Symbol:
Rab38
Name:
RAB38, member RAS oncogene family
RGD ID:
628752
Description:
Enables GTP binding activity. Involved in platelet dense granule organization; positive regulation of biosynthetic process; and positive regulation of protein localization to cell periphery. Located in cell body; melanosome; and perinuclear region of cytoplasm. Used to study Hermansky-Pudlak syndrome and proteinuria. Orthologous to human RAB38 (RAB38, member RAS oncogene family); INTERACTS WITH 1-[(4-chlorophenyl)-phenylmethyl]-4-methylpiperazine; 2,3,7,8-tetrachlorodibenzodioxine; 2,4-dinitrotoluene.
Type:
protein-coding
RefSeq Status:
PROVISIONAL
Previously known as:
R; R_mapped; Rab38, member of RAS oncogene family; ras-related protein Rab-38; red eyed dilution; Ruby; Ruby or red eyed dilution; ruby or red eyed dilution (mapped); small GTP binding protein
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Species
Gene symbol and name
Data Source
Assertion derived from
less info ...
Orthologs 1
Homo sapiens (human):
RAB38 (RAB38, member RAS oncogene family) HGNC
EggNOG, Ensembl, HomoloGene, Inparanoid, NCBI, OMA, OrthoDB, Panther, PhylomeDB, Treefam
Mus musculus (house mouse):
Rab38 (RAB38, member RAS oncogene family) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chinchilla lanigera (long-tailed chinchilla):
Rab38 (RAB38, member RAS oncogene family) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Pan paniscus (bonobo/pygmy chimpanzee):
RAB38 (RAB38, member RAS oncogene family) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Canis lupus familiaris (dog):
RAB38 (RAB38, member RAS oncogene family) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Ictidomys tridecemlineatus (thirteen-lined ground squirrel):
Rab38 (RAB38, member RAS oncogene family) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Sus scrofa (pig):
RAB38 (RAB38, member RAS oncogene family) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chlorocebus sabaeus (green monkey):
RAB38 (RAB38, member RAS oncogene family) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Heterocephalus glaber (naked mole-rat):
Rab38 (RAB38, member RAS oncogene family) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Other homologs 2
Homo sapiens (human):
RAB32 (RAB32, member RAS oncogene family) HGNC
OrthoDB
Alliance orthologs 3
Homo sapiens (human):
RAB38 (RAB38, member RAS oncogene family)
Alliance
DIOPT (Ensembl Compara|HGNC|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Mus musculus (house mouse):
Rab38 (RAB38, member RAS oncogene family)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Danio rerio (zebrafish):
rab38b (RAB38b, member of RAS oncogene family)
Alliance
DIOPT (Ensembl Compara|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Caenorhabditis elegans (roundworm):
glo-1
Alliance
DIOPT (InParanoid|OMA|OrthoInspector|PANTHER|SonicParanoid)
Drosophila melanogaster (fruit fly):
Rab32
Alliance
DIOPT (OrthoFinder|OrthoInspector|PhylomeDB)
Xenopus tropicalis (tropical clawed frog):
rab38
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Allele / Splice:
Rab38ru
Rab38em1Mcwi
Genetic Models:
FHH.BN-(D1Hmgc14-D1Hmgc15 )/Mcwi-Rab38em1Mcwi-/-
FHH.BN-(D1Hmgc14-D1Hmgc15 )/Mcwi-Rab38em1Mcwi
Is Marker For:
Strains:
FHH.BN-(D1Hmgc14-D1Hmgc15 )/Mcwi
FHH.BN-(D1Hmgc14-D1Hmgc15 )/Mcwi-Rab38em1Mcwi+/+
FHH-TgTn(T2/Rab38)1Mcwi
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 1 151,595,153 - 151,675,492 (+) NCBI GRCr8 mRatBN7.2 1 142,182,566 - 142,262,923 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 1 142,182,556 - 142,262,924 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 1 150,149,817 - 150,230,171 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 1 157,326,253 - 157,406,599 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 1 150,200,179 - 150,280,523 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 1 152,072,716 - 152,153,449 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 1 152,072,665 - 152,153,449 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 1 158,385,888 - 158,466,621 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 1 144,783,919 - 144,864,573 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 1 144,862,324 - 144,942,979 (+) NCBI Celera 1 140,481,941 - 140,561,948 (+) NCBI Celera Cytogenetic Map 1 q32 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Rab38 Rat 1,2-dimethylhydrazine increases expression ISO Rab38 (Mus musculus) 6480464 1 and 2-Dimethylhydrazine results in increased expression of RAB38 mRNA CTD PMID:22206623 Rab38 Rat 1-[(4-chlorophenyl)-phenylmethyl]-4-methylpiperazine increases expression EXP 6480464 chlorcyclizine results in increased expression of RAB38 mRNA CTD PMID:21058326 Rab38 Rat 17beta-estradiol multiple interactions ISO RAB38 (Homo sapiens) 6480464 [Estradiol co-treated with TGFB1 protein] results in decreased expression of RAB38 mRNA CTD PMID:30165855 Rab38 Rat 2,3,7,8-tetrachlorodibenzodioxine affects expression ISO RAB38 (Homo sapiens) 6480464 Tetrachlorodibenzodioxin affects the expression of RAB38 mRNA CTD PMID:22298810 Rab38 Rat 2,3,7,8-tetrachlorodibenzodioxine multiple interactions ISO RAB38 (Homo sapiens) 6480464 [Tetrachlorodibenzodioxin co-treated with 2-methyl-2H-pyrazole-3-carboxylic acid (2-methyl-4-o-tolylazophenyl)amide] results in increased expression of RAB38 mRNA CTD PMID:29704546 Rab38 Rat 2,3,7,8-tetrachlorodibenzodioxine increases expression ISO RAB38 (Homo sapiens) 6480464 Tetrachlorodibenzodioxin results in increased expression of RAB38 mRNA CTD PMID:29704546 Rab38 Rat 2,3,7,8-tetrachlorodibenzodioxine decreases expression EXP 6480464 Tetrachlorodibenzodioxin results in decreased expression of RAB38 mRNA CTD PMID:21215274 Rab38 Rat 2,4-dinitrotoluene affects expression EXP 6480464 2 and 4-dinitrotoluene affects the expression of RAB38 mRNA CTD PMID:21346803 Rab38 Rat 3-chloropropane-1,2-diol decreases expression EXP 6480464 alpha-Chlorohydrin results in decreased expression of RAB38 mRNA CTD PMID:28522335 Rab38 Rat 4,4'-sulfonyldiphenol increases expression ISO Rab38 (Mus musculus) 6480464 bisphenol S results in increased expression of RAB38 mRNA CTD PMID:30951980 Rab38 Rat 4-hydroxyphenyl retinamide decreases expression ISO Rab38 (Mus musculus) 6480464 Fenretinide results in decreased expression of RAB38 mRNA CTD PMID:28973697 Rab38 Rat 6-propyl-2-thiouracil increases expression EXP 6480464 Propylthiouracil results in increased expression of RAB38 mRNA CTD PMID:24780913 Rab38 Rat acrylamide increases expression EXP 6480464 Acrylamide results in increased expression of RAB38 mRNA CTD PMID:28959563 Rab38 Rat actinomycin D multiple interactions ISO RAB38 (Homo sapiens) 6480464 [Dactinomycin co-treated with nutlin 3] results in increased expression of RAB38 mRNA CTD PMID:38460933 Rab38 Rat aflatoxin B1 decreases methylation ISO RAB38 (Homo sapiens) 6480464 Aflatoxin B1 results in decreased methylation of RAB38 gene CTD PMID:27153756 Rab38 Rat all-trans-retinoic acid increases expression EXP 6480464 Tretinoin results in increased expression of RAB38 mRNA CTD PMID:20488242 Rab38 Rat all-trans-retinoic acid decreases expression ISO RAB38 (Homo sapiens) 6480464 Tretinoin results in decreased expression of RAB38 mRNA CTD PMID:33167477 Rab38 Rat ammonium chloride affects expression EXP 6480464 Ammonium Chloride affects the expression of RAB38 mRNA CTD PMID:16483693 Rab38 Rat amphetamine increases expression EXP 6480464 Amphetamine results in increased expression of RAB38 mRNA CTD PMID:30779732 Rab38 Rat benzo[a]pyrene increases expression ISO RAB38 (Homo sapiens) 6480464 Benzo(a)pyrene results in increased expression of RAB38 mRNA CTD PMID:20064835 and PMID:30453624 Rab38 Rat benzo[a]pyrene decreases methylation ISO RAB38 (Homo sapiens) 6480464 Benzo(a)pyrene results in decreased methylation of RAB38 promoter CTD PMID:27901495 Rab38 Rat bisphenol A decreases expression EXP 6480464 bisphenol A results in decreased expression of RAB38 mRNA CTD PMID:25181051 and PMID:34947998 Rab38 Rat bisphenol A increases expression EXP 6480464 bisphenol A results in increased expression of RAB38 mRNA CTD PMID:30816183 and PMID:32528016 Rab38 Rat bisphenol A increases expression ISO Rab38 (Mus musculus) 6480464 bisphenol A results in increased expression of RAB38 mRNA CTD PMID:30951980 Rab38 Rat bisphenol F increases expression ISO Rab38 (Mus musculus) 6480464 bisphenol F results in increased expression of RAB38 mRNA CTD PMID:30951980 Rab38 Rat buspirone decreases expression EXP 6480464 Buspirone results in decreased expression of RAB38 mRNA CTD PMID:24136188 Rab38 Rat butan-1-ol multiple interactions ISO RAB38 (Homo sapiens) 6480464 [[Gasoline co-treated with 1-Butanol] results in increased abundance of [Particulate Matter co-treated with Polycyclic Aromatic Hydrocarbons]] which results in increased expression of RAB38 mRNA CTD PMID:29432896 Rab38 Rat cadmium dichloride decreases expression ISO RAB38 (Homo sapiens) 6480464 Cadmium Chloride results in decreased expression of RAB38 mRNA CTD PMID:38568856 Rab38 Rat CGP 52608 multiple interactions ISO RAB38 (Homo sapiens) 6480464 CGP 52608 promotes the reaction [RORA protein binds to RAB38 gene] CTD PMID:28238834 Rab38 Rat chloropicrin decreases expression ISO RAB38 (Homo sapiens) 6480464 chloropicrin results in decreased expression of RAB38 mRNA CTD PMID:26352163 Rab38 Rat dehydroepiandrosterone decreases expression EXP 6480464 Dehydroepiandrosterone results in decreased expression of RAB38 mRNA CTD PMID:16940010 Rab38 Rat dexamethasone decreases expression ISO Rab38 (Mus musculus) 6480464 Dexamethasone results in decreased expression of RAB38 mRNA CTD PMID:22733784 Rab38 Rat dibenz[a,h]anthracene decreases expression ISO Rab38 (Mus musculus) 6480464 1 more ... CTD PMID:26377693 Rab38 Rat Dibutyl phosphate affects expression ISO RAB38 (Homo sapiens) 6480464 di-n-butylphosphoric acid affects the expression of RAB38 mRNA CTD PMID:37042841 Rab38 Rat dichloroacetic acid decreases expression ISO Rab38 (Mus musculus) 6480464 Dichloroacetic Acid results in decreased expression of RAB38 mRNA CTD PMID:28962523 Rab38 Rat diethylstilbestrol decreases expression EXP 6480464 Diethylstilbestrol results in decreased expression of RAB38 mRNA CTD PMID:17005392 Rab38 Rat dioxygen decreases expression ISO Rab38 (Mus musculus) 6480464 Oxygen deficiency results in decreased expression of RAB38 mRNA CTD PMID:20880076 Rab38 Rat dorsomorphin multiple interactions ISO RAB38 (Homo sapiens) 6480464 [NOG protein co-treated with Valproic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of RAB38 mRNA CTD PMID:27188386 Rab38 Rat endosulfan decreases expression EXP 6480464 Endosulfan results in decreased expression of RAB38 mRNA CTD PMID:29391264 Rab38 Rat flutamide decreases expression EXP 6480464 Flutamide results in decreased expression of RAB38 mRNA CTD PMID:24793618 Rab38 Rat FR900359 affects phosphorylation ISO RAB38 (Homo sapiens) 6480464 FR900359 affects the phosphorylation of RAB38 protein CTD PMID:37730182 Rab38 Rat genistein multiple interactions EXP 6480464 [Genistein co-treated with Methoxychlor] results in decreased expression of RAB38 mRNA CTD PMID:21782745 Rab38 Rat glafenine decreases expression EXP 6480464 Glafenine results in decreased expression of RAB38 mRNA CTD PMID:24136188 Rab38 Rat glycidol increases expression EXP 6480464 glycidol results in increased expression of RAB38 mRNA CTD PMID:24395379 Rab38 Rat GW 4064 increases expression ISO Rab38 (Mus musculus) 6480464 GW 4064 results in increased expression of RAB38 mRNA CTD PMID:26655953 Rab38 Rat isobutanol multiple interactions ISO RAB38 (Homo sapiens) 6480464 [[Gasoline co-treated with isobutyl alcohol] results in increased abundance of [Particulate Matter co-treated with Polycyclic Aromatic Hydrocarbons]] which results in increased expression of RAB38 mRNA CTD PMID:29432896 Rab38 Rat isotretinoin decreases expression ISO RAB38 (Homo sapiens) 6480464 Isotretinoin results in decreased expression of RAB38 mRNA CTD PMID:20436886 Rab38 Rat leflunomide decreases expression EXP 6480464 leflunomide results in decreased expression of RAB38 mRNA CTD PMID:24136188 Rab38 Rat methoxychlor multiple interactions EXP 6480464 [Genistein co-treated with Methoxychlor] results in decreased expression of RAB38 mRNA CTD PMID:21782745 Rab38 Rat methylmercury chloride decreases expression ISO RAB38 (Homo sapiens) 6480464 methylmercuric chloride results in decreased expression of RAB38 mRNA CTD PMID:23179753 Rab38 Rat methylphenidate increases expression ISO Rab38 (Mus musculus) 6480464 Methylphenidate results in increased expression of RAB38 mRNA CTD PMID:22470460 Rab38 Rat nefazodone decreases expression EXP 6480464 nefazodone results in decreased expression of RAB38 mRNA CTD PMID:24136188 Rab38 Rat nimesulide decreases expression EXP 6480464 nimesulide results in decreased expression of RAB38 mRNA CTD PMID:24136188 Rab38 Rat Nutlin-3 multiple interactions ISO RAB38 (Homo sapiens) 6480464 [Dactinomycin co-treated with nutlin 3] results in increased expression of RAB38 mRNA CTD PMID:38460933 Rab38 Rat oxycodone decreases expression EXP 6480464 Oxycodone results in decreased expression of RAB38 mRNA CTD PMID:23439660 Rab38 Rat ozone decreases expression EXP 6480464 Ozone results in decreased expression of RAB38 mRNA CTD PMID:16330353 Rab38 Rat ozone multiple interactions ISO Rab38 (Mus musculus) 6480464 [Air Pollutants results in increased abundance of Ozone] which results in increased expression of RAB38 mRNA CTD PMID:34911549 Rab38 Rat paracetamol affects expression ISO Rab38 (Mus musculus) 6480464 Acetaminophen affects the expression of RAB38 mRNA CTD PMID:17562736 Rab38 Rat paracetamol decreases expression ISO RAB38 (Homo sapiens) 6480464 Acetaminophen results in decreased expression of RAB38 mRNA CTD PMID:22230336 Rab38 Rat perfluorooctanoic acid decreases expression EXP 6480464 perfluorooctanoic acid results in decreased expression of RAB38 mRNA CTD PMID:19162173 Rab38 Rat pirinixic acid decreases expression EXP 6480464 pirinixic acid results in decreased expression of RAB38 mRNA CTD PMID:19162173 Rab38 Rat potassium chromate increases expression ISO RAB38 (Homo sapiens) 6480464 potassium chromate(VI) results in increased expression of RAB38 mRNA CTD PMID:22714537 Rab38 Rat rotenone increases expression ISO Rab38 (Mus musculus) 6480464 Rotenone results in increased expression of RAB38 mRNA CTD PMID:32937126 Rab38 Rat SB 431542 multiple interactions ISO RAB38 (Homo sapiens) 6480464 [NOG protein co-treated with Valproic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of RAB38 mRNA CTD PMID:27188386 Rab38 Rat silicon dioxide decreases expression ISO RAB38 (Homo sapiens) 6480464 Silicon Dioxide analog results in decreased expression of RAB38 mRNA and Silicon Dioxide results in decreased expression of RAB38 mRNA CTD PMID:25351596 and PMID:25895662 Rab38 Rat sodium arsenite decreases expression ISO RAB38 (Homo sapiens) 6480464 sodium arsenite results in decreased expression of RAB38 mRNA CTD PMID:28595984 and PMID:38568856 Rab38 Rat sodium arsenite affects expression ISO RAB38 (Homo sapiens) 6480464 sodium arsenite affects the expression of RAB38 mRNA CTD PMID:34032870 Rab38 Rat sotorasib multiple interactions ISO RAB38 (Homo sapiens) 6480464 [sotorasib co-treated with trametinib co-treated with NVP-BKM120] results in decreased expression of RAB38 mRNA CTD PMID:36139627 Rab38 Rat tetrachloromethane decreases expression EXP 6480464 Carbon Tetrachloride results in decreased expression of RAB38 mRNA CTD PMID:31150632 Rab38 Rat thapsigargin decreases expression ISO Rab38 (Mus musculus) 6480464 Thapsigargin results in decreased expression of RAB38 protein CTD PMID:24648495 Rab38 Rat thapsigargin decreases expression ISO RAB38 (Homo sapiens) 6480464 Thapsigargin results in decreased expression of RAB38 mRNA CTD PMID:29453283 Rab38 Rat tipifarnib increases expression EXP 6480464 tipifarnib results in increased expression of RAB38 mRNA CTD PMID:16403772 Rab38 Rat trametinib multiple interactions ISO RAB38 (Homo sapiens) 6480464 [sotorasib co-treated with trametinib co-treated with NVP-BKM120] results in decreased expression of RAB38 mRNA CTD PMID:36139627 Rab38 Rat triclosan increases expression ISO RAB38 (Homo sapiens) 6480464 Triclosan results in increased expression of RAB38 mRNA CTD PMID:30510588 Rab38 Rat trimellitic anhydride increases expression ISO Rab38 (Mus musculus) 6480464 trimellitic anhydride results in increased expression of RAB38 mRNA CTD PMID:19042947 Rab38 Rat valproic acid affects expression ISO Rab38 (Mus musculus) 6480464 Valproic Acid affects the expression of RAB38 mRNA CTD PMID:17292431 Rab38 Rat valproic acid increases expression ISO RAB38 (Homo sapiens) 6480464 Valproic Acid results in increased expression of RAB38 mRNA CTD PMID:23179753 more ... Rab38 Rat valproic acid multiple interactions ISO RAB38 (Homo sapiens) 6480464 [NOG protein co-treated with Valproic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of RAB38 mRNA CTD PMID:27188386 Rab38 Rat valproic acid affects expression ISO RAB38 (Homo sapiens) 6480464 Valproic Acid affects the expression of RAB38 mRNA CTD PMID:25979313 Rab38 Rat vorinostat increases expression ISO RAB38 (Homo sapiens) 6480464 vorinostat results in increased expression of RAB38 mRNA CTD PMID:27188386
1,2-dimethylhydrazine (ISO) 1-[(4-chlorophenyl)-phenylmethyl]-4-methylpiperazine (EXP) 17beta-estradiol (ISO) 2,3,7,8-tetrachlorodibenzodioxine (EXP,ISO) 2,4-dinitrotoluene (EXP) 3-chloropropane-1,2-diol (EXP) 4,4'-sulfonyldiphenol (ISO) 4-hydroxyphenyl retinamide (ISO) 6-propyl-2-thiouracil (EXP) acrylamide (EXP) actinomycin D (ISO) aflatoxin B1 (ISO) all-trans-retinoic acid (EXP,ISO) ammonium chloride (EXP) amphetamine (EXP) benzo[a]pyrene (ISO) bisphenol A (EXP,ISO) bisphenol F (ISO) buspirone (EXP) butan-1-ol (ISO) cadmium dichloride (ISO) CGP 52608 (ISO) chloropicrin (ISO) dehydroepiandrosterone (EXP) dexamethasone (ISO) dibenz[a,h]anthracene (ISO) Dibutyl phosphate (ISO) dichloroacetic acid (ISO) diethylstilbestrol (EXP) dioxygen (ISO) dorsomorphin (ISO) endosulfan (EXP) flutamide (EXP) FR900359 (ISO) genistein (EXP) glafenine (EXP) glycidol (EXP) GW 4064 (ISO) isobutanol (ISO) isotretinoin (ISO) leflunomide (EXP) methoxychlor (EXP) methylmercury chloride (ISO) methylphenidate (ISO) nefazodone (EXP) nimesulide (EXP) Nutlin-3 (ISO) oxycodone (EXP) ozone (EXP,ISO) paracetamol (ISO) perfluorooctanoic acid (EXP) pirinixic acid (EXP) potassium chromate (ISO) rotenone (ISO) SB 431542 (ISO) silicon dioxide (ISO) sodium arsenite (ISO) sotorasib (ISO) tetrachloromethane (EXP) thapsigargin (ISO) tipifarnib (EXP) trametinib (ISO) triclosan (ISO) trimellitic anhydride (ISO) valproic acid (ISO) vorinostat (ISO)
Cellular Component
cell body (IDA) cytoplasm (IEA) early endosome (IEA,ISO) early endosome lumen (ISO) endomembrane system (IBA,IEA) Golgi apparatus (IEA) intracellular membrane-bounded organelle (IEA) lysosome (IEA,ISO) melanosome (IBA,IDA,IEA,ISO) melanosome membrane (IEA,ISO) membrane (IEA,ISO) mitochondria-associated endoplasmic reticulum membrane contact site (IEA,ISO) mitochondrion (IBA,IEA,ISO) perinuclear region of cytoplasm (IDA) phagocytic vesicle (IEA,ISO) trans-Golgi network (IBA,IEA) vesicle (IDA,IEA)
1.
Phylogenetic-based propagation of functional annotations within the Gene Ontology consortium.
Gaudet P, etal., Brief Bioinform. 2011 Sep;12(5):449-62. doi: 10.1093/bib/bbr042. Epub 2011 Aug 27.
2.
Rat ISS GO annotations from GOA human gene data--August 2006
GOA data from the GO Consortium
3.
TM rats: a model for platelet storage pool deficiency.
Hamada S, etal., Exp Anim 1997 Jul;46(3):235-9.
4.
Rat ISS GO annotations from MGI mouse gene data--August 2006
MGD data from the GO Consortium
5.
The role of Rab38 in platelet dense granule defects.
Ninkovic I, etal., J Thromb Haemost. 2008 Dec;6(12):2143-51. Epub 2008 Oct 1.
6.
The rat Ruby ( R) locus is Rab38: identical mutations in Fawn-hooded and Tester-Moriyama rats derived from an ancestral Long Evans rat sub-strain.
Oiso N, etal., Mamm Genome 2004 Apr;15(4):307-14.
7.
Expression and localization of a novel Rab small G protein (Rab38) in the rat lung.
Osanai K, etal., Am J Pathol 2001 May;158(5):1665-75.
8.
Altered lung surfactant system in a Rab38-deficient rat model of Hermansky-Pudlak syndrome.
Osanai K, etal., Am J Physiol Lung Cell Mol Physiol. 2010 Feb;298(2):L243-51. Epub 2009 Nov 6.
9.
Expression and characterization of Rab38, a new member of the Rab small G protein family.
Osanai K, etal., Biol Chem. 2005 Feb;386(2):143-53.
10.
Exogenous gene transfer of Rab38 small GTPase ameliorates aberrant lung surfactant homeostasis in Ruby rats.
Osanai K, etal., Respir Res. 2017 Apr 24;18(1):70. doi: 10.1186/s12931-017-0549-2.
11.
RF-2 gene modulates proteinuria and albuminuria independently of changes in glomerular permeability in the fawn-hooded hypertensive rat.
Rangel-Filho A, etal., J Am Soc Nephrol 2005 Apr;16(4):852-6. Epub 2005 Mar 9.
12.
Rab38 modulates proteinuria in model of hypertension-associated renal disease.
Rangel-Filho A, etal., J Am Soc Nephrol. 2013 Feb;24(2):283-92. doi: 10.1681/ASN.2012090927. Epub 2013 Jan 4.
13.
GOA pipeline
RGD automated data pipeline
14.
ClinVar Automated Import and Annotation Pipeline
RGD automated import pipeline for ClinVar variants, variant-to-disease annotations and gene-to-disease annotations
15.
Data Import for Chemical-Gene Interactions
RGD automated import pipeline for gene-chemical interactions
16.
Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences.
Strausberg RL, etal., Proc Natl Acad Sci U S A. 2002 Dec 24;99(26):16899-903. Epub 2002 Dec 11.
17.
Rab38 and Rab32 control post-Golgi trafficking of melanogenic enzymes.
Wasmeier C, etal., J Cell Biol. 2006 Oct 23;175(2):271-81. doi: 10.1083/jcb.200606050. Epub 2006 Oct 16.
Rab38 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 1 151,595,153 - 151,675,492 (+) NCBI GRCr8 mRatBN7.2 1 142,182,566 - 142,262,923 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 1 142,182,556 - 142,262,924 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 1 150,149,817 - 150,230,171 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 1 157,326,253 - 157,406,599 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 1 150,200,179 - 150,280,523 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 1 152,072,716 - 152,153,449 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 1 152,072,665 - 152,153,449 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 1 158,385,888 - 158,466,621 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 1 144,783,919 - 144,864,573 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 1 144,862,324 - 144,942,979 (+) NCBI Celera 1 140,481,941 - 140,561,948 (+) NCBI Celera Cytogenetic Map 1 q32 NCBI
RAB38 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 11 87,803,715 - 88,175,443 (-) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 11 88,113,251 - 88,175,443 (-) Ensembl GRCh38 hg38 GRCh38 GRCh37 11 87,846,419 - 87,908,611 (-) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 11 87,486,079 - 87,548,247 (-) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 11 87,486,078 - 87,548,247 NCBI Celera 11 86,723,503 - 86,785,679 (+) NCBI Celera Cytogenetic Map 11 q14.2 NCBI HuRef 11 84,086,688 - 84,148,798 (-) NCBI HuRef CHM1_1 11 87,729,200 - 87,791,404 (-) NCBI CHM1_1 T2T-CHM13v2.0 11 87,746,041 - 88,094,423 (-) NCBI T2T-CHM13v2.0
Rab38 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 7 88,079,481 - 88,140,780 (+) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 7 88,079,481 - 88,140,780 (+) Ensembl GRCm39 Ensembl GRCm38 7 88,430,273 - 88,491,572 (+) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 7 88,430,273 - 88,491,572 (+) Ensembl GRCm38 mm10 GRCm38 MGSCv37 7 95,578,783 - 95,640,082 (+) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 7 88,305,465 - 88,366,764 (+) NCBI MGSCv36 mm8 Celera 7 85,784,928 - 85,846,216 (+) NCBI Celera Cytogenetic Map 7 D3 NCBI cM Map 7 49.19 NCBI
Rab38 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955414 5,158,261 - 5,215,698 (+) Ensembl ChiLan1.0 ChiLan1.0 NW_004955414 5,158,860 - 5,214,108 (+) NCBI ChiLan1.0 ChiLan1.0
RAB38 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 9 88,982,414 - 89,051,335 (-) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 11 90,026,601 - 90,092,945 (-) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 11 83,121,858 - 83,183,698 (-) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 11 86,710,358 - 86,772,796 (-) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 11 86,710,358 - 86,773,142 (-) Ensembl panpan1.1 panPan2
RAB38 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 21 11,769,924 - 11,823,546 (+) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 21 11,769,351 - 11,822,815 (+) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 21 11,629,645 - 11,685,137 (+) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 21 11,951,012 - 12,006,559 (+) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 21 11,950,427 - 12,014,114 (+) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 21 11,739,658 - 11,795,116 (+) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 21 11,810,618 - 11,866,135 (+) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 21 11,864,785 - 11,920,329 (+) NCBI UU_Cfam_GSD_1.0
Rab38 Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024404947 73,981,078 - 74,037,967 (-) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936736 1,304,185 - 1,361,221 (+) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936736 1,304,290 - 1,360,412 (+) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
RAB38 Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 9 21,577,033 - 21,640,115 (-) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 9 21,577,083 - 21,640,637 (-) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 9 23,798,471 - 23,863,103 (+) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
RAB38 Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 1 79,256,996 - 79,316,967 (-) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 1 79,256,835 - 79,316,789 (-) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666043 46,404,298 - 46,464,013 (+) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Rab38
.
Predicted Target Of
Count of predictions: 403 Count of miRNA genes: 240 Interacting mature miRNAs: 287 Transcripts: ENSRNOT00000022538 Prediction methods: Microtar, Miranda, Targetscan Result types: miRGate_prediction
61442 Strs1 Sensitivity to stroke QTL 1 7.4 cerebrum integrity trait (VT:0010549) post-insult time to onset of cerebrovascular lesion (CMO:0002343) 1 121767634 166767634 Rat 1578780 Cm52 Cardiac mass QTL 52 3.3 0.0001 heart mass (VT:0007028) heart wet weight (CMO:0000069) 1 81591954 219808434 Rat 1578654 Bss10 Bone structure and strength QTL 10 4 femur morphology trait (VT:0000559) femoral neck cortical cross-sectional area (CMO:0001702) 1 49393172 159356837 Rat 1598866 Bp287 Blood pressure QTL 287 5.1 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 121006655 166006655 Rat 1578770 Stresp23 Stress response QTL 23 kidney sympathetic nerve activity (VT:0004050) stimulated renal sympathetic nerve activity to basal renal sympathetic nerve activity ratio (CMO:0001786) 1 123350408 182418476 Rat 9590300 Scort16 Serum corticosterone level QTL 16 4.39 0.001 blood corticosterone amount (VT:0005345) plasma corticosterone level (CMO:0001173) 1 103111621 148111621 Rat 2298545 Neuinf8 Neuroinflammation QTL 8 4.6 nervous system integrity trait (VT:0010566) spinal cord beta-2 microglobulin mRNA level (CMO:0002125) 1 57336763 151090257 Rat 7794788 Mcs32 Mammary carcinoma susceptibility QTL 32 2.61 mammary gland integrity trait (VT:0010552) mammary tumor incidence/prevalence measurement (CMO:0000946) 1 115540693 238914717 Rat 631199 Cm23 Cardiac mass QTL 23 4.6 0.0004 heart left ventricle mass (VT:0007031) heart left ventricle wet weight (CMO:0000071) 1 115585465 172949803 Rat 2313402 Anxrr24 Anxiety related response QTL 24 aggression-related behavior trait (VT:0015014) tameness/aggressiveness composite score (CMO:0002136) 1 48963584 144267916 Rat 1598850 Bp297 Blood pressure QTL 297 2.1 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 121006655 166006655 Rat 631570 Bp94 Blood pressure QTL 94 0.0001 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 123479780 142990467 Rat 152025235 Bw194 Body weight QTL 194 4.86 body mass (VT:0001259) 1 123556856 242907031 Rat 152025232 Bw192 Body weight QTL 192 3.93 body mass (VT:0001259) 1 117917486 196963478 Rat 724521 Uae1 Urinary albumin excretion QTL 1 3.8 0.0001 urine albumin amount (VT:0002871) urine albumin excretion rate (CMO:0000757) 1 90508614 173018436 Rat 1358902 Bw47 Body weight QTL 47 1.67 body mass (VT:0001259) body weight (CMO:0000012) 1 90508614 180359386 Rat 61346 Rf2 Renal disease susceptibility QTL 2 3.7 urine protein amount (VT:0005160) urine protein level (CMO:0000591) 1 99267916 144267916 Rat 8655649 Arrd1 Age-related retinal degeneration QTL 1 4.89 retinal layer morphology trait (VT:0003727) percentage of study population developing retinopathy during a period of time (CMO:0002453) 1 100357752 183970443 Rat 1300153 Bp171 Blood pressure QTL 171 3.37 arterial blood pressure trait (VT:2000000) diastolic blood pressure (CMO:0000005) 1 90664883 143200202 Rat 2317833 Alcrsp19 Alcohol response QTL 19 12.4 0.001 response to alcohol trait (VT:0010489) duration of loss of righting reflex (CMO:0002289) 1 100979852 145979852 Rat 731168 Bp154 Blood pressure QTL 154 3.4 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 94642644 214537671 Rat 631202 Gluco13 Glucose level QTL 13 0.0001 blood glucose amount (VT:0000188) blood glucose level area under curve (AUC) (CMO:0000350) 1 131763437 159756369 Rat 631205 Bp196 Blood pressure QTL 196 4 0.0001 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 1 118944897 199050459 Rat 1300158 Bp173 Blood pressure QTL 173 3.48 arterial blood pressure trait (VT:2000000) blood pressure time series experimental set point of the baroreceptor response (CMO:0002593) 1 115540693 185145286 Rat 631206 Niddm40 Non-insulin dependent diabetes mellitus QTL 40 blood glucose amount (VT:0000188) plasma glucose level (CMO:0000042) 1 136745990 163747690 Rat 1641897 Alcrsp1 Alcohol response QTL 1 response to alcohol trait (VT:0010489) duration of loss of righting reflex (CMO:0002289) 1 100979852 145979852 Rat 1331749 Hrtrt11 Heart rate QTL 11 2.973 heart pumping trait (VT:2000009) heart rate (CMO:0000002) 1 94494440 198211706 Rat 1331751 Bp199 Blood pressure QTL 199 3.60022 arterial blood pressure trait (VT:2000000) diastolic blood pressure (CMO:0000005) 1 94494440 181830018 Rat 9685799 Bp375 Blood pressure QTL 375 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 125611501 170611501 Rat 2293140 Bp313 Blood pressure QTL 313 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 121833674 166833674 Rat 9685802 Bp376 Blood pressure QTL 376 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 126540680 171540680 Rat 724529 Cm16 Cardiac mass QTL 16 2.7 heart mass (VT:0007028) calculated heart weight (CMO:0000073) 1 87580395 150700247 Rat 61370 Mcs3 Mammary carcinoma susceptibility QTL 3 2.15 mammary gland integrity trait (VT:0010552) mammary tumor number (CMO:0000343) 1 102268556 147268556 Rat 1641895 Bp298 Blood pressure QTL 298 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 1 123350408 182418476 Rat 70209 Niddm23 Non-insulin dependent diabetes mellitus QTL 23 2.82 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 1 94494440 198324465 Rat 631496 Bp97 Blood pressure QTL 97 3.08 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 106047847 151047847 Rat 634314 Niddm44 Non-insulin dependent diabetes mellitus QTL 44 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 1 49393289 199050459 Rat 2303591 Gluco41 Glucose level QTL 41 2 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 1 102168504 147168504 Rat 1331793 Bp200 Blood pressure QTL 200 3.71601 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 94494440 172949803 Rat 2313060 Bss71 Bone structure and strength QTL 71 2.6 0.0001 long bone metaphysis morphology trait (VT:0000133) tibia midshaft total cross-sectional area (CMO:0001715) 1 118944747 163944747 Rat 6893347 Bw98 Body weight QTL 98 0.2 0.53 body mass (VT:0001259) body weight (CMO:0000012) 1 133680936 178680936 Rat 1354591 Cm36 Cardiac mass QTL 36 4.1 heart left ventricle mass (VT:0007031) calculated heart weight (CMO:0000073) 1 102813953 201278233 Rat 724550 Thym3 Thymus enlargement QTL 3 7.82 0.001 thymus mass (VT:0004954) thymus weight to body weight ratio (CMO:0000612) 1 136829932 181829932 Rat 7421630 Bp362 Blood pressure QTL 362 0.001 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 1 118608292 241799120 Rat 71118 Thym1 Thymus enlargement QTL 1 10.17 0.001 thymus mass (VT:0004954) thymus weight to body weight ratio (CMO:0000612) 1 136829932 181829932 Rat 70225 Bp58 Blood pressure QTL 58 3.3 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 32356093 162846471 Rat 10059597 Bp377 Blood pressure QTL 377 3.42 0.025 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 32737458 199368955 Rat 631519 Pia11 Pristane induced arthritis QTL 11 5.3 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 1 136830018 181830018 Rat 61399 Tcat1 Tongue tumor resistance QTL 1 3.3 tongue integrity trait (VT:0010553) number of squamous cell tumors of the tongue with diameter greater than 5 mm (CMO:0001879) 1 99267916 144267916 Rat 6893361 Bw104 Body weight QTL 104 0.59 0.27 body mass (VT:0001259) body weight (CMO:0000012) 1 133680936 178680936 Rat 724567 Tcas6 Tongue tumor susceptibility QTL 6 6.85 tongue integrity trait (VT:0010553) number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950) 1 92948896 144267916 Rat 738006 Anxrr14 Anxiety related response QTL 14 4 0.00035 locomotor behavior trait (VT:0001392) amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958) 1 130636910 175636910 Rat 1558645 Bw55 Body weight QTL 55 3.2 0.004 body mass (VT:0001259) body weight (CMO:0000012) 1 133680936 178680936 Rat 1354615 Cm32 Cardiac mass QTL 32 5.2 heart left ventricle mass (VT:0007031) heart left ventricle wet weight (CMO:0000071) 1 102813953 201278233 Rat 634348 Bp138 Blood pressure QTL 138 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 125611501 168883176 Rat 8694370 Bw154 Body weight QTL 154 8.91 0.001 body lean mass (VT:0010483) lean tissue morphological measurement (CMO:0002184) 1 103111621 148111621 Rat 738028 Anxrr12 Anxiety related response QTL 12 4.9 0.00001 locomotor behavior trait (VT:0001392) amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958) 1 130636910 175636910 Rat 1354623 Rf46 Renal function QTL 46 3.8 blood creatinine amount (VT:0005328) plasma creatinine level (CMO:0000537) 1 102813953 151162766 Rat 631654 Bp107 Blood pressure QTL 107 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 125611501 170611501 Rat 631544 Bp84 Blood pressure QTL 84 5.6 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 123350408 181759564 Rat 152025212 Bw190 Body weight QTL 190 5.7 body mass (VT:0001259) 1 123556856 196963478 Rat 631549 Bp89 Blood pressure QTL 89 5.7 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 123350581 201284552 Rat 1358189 Cstrr1 Cold stress response QTL 1 0.0001 catecholamine amount (VT:0010543) urine norepinephrine level (CMO:0001629) 1 123350408 182418476 Rat 1354606 Bp246 Blood pressure QTL 246 3.6 arterial blood pressure trait (VT:2000000) pulse pressure (CMO:0000292) 1 102813953 218753816 Rat
AU043391
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 1 142,262,559 - 142,262,829 (+) MAPPER mRatBN7.2 Rnor_6.0 1 152,153,086 - 152,153,355 NCBI Rnor6.0 Rnor_5.0 1 158,466,258 - 158,466,527 UniSTS Rnor5.0 RGSC_v3.4 1 144,864,210 - 144,864,479 UniSTS RGSC3.4 Celera 1 140,561,585 - 140,561,854 UniSTS Cytogenetic Map 1 q32 UniSTS
RH143545
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 1 142,262,293 - 142,262,398 (+) MAPPER mRatBN7.2 Rnor_6.0 1 152,152,820 - 152,152,924 NCBI Rnor6.0 Rnor_5.0 1 158,465,992 - 158,466,096 UniSTS Rnor5.0 RGSC_v3.4 1 144,863,944 - 144,864,048 UniSTS RGSC3.4 Celera 1 140,561,319 - 140,561,423 UniSTS RH 3.4 Map 1 1115.4 UniSTS Cytogenetic Map 1 q32 UniSTS
RH135407
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 1 142,262,616 - 142,262,820 (+) MAPPER mRatBN7.2 Rnor_6.0 1 152,153,143 - 152,153,346 NCBI Rnor6.0 Rnor_5.0 1 158,466,315 - 158,466,518 UniSTS Rnor5.0 RGSC_v3.4 1 144,864,267 - 144,864,470 UniSTS RGSC3.4 Celera 1 140,561,642 - 140,561,845 UniSTS RH 3.4 Map 1 1115.8 UniSTS Cytogenetic Map 1 q32 UniSTS
This gene Rab38 is modified in the following models/strains:
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
11
49
113
91
90
59
25
59
6
218
97
93
45
60
31
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000022538 ⟹ ENSRNOP00000022538
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 1 142,182,556 - 142,262,924 (+) Ensembl Rnor_6.0 Ensembl 1 152,072,665 - 152,153,449 (+) Ensembl
RefSeq Acc Id:
NM_145774 ⟹ NP_665717
RefSeq Status:
PROVISIONAL
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 1 151,595,153 - 151,675,492 (+) NCBI mRatBN7.2 1 142,182,566 - 142,262,923 (+) NCBI Rnor_6.0 1 152,072,716 - 152,153,449 (+) NCBI Rnor_5.0 1 158,385,888 - 158,466,621 (+) NCBI RGSC_v3.4 1 144,783,919 - 144,864,573 (+) RGD Celera 1 140,481,941 - 140,561,948 (+) RGD
Sequence:
TTCCCAGGGCAAGCTCCAGGCTCCGCAAGACCCGCGGGCCTCCAGGATGCAGACACCGCACAAGGAGCACCTGTATAAGCTGCTGGTAATCGGCGACCTAGGTGTAGGCAAGACCAGCATCATCAAGC
hide sequence
RefSeq Acc Id:
NP_665717 ⟸ NM_145774
- UniProtKB:
Q63483 (UniProtKB/TrEMBL), A6I5Z5 (UniProtKB/TrEMBL), F7F483 (UniProtKB/TrEMBL)
- Sequence:
MQTPHKEHLYKLLVIGDLGVGKTSIIKRYVHQNFSSHYRATIGVDFALKVLHWDPETVVRLQLWDIAGQERFGNMTRVYYREAMGAFIVFDVTRPATFEAVAKWKNDLDSKLTLPNGKPVSVVLLANK
hide sequence
Ensembl Acc Id:
ENSRNOP00000022538 ⟸ ENSRNOT00000022538
RGD ID: 13690179 Promoter ID: EPDNEW_R704 Type: multiple initiation site Name: Rab38_1 Description: RAB38, member RAS oncogene family SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Rat Assembly Chr Position (strand) Source Rnor_6.0 1 152,072,684 - 152,072,744 EPDNEW
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2007-02-12
Rab38
Rab38, member of RAS oncogene family
R_mapped
ruby or red eyed dilution (mapped)
Data merged from RGD:3462
737654 APPROVED
2005-11-17
R_mapped
ruby or red eyed dilution (mapped)
R
Ruby or red eyed dilution
Symbol and Name updated
1556543 APPROVED
2004-02-26
Rab38
Rab38, member of RAS oncogene family
Symbol and Name status set to approved
625702 APPROVED
2003-02-27
Rab38
Rab38, member of RAS oncogene family
Symbol and Name status set to provisional
70820 PROVISIONAL
2002-06-10
R
Ruby or red eyed dilution
Symbol and Name status set to approved
70586 APPROVED
Note Type
Note
Reference
gene_disease
Met1Ile mutation is responsible for the Ruby (red eyed dilution) phenotype in both the Fawn-hooded (FHH) and Tester Moriyama (TM) strains, two models for platelet storage pool deficiency
1300411
gene_expression
expressed in alveolar type II cells and in bronchial epithelial cells
633808
