Strain Report - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Strain: FHH.BN-(D1Hmgc14-D1Hmgc15)/Mcwi-Rab38em1Mcwi

Symbol: FHH.BN-(D1Hmgc14-D1Hmgc15)/Mcwi-Rab38em1Mcwi
Strain: FHH.BN-(D1Hmgc14-D1Hmgc15)/Mcwi-Rab38em1
Substrain: Mcwi
RGD ID: 4139877
RRID: RGD_4139877
Ontology ID: RS:0002431
Alleles: Rab38em1Mcwi
Also known as: FHH.BN-Rab38em1Mcwi; FHH.BN1-Rab38-Rab38em1Mcwi; FHH.BN-(Rab38)Mcwi-Rab38em1Mcwi; FHH.BN-(D1Hmgc14-D1Hmgc15)Mcwi-Rab38em1Mcwi; FHH.BN-(D1Hmgc14-D1Hmgc15)/Mcwi-Rab38em1Mcwi
Type: mutant
Source: PhysGen Knockouts
Origin: This strain was produced by injecting ZFNs targeting the sequence CACCAAAACTTCTCCTCCCACTACCGGGCCACCATTGGT into FHH.BN-(D1Hmgc14-D1Hmgc15)/Mcwi rat embryos. The resulting mutation is a 1-bp frameshift deletion in exon 1.
Last Known Status: Cryopreserved Sperm (as of 2017-01-26)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21142,182,566 - 142,262,923RGD_MAPPER_PIPELINE
Rnor_6.01152,072,716 - 152,153,449RGD_MAPPER_PIPELINERnor6.0
Rnor_5.01158,385,888 - 158,466,621RGD_MAPPER_PIPELINERnor5.0
RGSC_v3.41144,783,919 - 144,864,573RGD_MAPPER_PIPELINERGSC3.4






References

References - curated
1. Geurts AM, etal., Science. 2009 Jul 24;325(5939):433.
2. PhysGen Knockout strains
3. RGD Automated Pipelines

Region


Additional Information


Nomenclature History
Date Current Symbol Current Name Previous Symbol Previous Name Description Reference Status
2014-03-25 FHH.BN-(D1Hmgc14-D1Hmgc15)/Mcwi-Rab38em1Mcwi    FHH.BN-(D1Hmgc14-D1Hmgc15)/Mcwi-Rab38em1Mcwi    Name updated 68913 APPROVED
2014-03-25 FHH.BN-(D1Hmgc14-D1Hmgc15)/Mcwi-Rab38em1Mcwi    FHH.BN-(D1Hmgc14-D1Hmgc15)/Mcwi-Rab38em1Mcwi    Name updated 68913 APPROVED
2014-03-25 FHH.BN-(D1Hmgc14-D1Hmgc15)/Mcwi-Rab38em1Mcwi    FHH.BN-(D1Hmgc14-D1Hmgc15)/Mcwi-Rab38em1Mcwi    Symbol updated 68687 APPROVED
2014-03-25 FHH.BN-(D1Hmgc14-D1Hmgc15)/Mcwi-Rab38em1Mcwi    FHH.BN-(D1Hmgc14-D1Hmgc15)/Mcwi-Rab38em1Mcwi    Symbol updated 68687 APPROVED
2013-08-13 FHH.BN-(D1Hmgc14-D1Hmgc15)/Mcwi-Rab38em1Mcwi    FHH.BN-(D1Hmgc14-D1Hmgc15)/Mcwi-Rab38em1Mcwi    Name updated 68913 APPROVED
2012-02-17 FHH.BN-(D1Hmgc14-D1Hmgc15)/Mcwi-Rab38em1Mcwi    FHH.BN-(Rab38)/Mcwi-Rab38em1Mcwi    Name updated 68913 APPROVED
2012-02-17 FHH.BN-(D1Hmgc14-D1Hmgc15)/Mcwi-Rab38em1Mcwi    FHH.BN-(Rab38)/Mcwi-Rab38em1Mcwi    Name updated 68913 APPROVED
2012-02-17 FHH.BN-(Rab38)/Mcwi-Rab38em1Mcwi    FHH.BN-Rab38em1Mcwi    Symbol updated 68687 APPROVED
2012-02-17 FHH.BN-(Rab38)/Mcwi-Rab38em1Mcwi    FHH.BN-Rab38em1Mcwi    Name updated 68913 APPROVED
2012-02-17 FHH.BN-(Rab38)/Mcwi-Rab38em1Mcwi    FHH.BN-Rab38em1Mcwi    Symbol updated 68687 APPROVED
2012-02-17 FHH.BN-(Rab38)/Mcwi-Rab38em1Mcwi    FHH.BN-Rab38em1Mcwi    Name updated 68913 APPROVED
2012-02-17 FHH.BN-(D1Hmgc14-D1Hmgc15)/Mcwi-Rab38em1Mcwi    FHH.BN-(Rab38)/Mcwi-Rab38em1Mcwi    Symbol updated 68687 APPROVED
2012-02-17 FHH.BN-(Rab38)/Mcwi-Rab38em1Mcwi    FHH.BN-Rab38em1Mcwi    Name updated 68913 APPROVED
2012-02-17 FHH.BN-(Rab38)/Mcwi-Rab38em1Mcwi    FHH.BN-Rab38em1Mcwi    Symbol updated 68687 APPROVED
2012-02-17 FHH.BN-(Rab38)/Mcwi-Rab38em1Mcwi    FHH.BN-Rab38em1Mcwi    Name updated 68913 APPROVED
2012-02-17 FHH.BN-(Rab38)/Mcwi-Rab38em1Mcwi    FHH.BN-Rab38em1Mcwi    Symbol updated 68687 APPROVED
2012-02-17 FHH.BN-(D1Hmgc14-D1Hmgc15)/Mcwi-Rab38em1Mcwi    FHH.BN-(Rab38)/Mcwi-Rab38em1Mcwi    Symbol updated 68687 APPROVED
2011-05-16 FHH.BN-Rab38em1Mcwi    FHH.BN-Rab38em2Mcwi    Symbol updated 68687 APPROVED
2011-05-16 FHH.BN-Rab38em1Mcwi    FHH.BN-Rab38em2Mcwi    Name updated 68913 APPROVED
2011-05-16 FHH.BN-Rab38em1Mcwi    FHH.BN-Rab38em2Mcwi    Symbol updated 68687 APPROVED
2011-05-16 FHH.BN-Rab38em1Mcwi    FHH.BN-Rab38em2Mcwi    Name updated 68913 APPROVED