Symbol:
Tspan31
Name:
tetraspanin 31
RGD ID:
1617557
MGI Page
MGI
Description:
Predicted to be located in membrane. Is expressed in brain. Orthologous to human TSPAN31 (tetraspanin 31).
Type:
protein-coding
RefSeq Status:
VALIDATED
Previously known as:
2700085A14Rik; AW742554; sarcoma amplified sequence; sarcoma-amplified sequence homolog; Sas; tetraspanin-31; Tsp; tspan-31
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Species
Gene symbol and name
Data Source
Assertion derived from
less info ...
Orthologs 1
Homo sapiens (human):
TSPAN31 (tetraspanin 31) HGNC
EggNOG, Ensembl, HGNC, HomoloGene, Inparanoid, NCBI, OMA, OrthoDB, OrthoMCL, Panther, PhylomeDB, Treefam
Rattus norvegicus (Norway rat):
Tspan31 (tetraspanin 31) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chinchilla lanigera (long-tailed chinchilla):
Tspan31 (tetraspanin 31) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Pan paniscus (bonobo/pygmy chimpanzee):
TSPAN31 (tetraspanin 31) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Canis lupus familiaris (dog):
TSPAN31 (tetraspanin 31) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Ictidomys tridecemlineatus (thirteen-lined ground squirrel):
Tspan31 (tetraspanin 31) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Sus scrofa (pig):
TSPAN31 (tetraspanin 31) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chlorocebus sabaeus (green monkey):
TSPAN31 (tetraspanin 31) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Heterocephalus glaber (naked mole-rat):
Tspan31 (tetraspanin 31) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Alliance orthologs 3
Rattus norvegicus (Norway rat):
Tspan31 (tetraspanin 31)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Homo sapiens (human):
TSPAN31 (tetraspanin 31)
Alliance
DIOPT (Ensembl Compara|HGNC|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Danio rerio (zebrafish):
tspan31 (tetraspanin 31)
Alliance
DIOPT (Ensembl Compara|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid|ZFIN)
Drosophila melanogaster (fruit fly):
Tsp97E
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Xenopus tropicalis (tropical clawed frog):
tspan31
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB)
Latest Assembly:
GRCm39 - Mouse Genome Assembly GRCm39
Position:
Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 10 126,903,156 - 126,906,977 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 10 126,903,149 - 126,906,133 (-) Ensembl GRCm39 Ensembl GRCm38 10 127,067,287 - 127,070,972 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 10 127,067,280 - 127,070,264 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 10 126,504,346 - 126,507,317 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 10 126,470,239 - 126,473,210 (-) NCBI MGSCv36 mm8 Celera 10 129,459,800 - 129,462,771 (-) NCBI Celera Cytogenetic Map 10 D3 NCBI cM Map 10 74.5 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Tspan31 Mouse (1->4)-beta-D-glucan multiple interactions EXP 6480464 [perfluorooctane sulfonic acid co-treated with Cellulose] results in decreased expression of TSPAN31 mRNA CTD PMID:36331819 Tspan31 Mouse 1,2-dimethylhydrazine multiple interactions EXP 6480464 [1 and 2-Dimethylhydrazine co-treated with Folic Acid] results in decreased expression of TSPAN31 mRNA CTD PMID:22206623 Tspan31 Mouse 17alpha-ethynylestradiol multiple interactions EXP 6480464 [Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of TSPAN31 mRNA CTD PMID:17942748 Tspan31 Mouse 17beta-estradiol increases expression EXP 6480464 Estradiol results in increased expression of TSPAN31 mRNA CTD PMID:39298647 Tspan31 Mouse 2,3,7,8-tetrachlorodibenzodioxine increases expression EXP 6480464 Tetrachlorodibenzodioxin results in increased expression of TSPAN31 mRNA CTD PMID:19770486 Tspan31 Mouse 2,3,7,8-tetrachlorodibenzodioxine decreases expression ISO Tspan31 (Rattus norvegicus) 6480464 Tetrachlorodibenzodioxin results in decreased expression of TSPAN31 mRNA CTD PMID:34747641 Tspan31 Mouse 2,3,7,8-tetrachlorodibenzodioxine multiple interactions EXP 6480464 [Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of TSPAN31 mRNA CTD PMID:17942748 Tspan31 Mouse 2,3,7,8-tetrachlorodibenzodioxine affects expression EXP 6480464 Tetrachlorodibenzodioxin affects the expression of TSPAN31 mRNA CTD PMID:21570461 Tspan31 Mouse 3-isobutyl-1-methyl-7H-xanthine multiple interactions ISO TSPAN31 (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol A] results in increased expression of TSPAN31 mRNA CTD PMID:28628672 Tspan31 Mouse 4,4'-diaminodiphenylmethane decreases expression EXP 6480464 4 and 4'-diaminodiphenylmethane results in decreased expression of TSPAN31 mRNA CTD PMID:18648102 Tspan31 Mouse 4,4'-sulfonyldiphenol increases expression EXP 6480464 bisphenol S results in increased expression of TSPAN31 mRNA CTD PMID:39298647 Tspan31 Mouse 4-hydroxynon-2-enal decreases expression ISO TSPAN31 (Homo sapiens) 6480464 4-hydroxy-2-nonenal results in decreased expression of TSPAN31 mRNA CTD PMID:12419474 Tspan31 Mouse 5-aza-2'-deoxycytidine affects expression ISO TSPAN31 (Homo sapiens) 6480464 Decitabine affects the expression of TSPAN31 mRNA CTD PMID:23300844 Tspan31 Mouse acrylamide increases expression ISO TSPAN31 (Homo sapiens) 6480464 Acrylamide results in increased expression of TSPAN31 mRNA CTD PMID:32763439 Tspan31 Mouse all-trans-retinoic acid increases expression ISO TSPAN31 (Homo sapiens) 6480464 Tretinoin results in increased expression of TSPAN31 mRNA CTD PMID:33167477 Tspan31 Mouse amphetamine increases expression ISO Tspan31 (Rattus norvegicus) 6480464 Amphetamine results in increased expression of TSPAN31 mRNA CTD PMID:30779732 Tspan31 Mouse aristolochic acid A decreases expression ISO TSPAN31 (Homo sapiens) 6480464 aristolochic acid I results in decreased expression of TSPAN31 mRNA and aristolochic acid I results in decreased expression of TSPAN31 protein CTD PMID:33212167 Tspan31 Mouse arsane multiple interactions ISO TSPAN31 (Homo sapiens) 6480464 [sodium arsenite results in increased abundance of Arsenic] which results in decreased expression of TSPAN31 mRNA CTD PMID:39836092 Tspan31 Mouse arsenic atom multiple interactions ISO TSPAN31 (Homo sapiens) 6480464 [sodium arsenite results in increased abundance of Arsenic] which results in decreased expression of TSPAN31 mRNA CTD PMID:39836092 Tspan31 Mouse arsenous acid multiple interactions ISO TSPAN31 (Homo sapiens) 6480464 Arsenic Trioxide inhibits the reaction [4-aminophenylarsenoxide binds to TSPAN31 protein] CTD PMID:26598702 Tspan31 Mouse bis(2-ethylhexyl) phthalate increases expression EXP 6480464 Diethylhexyl Phthalate results in increased expression of TSPAN31 mRNA CTD PMID:33754040 Tspan31 Mouse bisphenol A increases expression ISO Tspan31 (Rattus norvegicus) 6480464 bisphenol A results in increased expression of TSPAN31 mRNA CTD PMID:25181051 Tspan31 Mouse bisphenol A decreases expression ISO Tspan31 (Rattus norvegicus) 6480464 bisphenol A results in decreased expression of TSPAN31 mRNA CTD PMID:34947998 Tspan31 Mouse bisphenol A multiple interactions ISO TSPAN31 (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol A] results in increased expression of TSPAN31 mRNA CTD PMID:28628672 Tspan31 Mouse bisphenol A increases methylation EXP 6480464 bisphenol A results in increased methylation of TSPAN31 promoter CTD PMID:27312807 Tspan31 Mouse cadmium atom decreases expression ISO TSPAN31 (Homo sapiens) 6480464 Cadmium results in decreased expression of TSPAN31 mRNA CTD PMID:23369406 Tspan31 Mouse cadmium atom multiple interactions ISO TSPAN31 (Homo sapiens) 6480464 [Cadmium Chloride results in increased abundance of Cadmium] which results in increased expression of TSPAN31 mRNA CTD PMID:35301059 Tspan31 Mouse cadmium dichloride multiple interactions ISO TSPAN31 (Homo sapiens) 6480464 [Cadmium Chloride results in increased abundance of Cadmium] which results in increased expression of TSPAN31 mRNA CTD PMID:35301059 Tspan31 Mouse calcitriol increases expression ISO TSPAN31 (Homo sapiens) 6480464 Calcitriol results in increased expression of TSPAN31 mRNA CTD PMID:21592394 Tspan31 Mouse calcitriol multiple interactions ISO TSPAN31 (Homo sapiens) 6480464 [Testosterone co-treated with Calcitriol] results in increased expression of TSPAN31 mRNA CTD PMID:21592394 Tspan31 Mouse CGP 52608 multiple interactions ISO TSPAN31 (Homo sapiens) 6480464 CGP 52608 promotes the reaction [RORA protein binds to TSPAN31 gene] CTD PMID:28238834 Tspan31 Mouse chlorpyrifos increases expression EXP 6480464 Chlorpyrifos results in increased expression of TSPAN31 mRNA CTD PMID:37019170 Tspan31 Mouse cisplatin affects expression ISO TSPAN31 (Homo sapiens) 6480464 Cisplatin affects the expression of TSPAN31 mRNA CTD PMID:23300844 Tspan31 Mouse clobetasol increases expression EXP 6480464 Clobetasol results in increased expression of TSPAN31 mRNA CTD PMID:27462272 Tspan31 Mouse cobalt dichloride decreases expression ISO TSPAN31 (Homo sapiens) 6480464 cobaltous chloride results in decreased expression of TSPAN31 mRNA CTD PMID:19320972 and PMID:19376846 Tspan31 Mouse copper atom multiple interactions ISO TSPAN31 (Homo sapiens) 6480464 [NSC 689534 binds to Copper] which results in increased expression of TSPAN31 mRNA CTD PMID:20971185 Tspan31 Mouse copper(0) multiple interactions ISO TSPAN31 (Homo sapiens) 6480464 [NSC 689534 binds to Copper] which results in increased expression of TSPAN31 mRNA CTD PMID:20971185 Tspan31 Mouse coumestrol multiple interactions ISO TSPAN31 (Homo sapiens) 6480464 [Coumestrol co-treated with 2 more ... CTD PMID:19167446 Tspan31 Mouse coumestrol decreases expression ISO TSPAN31 (Homo sapiens) 6480464 Coumestrol results in decreased expression of TSPAN31 mRNA CTD PMID:19167446 Tspan31 Mouse crocidolite asbestos decreases expression EXP 6480464 Asbestos and Crocidolite results in decreased expression of TSPAN31 mRNA CTD PMID:29279043 Tspan31 Mouse cyclosporin A increases expression EXP 6480464 Cyclosporine results in increased expression of TSPAN31 mRNA CTD PMID:19770486 Tspan31 Mouse dexamethasone multiple interactions ISO TSPAN31 (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol A] results in increased expression of TSPAN31 mRNA CTD PMID:28628672 Tspan31 Mouse diarsenic trioxide multiple interactions ISO TSPAN31 (Homo sapiens) 6480464 Arsenic Trioxide inhibits the reaction [4-aminophenylarsenoxide binds to TSPAN31 protein] CTD PMID:26598702 Tspan31 Mouse Dibutyl phosphate affects expression ISO TSPAN31 (Homo sapiens) 6480464 di-n-butylphosphoric acid affects the expression of TSPAN31 mRNA CTD PMID:37042841 Tspan31 Mouse endosulfan increases expression ISO Tspan31 (Rattus norvegicus) 6480464 Endosulfan results in increased expression of TSPAN31 mRNA CTD PMID:29391264 Tspan31 Mouse Enterolactone multiple interactions ISO TSPAN31 (Homo sapiens) 6480464 [Coumestrol co-treated with 2 and 3-bis(3'-hydroxybenzyl)butyrolactone] results in decreased expression of TSPAN31 mRNA CTD PMID:19167446 Tspan31 Mouse flutamide increases expression ISO Tspan31 (Rattus norvegicus) 6480464 Flutamide results in increased expression of TSPAN31 mRNA CTD PMID:24136188 Tspan31 Mouse folic acid multiple interactions EXP 6480464 [1 and 2-Dimethylhydrazine co-treated with Folic Acid] results in decreased expression of TSPAN31 mRNA CTD PMID:22206623 Tspan31 Mouse glyphosate decreases expression ISO Tspan31 (Rattus norvegicus) 6480464 Glyphosate results in decreased expression of TSPAN31 mRNA CTD PMID:26302742 Tspan31 Mouse indometacin multiple interactions ISO TSPAN31 (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol A] results in increased expression of TSPAN31 mRNA CTD PMID:28628672 Tspan31 Mouse inulin multiple interactions EXP 6480464 [perfluorooctane sulfonic acid co-treated with Inulin] results in decreased expression of TSPAN31 mRNA CTD PMID:36331819 Tspan31 Mouse paracetamol increases expression ISO TSPAN31 (Homo sapiens) 6480464 Acetaminophen results in increased expression of TSPAN31 mRNA CTD PMID:22230336 Tspan31 Mouse perfluorooctane-1-sulfonic acid multiple interactions EXP 6480464 [perfluorooctane sulfonic acid co-treated with Cellulose] results in decreased expression of TSPAN31 mRNA more ... CTD PMID:36331819 Tspan31 Mouse resveratrol multiple interactions ISO TSPAN31 (Homo sapiens) 6480464 [Coumestrol co-treated with resveratrol] results in decreased expression of TSPAN31 mRNA CTD PMID:19167446 Tspan31 Mouse silicon dioxide decreases expression ISO TSPAN31 (Homo sapiens) 6480464 Silicon Dioxide analog results in decreased expression of TSPAN31 mRNA CTD PMID:25895662 Tspan31 Mouse sodium arsenite increases expression ISO TSPAN31 (Homo sapiens) 6480464 sodium arsenite results in increased expression of TSPAN31 mRNA CTD PMID:12016162 and PMID:38568856 Tspan31 Mouse sodium arsenite multiple interactions ISO TSPAN31 (Homo sapiens) 6480464 [sodium arsenite results in increased abundance of Arsenic] which results in decreased expression of TSPAN31 mRNA CTD PMID:39836092 Tspan31 Mouse sodium arsenite decreases expression ISO TSPAN31 (Homo sapiens) 6480464 sodium arsenite results in decreased expression of TSPAN31 mRNA CTD PMID:34032870 Tspan31 Mouse tert-butyl hydroperoxide decreases expression ISO TSPAN31 (Homo sapiens) 6480464 tert-Butylhydroperoxide results in decreased expression of TSPAN31 mRNA CTD PMID:12419474 Tspan31 Mouse testosterone multiple interactions ISO TSPAN31 (Homo sapiens) 6480464 [Testosterone co-treated with Calcitriol] results in increased expression of TSPAN31 mRNA CTD PMID:21592394 Tspan31 Mouse testosterone increases expression ISO TSPAN31 (Homo sapiens) 6480464 Testosterone results in increased expression of TSPAN31 mRNA CTD PMID:21592394 Tspan31 Mouse thioacetamide decreases expression ISO Tspan31 (Rattus norvegicus) 6480464 Thioacetamide results in decreased expression of TSPAN31 mRNA CTD PMID:34492290 Tspan31 Mouse triptonide increases expression EXP 6480464 triptonide results in increased expression of TSPAN31 mRNA CTD PMID:33045310 Tspan31 Mouse valproic acid affects expression EXP 6480464 Valproic Acid affects the expression of TSPAN31 mRNA CTD PMID:17963808 Tspan31 Mouse valproic acid decreases expression EXP 6480464 Valproic Acid results in decreased expression of TSPAN31 mRNA CTD PMID:21427059 Tspan31 Mouse valproic acid increases expression ISO TSPAN31 (Homo sapiens) 6480464 Valproic Acid results in increased expression of TSPAN31 mRNA CTD PMID:23179753 and PMID:27188386 Tspan31 Mouse vorinostat increases expression ISO TSPAN31 (Homo sapiens) 6480464 vorinostat results in increased expression of TSPAN31 mRNA CTD PMID:27188386
Tspan31 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 10 126,903,156 - 126,906,977 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 10 126,903,149 - 126,906,133 (-) Ensembl GRCm39 Ensembl GRCm38 10 127,067,287 - 127,070,972 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 10 127,067,280 - 127,070,264 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 10 126,504,346 - 126,507,317 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 10 126,470,239 - 126,473,210 (-) NCBI MGSCv36 mm8 Celera 10 129,459,800 - 129,462,771 (-) NCBI Celera Cytogenetic Map 10 D3 NCBI cM Map 10 74.5 NCBI
TSPAN31 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 12 57,745,039 - 57,750,219 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 12 57,738,013 - 57,750,219 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 12 58,138,822 - 58,144,002 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 12 56,425,051 - 56,428,293 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 12 56,425,050 - 56,428,292 NCBI Celera 12 57,796,378 - 57,799,620 (+) NCBI Celera Cytogenetic Map 12 q14.1 NCBI HuRef 12 55,175,625 - 55,178,866 (+) NCBI HuRef CHM1_1 12 58,106,588 - 58,109,831 (+) NCBI CHM1_1 T2T-CHM13v2.0 12 57,713,393 - 57,718,569 (+) NCBI T2T-CHM13v2.0
Tspan31 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 7 64,774,881 - 64,783,534 (-) NCBI GRCr8 mRatBN7.2 7 62,889,552 - 62,892,428 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 7 62,889,552 - 62,898,388 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 7 64,778,864 - 64,781,738 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 7 66,981,266 - 66,984,140 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 7 66,782,317 - 66,785,191 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 7 70,352,679 - 70,355,555 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 7 70,352,251 - 70,355,619 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 7 70,530,381 - 70,533,257 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 7 67,019,168 - 67,022,042 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 7 67,039,898 - 67,042,772 (-) NCBI Celera 7 60,032,790 - 60,035,664 (-) NCBI Celera Cytogenetic Map 7 q22 NCBI
Tspan31 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955458 5,455,012 - 5,457,904 (+) Ensembl ChiLan1.0 ChiLan1.0 NW_004955458 5,455,012 - 5,457,912 (+) NCBI ChiLan1.0 ChiLan1.0
TSPAN31 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 10 36,592,776 - 36,602,941 (-) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 12 36,590,293 - 36,599,712 (-) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 12 31,178,439 - 31,188,737 (-) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 12 31,438,856 - 31,442,261 (-) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 12 31,438,856 - 31,442,267 (-) Ensembl panpan1.1 panPan2
TSPAN31 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 10 1,810,047 - 1,812,702 (+) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 10 1,810,159 - 1,812,692 (+) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 10 1,873,096 - 1,875,764 (+) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 10 1,819,306 - 1,821,975 (+) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 10 1,819,040 - 1,821,965 (+) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 10 1,797,017 - 1,799,685 (+) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 10 2,039,110 - 2,041,778 (+) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 10 2,163,976 - 2,166,644 (+) NCBI UU_Cfam_GSD_1.0
Tspan31 Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024404945 56,983,948 - 56,986,963 (-) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936646 1,883,341 - 1,889,284 (+) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936646 1,883,272 - 1,886,287 (+) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
TSPAN31
TSPAN31 Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 11 53,658,532 - 53,661,159 (+) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 11 53,658,802 - 53,660,951 (+) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666037 192,300,418 - 192,303,788 (-) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Tspan31
.
Predicted Target Of
Count of predictions: 369 Count of miRNA genes: 259 Interacting mature miRNAs: 298 Transcripts: ENSMUST00000060991 Prediction methods: Miranda, Rnahybrid, Targetscan Result types: miRGate_prediction
4142461 Bmd25_m bone mineral density 25 (mouse) Not determined 10 97217101 130530862 Mouse 1301968 Estq4_m estradiol regulated response QTL 4 (mouse) Not determined 10 100986516 130530862 Mouse 12904001 Opfaq10_m open field activity QTL 10 (mouse) 10 125633671 129466375 Mouse 12879490 Frct3_m fear conditioning traits 3 (mouse) 10 122785970 129466996 Mouse 11049570 Lmr25b_m leishmaniasis resistance 25b (mouse) 10 108575094 130530862 Mouse 27226772 Tibl13_m tibia length 13, 10 week (mouse) 10 18875748 129635869 Mouse 11533921 Mvb2_m modifier of vibrator 2 (mouse) 10 97217101 130530862 Mouse 4141361 Cfmq3_m cystic fibrosis modifier QTL 3 (mouse) Not determined 10 101497164 130530862 Mouse 4141487 Tgq21_m triglyceride QTL 21 (mouse) Not determined 104110021 130530862 Mouse 27226764 Tibl19_m tibia length 19, 16 week (mouse) 10 39175996 129635869 Mouse 1301895 Exq1_m exploratory and excitability QTL 1 (mouse) Not determined 10 102847852 130530862 Mouse 1300679 Nociq2_m nociceptive sensitivity inflammatory QTL 2 (mouse) Not determined 10 105041304 130530862 Mouse 1300678 Leg2_m longevity extending gene 2 (mouse) Not determined 10 102506908 130530862 Mouse 14746996 Manh69_m mandible shape 69 (mouse) 10 104763638 130530862 Mouse 12880413 V125Dq9_m vitamin D active form serum level QTL 9 (mouse) 10 97535905 130530862 Mouse 1301901 Im5_m immunoregulatory 5 (mouse) Not determined 10 101497164 130530862 Mouse 4141153 Ltgq2_m liver triglyceride QTL 2 (mouse) Not determined 108515907 130530862 Mouse 11039496 Ltpr5b_m Leishmania tropica response 5b (mouse) 10 108575094 130530862 Mouse 1357744 Cfbw4_m cystic fibrosis body weight 4 (mouse) Not determined 10 100986516 130530862 Mouse 4141402 T2dm1sa_m type 2 diabetes mellitus 1 in SMXA RI mice (mouse) Not determined 97758644 130530862 Mouse 11041664 Lmr25_m leishmaniasis resistance 25 (mouse) 10 108575094 130530862 Mouse 1302200 Sle12_m systematic lupus erythematosus susceptibility 12 (mouse) Not determined 10 105041304 130530862 Mouse 26884405 Huml2_m humerus length 2, 5 week (mouse) 10 69735830 130430862 Mouse 11533919 Mvb4_m modifier of vibrator 4 (mouse) 3 97217101 130530862 Mouse 4141007 Obrq10_m obesity resistance QTL 10 (mouse) Not determined 103243727 130530862 Mouse 12911220 Frct3c_m fear conditioning traits 3c (mouse) 10 122785970 129466996 Mouse 11049563 Lmr25a_m leishmaniasis resistance 25a (mouse) 10 108575094 130530862 Mouse 4142089 Obrq9_m obesity resistance QTL 9 (mouse) Not determined 108515907 130530862 Mouse 14696727 Kidrq2_m kidney weight, right QTL 2 (mouse) 10 102902508 130530862 Mouse 12911218 Frct3a_m fear conditioning traits 3a (mouse) 10 122785970 129466996 Mouse 11040593 Lmr5e_m leishmaniasis resistance 5e (mouse) 10 99220635 130530862 Mouse 27095911 Pglq15_m pelvic girdle length QTL 15, 16 week (mouse) 10 39175996 129635869 Mouse 11040594 Lmr5f_m leishmaniasis resistance 5f (mouse) 10 105179713 130530862 Mouse 11040595 Lmr5c_m leishmaniasis resistance 5c (mouse) 10 99220635 130530862 Mouse 1357544 Vtbt10_m vertebral trabecular bone trait 10 (mouse) Not determined 10 97217101 130530862 Mouse 11040596 Lmr5d_m leishmaniasis resistance 5d (mouse) 10 105179713 130530862 Mouse 11040597 Lmr5a_m leishmaniasis resistance 5a (mouse) 10 99220635 130530862 Mouse 1357482 Nhdlq4_m non-HDL QTL 4 (mouse) Not determined 10 105041304 130530862 Mouse 11040598 Lmr5b_m leishmaniasis resistance 5b (mouse) 10 105179713 130530862 Mouse
AW742554
Mouse Assembly Chr Position (strand) Source JBrowse GRCm38 10 127,067,491 - 127,067,748 UniSTS GRCm38 MGSCv37 10 126,504,547 - 126,504,804 UniSTS GRCm37 Celera 10 129,460,001 - 129,460,258 UniSTS Cytogenetic Map 10 D3 UniSTS Whitehead/MRC_RH 10 1414.44 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
Ensembl Acc Id:
ENSMUST00000060991 ⟹ ENSMUSP00000057751
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 10 126,903,149 - 126,906,133 (-) Ensembl GRCm38.p6 Ensembl 10 127,067,280 - 127,070,264 (-) Ensembl
Ensembl Acc Id:
ENSMUST00000217875
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 10 126,905,134 - 126,906,125 (-) Ensembl GRCm38.p6 Ensembl 10 127,069,265 - 127,070,256 (-) Ensembl
Ensembl Acc Id:
ENSMUST00000218488
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 10 126,904,110 - 126,905,269 (-) Ensembl GRCm38.p6 Ensembl 10 127,068,241 - 127,069,400 (-) Ensembl
Ensembl Acc Id:
ENSMUST00000218603
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 10 126,904,776 - 126,905,850 (-) Ensembl GRCm38.p6 Ensembl 10 127,068,907 - 127,069,981 (-) Ensembl
Ensembl Acc Id:
ENSMUST00000220344
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 10 126,905,077 - 126,906,130 (-) Ensembl GRCm38.p6 Ensembl 10 127,069,208 - 127,070,261 (-) Ensembl
RefSeq Acc Id:
NM_025982 ⟹ NP_080258
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 10 126,903,159 - 126,906,130 (-) NCBI GRCm38 10 127,067,290 - 127,070,261 (-) ENTREZGENE MGSCv37 10 126,504,346 - 126,507,317 (-) RGD Celera 10 129,459,800 - 129,462,771 (-) RGD cM Map 10 ENTREZGENE
Sequence:
AGACGCGGTTGGGAGTCCTACAAGACGGTCCTCGATACCCTCCCCACAAGTCTTGGGACCATTTGGGTCCCCAGATCTGGGGAGATGGTTTGCGGCGGATTTGCCTGTTCCAGGAATGCGCTGTGCGC
hide sequence
RefSeq Acc Id:
XM_030245229 ⟹ XP_030101089
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 10 126,903,156 - 126,906,977 (-) NCBI GRCm38 10 127,067,287 - 127,070,972 (-) NCBI
Sequence:
GACAGTATGGAGGCTCTTATTTATTCATATTCCAGACTCGCCCCCACTTTGCGTCATGTGCCAA
hide sequence
RefSeq Acc Id:
XM_030245230 ⟹ XP_030101090
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 10 126,903,156 - 126,905,845 (-) NCBI GRCm38 10 127,067,287 - 127,069,976 (-) NCBI
Sequence:
ACTTCCGTGGAAGAGGATAGATAGACTTCCGGTGATGAGGGGGCTTGTTTGGTGGTGGGCAGGG
hide sequence
RefSeq Acc Id:
NP_080258 ⟸ NM_025982
- UniProtKB:
Q9CUY7 (UniProtKB/Swiss-Prot), Q9CQ88 (UniProtKB/Swiss-Prot)
- Sequence:
MVCGGFACSRNALCALNVVYMLVGFLLIGVAAWGKGLGVVSSIHIIGGVIAVGVFLLLIAVAGLVGAANHHQVLLFFYMIILGLVFIFQFGISCSCLAINRNTQADVINASWSVLSNSTRHELERSFD
hide sequence
RefSeq Acc Id:
XP_030101089 ⟸ XM_030245229
- Peptide Label:
isoform X1
RefSeq Acc Id:
XP_030101090 ⟸ XM_030245230
- Peptide Label:
isoform X1
Ensembl Acc Id:
ENSMUSP00000057751 ⟸ ENSMUST00000060991
RGD ID: 6818847 Promoter ID: MM_KWN:5865 Type: CpG-Island SO ACC ID: SO:0000170 Source: MPROMDB Tissues & Cell Lines: 3T3L1_Day0, 3T3L1_Day1, 3T3L1_Day2, 3T3L1_Day3, 3T3L1_Day4, BoneMarrow_0Hour, BoneMarrow_2Hour, BoneMarrow_4Hour, Brain, ES_Cell, Kidney, Liver, Lung, MEF_B4, MEF_B6, Spleen Transcripts: AK080508_A730063M14RIK, ENSMUST00000060991 Position: Mouse Assembly Chr Position (strand) Source MGSCv36 10 126,506,201 - 126,507,842 (+) MPROMDB
RGD ID: 8673460 Promoter ID: EPDNEW_M14761 Type: initiation region Name: Tspan31_1 Description: Mus musculus tetraspanin 31 , mRNA. SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Mouse Assembly Chr Position (strand) Source GRCm38 10 127,070,261 - 127,070,321 EPDNEW
