D12Got35 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: D12Got35

Symbol: D12Got35
Previously known as: oxsts866; OT51.25; 
RGD ID: 44960
Expected Size: 142 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21217,098,721 - 17,098,867 (+)MAPPERmRatBN7.2
Rnor_6.01219,430,048 - 19,430,193NCBIRnor6.0
Rnor_5.01221,487,649 - 21,487,794UniSTSRnor5.0
RGSC_v3.41217,689,981 - 17,690,123RGDRGSC3.4
RGSC_v3.41217,663,681 - 17,663,827RGDRGSC3.4
RGSC_v3.41217,689,982 - 17,690,123UniSTSRGSC3.4
RGSC_v3.41217,663,682 - 17,663,827UniSTSRGSC3.4
RGSC_v3.11217,679,504 - 17,679,645RGD
Celera1219,028,804 - 19,028,945UniSTS
RH 3.4 Map12254.4UniSTS
RH 3.4 Map12254.4RGD
RH 2.0 Map12175.5RGD
Cytogenetic Map12q11UniSTS
Is Marker For: Genes:   LOC684741   Nxpe5l2   Nxpe5  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. UniSTS Pipeline RGD automated pipelines
4. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
5. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8

Strains and Sequence

Sequence
 
Forward Primer CCTCTGTTTCCCAGGTGTTC
Reverse Primer ATTCCAGGTCAGCTAGGACTACA
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1588255Nxpe5neurexophilin and PC-esterase domain family, member 5121709762417119700Rat



QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
61443Btemp2Thermal response to stress QTL 23.30.000094body temperature trait (VT:0005535)core body temperature (CMO:0001036)121502518320794014Rat
8552964Pigfal17Plasma insulin-like growth factor 1 level QTL 173.5blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)12556449546669029Rat
9590147Scort7Serum corticosterone level QTL 713.610.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)12142110980Rat
1549829Scl48Serum cholesterol level QTL 485blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)12960327746669029Rat
61331Eau2Experimental allergic uveoretinitis QTL 20.0005uvea integrity trait (VT:0010551)experimental autoimmune uveitis score (CMO:0001504)12852542328064601Rat
2293684Bmd26Bone mineral density QTL 264.40.0002femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)121587265332974238Rat
6893681Bw109Body weight QTL 1092.30.004body mass (VT:0001259)body weight (CMO:0000012)12123297788Rat
1302792Scl21Serum cholesterol level QTL 213.80.0011blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)12719673046669029Rat
1598855Bp294Blood pressure QTL 2943.5arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)12134851688Rat
1600391Edcs2Endometrial carcinoma susceptibility QTL23.50.01uterus morphology trait (VT:0001120)percentage of study population developing endometrioid carcinoma during a period of time (CMO:0001759)12683319017870186Rat
10755457Coatc14Coat color QTL 140.01759coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)12122591684Rat
1331761Bp218Blood pressure QTL 2182.973arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)121107382545055165Rat
8694179Bw150Body weight QTL 1502.90.001body mass (VT:0001259)body weight gain (CMO:0000420)12142110980Rat
7411545Bw128Body weight QTL 1285.20.001body mass (VT:0001259)body weight gain (CMO:0000420)12142110980Rat
7411547Bw129Body weight QTL 1290.001body mass (VT:0001259)body weight gain (CMO:0000420)6556449546669029Rat
1300157Rf21Renal function QTL 214.4renal blood flow trait (VT:2000006)absolute change in renal blood flow rate (CMO:0001168)12931821632103380Rat
737979Pia22Pristane induced arthritis QTL 2253.1joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)12144465750Rat
2300186Bmd59Bone mineral density QTL 597.10.0001lumbar vertebra mineral mass (VT:0010511)volumetric bone mineral density (CMO:0001553)121047413746669029Rat
7411660Foco28Food consumption QTL 2810.90.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)12142110980Rat
1331755Bp219Blood pressure QTL 2193.041arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)121107382528064557Rat
2312418Kidm41Kidney mass QTL 413.70.0001kidney mass (VT:0002707)single kidney wet weight to body weight ratio (CMO:0000622)12119611090Rat
7411641Foco19Food consumption QTL 1927.70.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)12556449546669029Rat
1549912Bp268Blood pressure QTL 268arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)101318273646669029Rat
2302060Pia37Pristane induced arthritis QTL 376.10.001blood immunoglobulin amount (VT:0002460)serum immunoglobulin G1 level (CMO:0002115)121319815746669029Rat
1641928Alcrsp5Alcohol response QTL 5response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)121281238546669029Rat
8552912Pigfal6Plasma insulin-like growth factor 1 level QTL 65blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)12556449846669029Rat
10059594Kidm46Kidney mass QTL 463.790.025kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)12610757946669029Rat
1581516Cm56Cardiac mass QTL 564.20.05heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)12129333307Rat
9590086Insglur6Insulin/glucose ratio QTL 618.970.001blood insulin amount (VT:0001560)calculated plasma insulin level (CMO:0002170)12142110980Rat
8552918Pigfal7Plasma insulin-like growth factor 1 level QTL 7blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)12556449546669029Rat
1549902Bp269Blood pressure QTL 269arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)121318273646669029Rat
61404Bw120Body weight QTL 1205.1body mass (VT:0001259)body mass index (BMI) (CMO:0000105)121235161946669029Rat
1331786Kidm11Kidney mass QTL 113.571kidney mass (VT:0002707)right kidney wet weight (CMO:0000082)121107382524234895Rat
2293699Bss49Bone structure and strength QTL 495.610.0001lumbar vertebra size trait (VT:0010518)lumbar vertebra trabecular cross-sectional area (CMO:0001692)121047413746669029Rat
634351Apr5Acute phase response QTL 56.7blood interleukin-6 amount (VT:0008595)plasma interleukin-6 level (CMO:0001927)12144503507Rat
634350Apr4Acute phase response QTL 46orosomucoid 1 amount (VT:0010541)plasma orosomucoid 1 level (CMO:0001467)12117200546172005Rat
61416Pia4Pristane induced arthritis QTL 48.4joint integrity trait (VT:0010548)arthritic paw count (CMO:0001460)121363552330827399Rat
7204484Bp358Blood pressure QTL 3580.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)121300829619212979Rat
7387292Kidm42Kidney mass QTL 423.030.0004kidney mass (VT:0002707)left kidney wet weight (CMO:0000083)12136247923Rat
61421Cia12Collagen induced arthritis QTL 124.6joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)121363552335682913Rat
2303569Gluco44Glucose level QTL 442blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)121281238546669029Rat
7411586Foco5Food consumption QTL 55.40.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)12142110980Rat
2303575Insul14Insulin level QTL 144blood insulin amount (VT:0001560)blood insulin level (CMO:0000349)12142450532Rat
7411588Foco6Food consumption QTL 60.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)12556449546669029Rat
2302042Pia38Pristane induced arthritis QTL 383.50.001blood immunoglobulin amount (VT:0002460)serum immunoglobulin G1 level (CMO:0002115)12144503507Rat
7411595Foco9Food consumption QTL 940.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)12142110980Rat
7411597Foco10Food consumption QTL 100.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)12556449546669029Rat
2293086Iddm30Insulin dependent diabetes mellitus QTL 303.82blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)12844949028302290Rat
631543Bp83Blood pressure QTL 835.8arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)121555082638478808Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 680711 UniSTS
  680825 UniSTS
  684741 UniSTS