mus musculus) 6480464 [Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of TSPAN31 mRNA CTD PMID:17942748 Tspan31 Rat 2,3,7,8-tetrachlorodibenzodioxine affects expression ISO Tspan31 (Mus musculus) 6480464 Tetrachlorodibenzodioxin affects the expression of TSPAN31 mRNA CTD PMID:21570461 Tspan31 Rat 3-isobutyl-1-methyl-7H-xanthine multiple interactions ISO TSPAN31 (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol A] results in increased expression of TSPAN31 mRNA CTD PMID:28628672 Tspan31 Rat 4,4'-diaminodiphenylmethane decreases expression ISO Tspan31 (Mus musculus) 6480464 4 and 4'-diaminodiphenylmethane results in decreased expression of TSPAN31 mRNA CTD PMID:18648102 Tspan31 Rat 4,4'-sulfonyldiphenol increases expression ISO Tspan31 (Mus musculus) 6480464 bisphenol S results in increased expression of TSPAN31 mRNA CTD PMID:39298647 Tspan31 Rat 4-hydroxynon-2-enal decreases expression ISO TSPAN31 (Homo sapiens) 6480464 4-hydroxy-2-nonenal results in decreased expression of TSPAN31 mRNA CTD PMID:12419474 Tspan31 Rat 5-aza-2'-deoxycytidine affects expression ISO TSPAN31 (Homo sapiens) 6480464 Decitabine affects the expression of TSPAN31 mRNA CTD PMID:23300844 Tspan31 Rat acrylamide increases expression ISO TSPAN31 (Homo sapiens) 6480464 Acrylamide results in increased expression of TSPAN31 mRNA CTD PMID:32763439 Tspan31 Rat all-trans-retinoic acid increases expression ISO TSPAN31 (Homo sapiens) 6480464 Tretinoin results in increased expression of TSPAN31 mRNA CTD PMID:33167477 Tspan31 Rat amphetamine increases expression EXP 6480464 Amphetamine results in increased expression of TSPAN31 mRNA CTD PMID:30779732 Tspan31 Rat aristolochic acid A decreases expression ISO TSPAN31 (Homo sapiens) 6480464 aristolochic acid I results in decreased expression of TSPAN31 mRNA and aristolochic acid I results in decreased expression of TSPAN31 protein CTD PMID:33212167 Tspan31 Rat arsane multiple interactions ISO TSPAN31 (Homo sapiens) 6480464 [sodium arsenite results in increased abundance of Arsenic] which results in decreased expression of TSPAN31 mRNA CTD PMID:39836092 Tspan31 Rat arsenic atom multiple interactions ISO TSPAN31 (Homo sapiens) 6480464 [sodium arsenite results in increased abundance of Arsenic] which results in decreased expression of TSPAN31 mRNA CTD PMID:39836092 Tspan31 Rat arsenous acid multiple interactions ISO TSPAN31 (Homo sapiens) 6480464 Arsenic Trioxide inhibits the reaction [4-aminophenylarsenoxide binds to TSPAN31 protein] CTD PMID:26598702 Tspan31 Rat bis(2-ethylhexyl) phthalate increases expression ISO Tspan31 (Mus musculus) 6480464 Diethylhexyl Phthalate results in increased expression of TSPAN31 mRNA CTD PMID:33754040 Tspan31 Rat bisphenol A increases expression EXP 6480464 bisphenol A results in increased expression of TSPAN31 mRNA CTD PMID:25181051 Tspan31 Rat bisphenol A decreases expression EXP 6480464 bisphenol A results in decreased expression of TSPAN31 mRNA CTD PMID:34947998 Tspan31 Rat bisphenol A multiple interactions ISO TSPAN31 (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol A] results in increased expression of TSPAN31 mRNA CTD PMID:28628672 Tspan31 Rat bisphenol A increases methylation ISO Tspan31 (Mus musculus) 6480464 bisphenol A results in increased methylation of TSPAN31 promoter CTD PMID:27312807 Tspan31 Rat cadmium atom decreases expression ISO TSPAN31 (Homo sapiens) 6480464 Cadmium results in decreased expression of TSPAN31 mRNA CTD PMID:23369406 Tspan31 Rat cadmium atom multiple interactions ISO TSPAN31 (Homo sapiens) 6480464 [Cadmium Chloride results in increased abundance of Cadmium] which results in increased expression of TSPAN31 mRNA CTD PMID:35301059 Tspan31 Rat cadmium dichloride multiple interactions ISO TSPAN31 (Homo sapiens) 6480464 [Cadmium Chloride results in increased abundance of Cadmium] which results in increased expression of TSPAN31 mRNA CTD PMID:35301059 Tspan31 Rat calcitriol increases expression ISO TSPAN31 (Homo sapiens) 6480464 Calcitriol results in increased expression of TSPAN31 mRNA CTD PMID:21592394 Tspan31 Rat calcitriol multiple interactions ISO TSPAN31 (Homo sapiens) 6480464 [Testosterone co-treated with Calcitriol] results in increased expression of TSPAN31 mRNA CTD PMID:21592394 Tspan31 Rat CGP 52608 multiple interactions ISO TSPAN31 (Homo sapiens) 6480464 CGP 52608 promotes the reaction [RORA protein binds to TSPAN31 gene] CTD PMID:28238834 Tspan31 Rat chlorpyrifos increases expression ISO Tspan31 (Mus musculus) 6480464 Chlorpyrifos results in increased expression of TSPAN31 mRNA CTD PMID:37019170 Tspan31 Rat cisplatin affects expression ISO TSPAN31 (Homo sapiens) 6480464 Cisplatin affects the expression of TSPAN31 mRNA CTD PMID:23300844 Tspan31 Rat clobetasol increases expression ISO Tspan31 (Mus musculus) 6480464 Clobetasol results in increased expression of TSPAN31 mRNA CTD PMID:27462272 Tspan31 Rat cobalt dichloride decreases expression ISO TSPAN31 (Homo sapiens) 6480464 cobaltous chloride results in decreased expression of TSPAN31 mRNA CTD PMID:19320972 and PMID:19376846 Tspan31 Rat copper atom multiple interactions ISO TSPAN31 (Homo sapiens) 6480464 [NSC 689534 binds to Copper] which results in increased expression of TSPAN31 mRNA CTD PMID:20971185 Tspan31 Rat copper(0) multiple interactions ISO TSPAN31 (Homo sapiens) 6480464 [NSC 689534 binds to Copper] which results in increased expression of TSPAN31 mRNA CTD PMID:20971185 Tspan31 Rat coumestrol multiple interactions ISO TSPAN31 (Homo sapiens) 6480464 [Coumestrol co-treated with 2 more ... CTD PMID:19167446 Tspan31 Rat coumestrol decreases expression ISO TSPAN31 (Homo sapiens) 6480464 Coumestrol results in decreased expression of TSPAN31 mRNA CTD PMID:19167446 Tspan31 Rat crocidolite asbestos decreases expression ISO Tspan31 (Mus musculus) 6480464 Asbestos and Crocidolite results in decreased expression of TSPAN31 mRNA CTD PMID:29279043 Tspan31 Rat cyclosporin A increases expression ISO Tspan31 (Mus musculus) 6480464 Cyclosporine results in increased expression of TSPAN31 mRNA CTD PMID:19770486 Tspan31 Rat dexamethasone multiple interactions ISO TSPAN31 (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol A] results in increased expression of TSPAN31 mRNA CTD PMID:28628672 Tspan31 Rat diarsenic trioxide multiple interactions ISO TSPAN31 (Homo sapiens) 6480464 Arsenic Trioxide inhibits the reaction [4-aminophenylarsenoxide binds to TSPAN31 protein] CTD PMID:26598702 Tspan31 Rat Dibutyl phosphate affects expression ISO TSPAN31 (Homo sapiens) 6480464 di-n-butylphosphoric acid affects the expression of TSPAN31 mRNA CTD PMID:37042841 Tspan31 Rat endosulfan increases expression EXP 6480464 Endosulfan results in increased expression of TSPAN31 mRNA CTD PMID:29391264 Tspan31 Rat Enterolactone multiple interactions ISO TSPAN31 (Homo sapiens) 6480464 [Coumestrol co-treated with 2 and 3-bis(3'-hydroxybenzyl)butyrolactone] results in decreased expression of TSPAN31 mRNA CTD PMID:19167446 Tspan31 Rat flutamide increases expression EXP 6480464 Flutamide results in increased expression of TSPAN31 mRNA CTD PMID:24136188 Tspan31 Rat folic acid multiple interactions ISO Tspan31 (Mus musculus) 6480464 [1 and 2-Dimethylhydrazine co-treated with Folic Acid] results in decreased expression of TSPAN31 mRNA CTD PMID:22206623 Tspan31 Rat glyphosate decreases expression EXP 6480464 Glyphosate results in decreased expression of TSPAN31 mRNA CTD PMID:26302742 Tspan31 Rat indometacin multiple interactions ISO TSPAN31 (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol A] results in increased expression of TSPAN31 mRNA CTD PMID:28628672 Tspan31 Rat inulin multiple interactions ISO Tspan31 (Mus musculus) 6480464 [perfluorooctane sulfonic acid co-treated with Inulin] results in decreased expression of TSPAN31 mRNA CTD PMID:36331819 Tspan31 Rat paracetamol increases expression ISO TSPAN31 (Homo sapiens) 6480464 Acetaminophen results in increased expression of TSPAN31 mRNA CTD PMID:22230336 Tspan31 Rat perfluorooctane-1-sulfonic acid multiple interactions ISO Tspan31 (Mus musculus) 6480464 [perfluorooctane sulfonic acid co-treated with Cellulose] results in decreased expression of TSPAN31 mRNA more ... CTD PMID:36331819 Tspan31 Rat resveratrol multiple interactions ISO TSPAN31 (Homo sapiens) 6480464 [Coumestrol co-treated with resveratrol] results in decreased expression of TSPAN31 mRNA CTD PMID:19167446 Tspan31 Rat silicon dioxide decreases expression ISO TSPAN31 (Homo sapiens) 6480464 Silicon Dioxide analog results in decreased expression of TSPAN31 mRNA CTD PMID:25895662 Tspan31 Rat sodium arsenite increases expression ISO TSPAN31 (Homo sapiens) 6480464 sodium arsenite results in increased expression of TSPAN31 mRNA CTD PMID:12016162 and PMID:38568856 Tspan31 Rat sodium arsenite multiple interactions ISO TSPAN31 (Homo sapiens) 6480464 [sodium arsenite results in increased abundance of Arsenic] which results in decreased expression of TSPAN31 mRNA CTD PMID:39836092 Tspan31 Rat sodium arsenite decreases expression ISO TSPAN31 (Homo sapiens) 6480464 sodium arsenite results in decreased expression of TSPAN31 mRNA CTD PMID:34032870 Tspan31 Rat tert-butyl hydroperoxide decreases expression ISO TSPAN31 (Homo sapiens) 6480464 tert-Butylhydroperoxide results in decreased expression of TSPAN31 mRNA CTD PMID:12419474 Tspan31 Rat testosterone multiple interactions ISO TSPAN31 (Homo sapiens) 6480464 [Testosterone co-treated with Calcitriol] results in increased expression of TSPAN31 mRNA CTD PMID:21592394 Tspan31 Rat testosterone increases expression ISO TSPAN31 (Homo sapiens) 6480464 Testosterone results in increased expression of TSPAN31 mRNA CTD PMID:21592394 Tspan31 Rat thioacetamide decreases expression EXP 6480464 Thioacetamide results in decreased expression of TSPAN31 mRNA CTD PMID:34492290 Tspan31 Rat triptonide increases expression ISO Tspan31 (Mus musculus) 6480464 triptonide results in increased expression of TSPAN31 mRNA CTD PMID:33045310 Tspan31 Rat valproic acid affects expression ISO Tspan31 (Mus musculus) 6480464 Valproic Acid affects the expression of TSPAN31 mRNA CTD PMID:17963808 Tspan31 Rat valproic acid decreases expression ISO Tspan31 (Mus musculus) 6480464 Valproic Acid results in decreased expression of TSPAN31 mRNA CTD PMID:21427059 Tspan31 Rat valproic acid increases expression ISO TSPAN31 (Homo sapiens) 6480464 Valproic Acid results in increased expression of TSPAN31 mRNA CTD PMID:23179753 and PMID:27188386 Tspan31 Rat vorinostat increases expression ISO TSPAN31 (Homo sapiens) 6480464 vorinostat results in increased expression of TSPAN31 mRNA CTD PMID:27188386
Tspan31 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 7 64,774,881 - 64,783,534 (-) NCBI GRCr8 mRatBN7.2 7 62,889,552 - 62,892,428 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 7 62,889,552 - 62,898,388 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 7 64,778,864 - 64,781,738 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 7 66,981,266 - 66,984,140 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 7 66,782,317 - 66,785,191 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 7 70,352,679 - 70,355,555 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 7 70,352,251 - 70,355,619 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 7 70,530,381 - 70,533,257 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 7 67,019,168 - 67,022,042 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 7 67,039,898 - 67,042,772 (-) NCBI Celera 7 60,032,790 - 60,035,664 (-) NCBI Celera Cytogenetic Map 7 q22 NCBI
TSPAN31 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 12 57,745,039 - 57,750,219 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 12 57,738,013 - 57,750,219 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 12 58,138,822 - 58,144,002 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 12 56,425,051 - 56,428,293 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 12 56,425,050 - 56,428,292 NCBI Celera 12 57,796,378 - 57,799,620 (+) NCBI Celera Cytogenetic Map 12 q14.1 NCBI HuRef 12 55,175,625 - 55,178,866 (+) NCBI HuRef CHM1_1 12 58,106,588 - 58,109,831 (+) NCBI CHM1_1 T2T-CHM13v2.0 12 57,713,393 - 57,718,569 (+) NCBI T2T-CHM13v2.0
Tspan31 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 10 126,903,156 - 126,906,977 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 10 126,903,149 - 126,906,133 (-) Ensembl GRCm39 Ensembl GRCm38 10 127,067,287 - 127,070,972 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 10 127,067,280 - 127,070,264 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 10 126,504,346 - 126,507,317 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 10 126,470,239 - 126,473,210 (-) NCBI MGSCv36 mm8 Celera 10 129,459,800 - 129,462,771 (-) NCBI Celera Cytogenetic Map 10 D3 NCBI cM Map 10 74.5 NCBI
Tspan31 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955458 5,455,012 - 5,457,904 (+) Ensembl ChiLan1.0 ChiLan1.0 NW_004955458 5,455,012 - 5,457,912 (+) NCBI ChiLan1.0 ChiLan1.0
TSPAN31 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 10 36,592,776 - 36,602,941 (-) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 12 36,590,293 - 36,599,712 (-) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 12 31,178,439 - 31,188,737 (-) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 12 31,438,856 - 31,442,261 (-) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 12 31,438,856 - 31,442,267 (-) Ensembl panpan1.1 panPan2
TSPAN31 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 10 1,810,047 - 1,812,702 (+) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 10 1,810,159 - 1,812,692 (+) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 10 1,873,096 - 1,875,764 (+) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 10 1,819,306 - 1,821,975 (+) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 10 1,819,040 - 1,821,965 (+) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 10 1,797,017 - 1,799,685 (+) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 10 2,039,110 - 2,041,778 (+) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 10 2,163,976 - 2,166,644 (+) NCBI UU_Cfam_GSD_1.0
Tspan31 Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024404945 56,983,948 - 56,986,963 (-) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936646 1,883,341 - 1,889,284 (+) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936646 1,883,272 - 1,886,287 (+) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
TSPAN31
TSPAN31 Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 11 53,658,532 - 53,661,159 (+) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 11 53,658,802 - 53,660,951 (+) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666037 192,300,418 - 192,303,788 (-) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Tspan31
.
Predicted Target Of
Count of predictions: 234 Count of miRNA genes: 147 Interacting mature miRNAs: 168 Transcripts: ENSRNOT00000031272 Prediction methods: Microtar, Miranda, Rnahybrid, Targetscan Result types: miRGate_prediction
7411569 Bw137 Body weight QTL 137 0.001 body mass (VT:0001259) body weight gain (CMO:0000420) 7 21921195 66921195 Rat 1300179 Kidm5 Kidney mass QTL 5 3.51 kidney mass (VT:0002707) left kidney wet weight (CMO:0000083) 7 43747012 135012528 Rat 2293667 Bss42 Bone structure and strength QTL 42 7.25 0.0001 lumbar vertebra size trait (VT:0010518) lumbar vertebra cross-sectional area (CMO:0001689) 7 47651439 92651439 Rat 10053722 Scort27 Serum corticosterone level QTL 27 2.41 0.0083 blood corticosterone amount (VT:0005345) plasma corticosterone level (CMO:0001173) 7 43228750 88228750 Rat 1641885 Alcrsp9 Alcohol response QTL 9 alcohol metabolism trait (VT:0015089) blood ethanol level (CMO:0000535) 7 24099606 69099606 Rat 1549840 Bss5 Bone structure and strength QTL 5 9.8 femur strength trait (VT:0010010) femur midshaft polar moment of inertia (CMO:0001669) 7 24751841 69751841 Rat 2317035 Aia16 Adjuvant induced arthritis QTL 16 2.71 joint integrity trait (VT:0010548) right rear ankle joint diameter (CMO:0002150) 7 59238038 104238038 Rat 1300127 Srn1 Serum renin concentration QTL 1 3.87 blood renin amount (VT:0003349) plasma renin activity level (CMO:0000116) 7 29409683 84928080 Rat 10059605 Kidm47 Kidney mass QTL 47 2.91 0.05 kidney mass (VT:0002707) both kidneys wet weight to body weight ratio (CMO:0000340) 7 47251783 65728867 Rat 2293678 Bss24 Bone structure and strength QTL 24 6.71 0.0001 femur morphology trait (VT:0000559) femur cross-sectional area (CMO:0001661) 7 47651439 92651439 Rat 1358361 Sradr5 Stress Responsive Adrenal Weight QTL 5 5.55 adrenal gland mass (VT:0010420) both adrenal glands wet weight (CMO:0000164) 7 43747012 108555253 Rat 631513 Scl7 Serum cholesterol level QTL 7 4.1 blood cholesterol amount (VT:0000180) serum total cholesterol level (CMO:0000363) 7 37960569 82960569 Rat 2293685 Bmd21 Bone mineral density QTL 21 4.2 0.0003 femur mineral mass (VT:0010011) total volumetric bone mineral density (CMO:0001728) 7 47651439 92651439 Rat 10755453 Coatc12 Coat color QTL 12 0 coat/hair pigmentation trait (VT:0010463) pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812) 7 31112832 76112832 Rat 631504 Cm27 Cardiac mass QTL 27 3.45 heart left ventricle mass (VT:0007031) heart left ventricle wet weight (CMO:0000071) 7 44421311 118198041 Rat 10755451 Coatc11 Coat color QTL 11 0 coat/hair pigmentation trait (VT:0010463) pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812) 7 17944357 62944357 Rat 634326 Hc3 Hypercalciuria QTL 3 2.1 urine calcium amount (VT:0002985) urine calcium excretion rate (CMO:0000763) 7 42787314 87787314 Rat 2293696 Bmd32 Bone mineral density QTL 32 5.1 0.0001 femur strength trait (VT:0010010) femoral neck polar moment of inertia (CMO:0001670) 7 47651439 92651439 Rat 7411605 Foco14 Food consumption QTL 14 24.1 0.001 eating behavior trait (VT:0001431) feed conversion ratio (CMO:0001312) 7 34293282 79293282 Rat 1300151 Bp181 Blood pressure QTL 181 3.36 arterial blood pressure trait (VT:2000000) diastolic blood pressure (CMO:0000005) 7 53612714 103945643 Rat 1559283 Emca4 Estrogen-induced mammary cancer QTL 4 3.7 mammary gland integrity trait (VT:0010552) percentage of study population developing mammary tumors during a period of time (CMO:0000948) 7 62004452 101773158 Rat 1643004 Pain2 Pain QTL 2 1 mechanical nociception trait (VT:0002734) self mutilation severity score (CMO:0002145) 7 9462246 98011544 Rat 738030 Anxrr8 Anxiety related response QTL 8 4.1 exploratory behavior trait (VT:0010471) number of entries into a discrete space in an experimental apparatus (CMO:0000960) 7 46590070 91590070 Rat 1300149 Cm6 Cardiac mass QTL 6 4.09 heart mass (VT:0007028) heart left ventricle weight to body weight ratio (CMO:0000530) 7 43747099 102228765 Rat 631534 Lnnr1 Liver neoplastic nodule remodeling QTL 1 3.85 0.001 liver integrity trait (VT:0010547) liver remodeling tumorous lesion number to liver total tumorous lesion number ratio (CMO:0001705) 7 34293282 79293282 Rat 634336 Anxrr17 Anxiety related response QTL 17 3.66 locomotor behavior trait (VT:0001392) number of entries into a discrete space in an experimental apparatus (CMO:0000960) 7 924703 115097879 Rat 2293707 Bss32 Bone structure and strength QTL 32 7.64 0.0001 femur strength trait (VT:0010010) femur midshaft polar moment of inertia (CMO:0001669) 7 47651439 92651439 Rat 61357 Bp38 Blood pressure QTL 38 1.6 0.052 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 7 41333674 119109060 Rat 2293644 Bmd29 Bone mineral density QTL 29 5.4 0.0001 femur size trait (VT:1000369) femoral neck cross-sectional area (CMO:0001697) 7 47651439 92651439 Rat 70190 Mcs6 Mammary carcinoma susceptibility QTL 6 2.29 mammary gland integrity trait (VT:0010552) mammary tumor number (CMO:0000343) 7 26737401 63902784 Rat 2300178 Bmd54 Bone mineral density QTL 54 5.3 0.0001 femur mineral mass (VT:0010011) volumetric bone mineral density (CMO:0001553) 7 47651439 92651439 Rat 1298528 Bp169 Blood pressure QTL 169 0.0001 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 7 61074194 106074194 Rat 61428 Scl3 Serum cholesterol level QTL 3 3.2 blood cholesterol amount (VT:0000180) serum total cholesterol level (CMO:0000363) 7 44867533 89867533 Rat 1300132 Bp182 Blood pressure QTL 182 3.49 arterial blood pressure trait (VT:2000000) blood pressure time series experimental set point of the baroreceptor response (CMO:0002593) 7 19654317 84928080 Rat 1576303 Ept7 Estrogen-induced pituitary tumorigenesis QTL 7 3.7 pituitary gland mass (VT:0010496) pituitary gland wet weight (CMO:0000853) 7 62004452 101773158 Rat 10402855 Bp379 Blood pressure QTL 379 0.21 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 7 29409683 74409683 Rat
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
11
49
113
91
90
59
25
59
6
218
97
93
45
60
31
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000031272 ⟹ ENSRNOP00000036976
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 7 62,889,552 - 62,898,388 (-) Ensembl Rnor_6.0 Ensembl 7 70,352,251 - 70,355,619 (-) Ensembl
RefSeq Acc Id:
NM_001008378 ⟹ NP_001008379
RefSeq Status:
PROVISIONAL
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 7 64,774,883 - 64,777,757 (-) NCBI mRatBN7.2 7 62,889,554 - 62,892,428 (-) NCBI Rnor_6.0 7 70,352,681 - 70,355,555 (-) NCBI Rnor_5.0 7 70,530,381 - 70,533,257 (-) NCBI RGSC_v3.4 7 67,019,168 - 67,022,042 (-) RGD Celera 7 60,032,790 - 60,035,664 (-) RGD
Sequence:
TTAAAGCGATAGACGCTGTTGGATTCCTACAAGACGGTCCTCAGTACCCTCCCCACAAGTCTTGGGACCATTCGGGTCCCCAGATCTGGGGAGATGGCTTGCGGCGGATTTGCCTGTTCCAAGAATGC
hide sequence
RefSeq Acc Id:
XM_017594923 ⟹ XP_017450412
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 7 64,774,881 - 64,777,490 (-) NCBI mRatBN7.2 7 62,889,552 - 62,892,173 (-) NCBI Rnor_6.0 7 70,352,679 - 70,355,318 (-) NCBI
Sequence:
TACTGGGGGTTCTGGGAAGCTTCCCAGAAACTTCCGGCGAAGAGGGAATTCCTGGTTACTTCCGTGAAGAGGAGAGACTTCCGGTGATGGGGGCTTGTTTGGTGGTGGGCAGAGGTGAATTGAAGACT
hide sequence
RefSeq Acc Id:
XM_063263798 ⟹ XP_063119868
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 7 64,774,881 - 64,778,127 (-) NCBI
RefSeq Acc Id:
XM_063263799 ⟹ XP_063119869
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 7 64,774,881 - 64,783,534 (-) NCBI
RefSeq Acc Id:
NP_001008379 ⟸ NM_001008378
- UniProtKB:
Q5U1V9 (UniProtKB/Swiss-Prot), A6HQS1 (UniProtKB/TrEMBL)
- Sequence:
MACGGFACSKNALCALNVVYMLVGLLLIGVAAWGKGLGVVSSIHIIGGVIAVGVFLLLIAVAGLVGAVNHHQVLLFFYMIILGLVFIFQFGISCSCLAINRNTQADVINASWWVLSNSTRHELERSFD
hide sequence
RefSeq Acc Id:
XP_017450412 ⟸ XM_017594923
- Peptide Label:
isoform X2
- UniProtKB:
A0A8L2ULA8 (UniProtKB/TrEMBL)
- Sequence:
MLDNAKLVGLLLIGVAAWGKGLGVVSSIHIIGGVIAVGVFLLLIAVAGLVGAVNHHQVLLFFYMIILGLVFIFQFGISCSCLAINRNTQADVINASWWVLSNSTRHELERSFDCCGLFNLTTVHLHDD
hide sequence
Ensembl Acc Id:
ENSRNOP00000036976 ⟸ ENSRNOT00000031272
RefSeq Acc Id:
XP_063119869 ⟸ XM_063263799
- Peptide Label:
isoform X1
- UniProtKB:
Q5U1V9 (UniProtKB/Swiss-Prot), A6HQS1 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063119868 ⟸ XM_063263798
- Peptide Label:
isoform X1
- UniProtKB:
Q5U1V9 (UniProtKB/Swiss-Prot), A6HQS1 (UniProtKB/TrEMBL)
RGD ID: 13695248 Promoter ID: EPDNEW_R5773 Type: initiation region Name: Tspan31_1 Description: tetraspanin 31 SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Rat Assembly Chr Position (strand) Source Rnor_6.0 7 70,355,545 - 70,355,605 EPDNEW
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2006-03-30
Tspan31
tetraspanin 31
Sas
sarcoma amplified sequence
Symbol and Name updated
1299863 APPROVED
2005-12-06
Sas
sarcoma amplified sequence
Sas_predicted
sarcoma amplified sequence (predicted)
Symbol and Name updated
1559027 APPROVED
2005-01-12
Sas_predicted
sarcoma amplified sequence (predicted)
Symbol and Name status set to approved
70820 APPROVED
