Symbol:
Vamp8
Name:
vesicle-associated membrane protein 8
RGD ID:
620421
Description:
Enables SNAP receptor activity and syntaxin binding activity. Involved in protein-containing complex assembly and vesicle fusion. Located in endosome; lysosomal membrane; and midbody. Part of SNARE complex. Orthologous to human VAMP8 (vesicle associated membrane protein 8); INTERACTS WITH (+)-schisandrin B; 17beta-estradiol; 2,3,7,8-tetrachlorodibenzodioxine.
Type:
protein-coding
RefSeq Status:
VALIDATED
Previously known as:
EDB; endobrevin; VAMP-8; vesicle-associated membrane protein 8 (endobrevin)
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 4 106,000,570 - 106,011,081 (-) NCBI GRCr8 mRatBN7.2 4 104,442,383 - 104,452,884 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 4 104,442,393 - 104,452,897 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 4 109,822,062 - 109,827,133 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 4 105,597,175 - 105,602,246 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 4 104,210,202 - 104,215,278 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 4 100,250,301 - 100,252,756 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 4 100,250,301 - 100,252,755 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 4 165,020,594 - 165,023,049 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 4 105,692,451 - 105,694,908 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 4 105,936,931 - 105,939,387 (-) NCBI Celera 4 93,595,511 - 93,597,967 (-) NCBI Celera Cytogenetic Map 4 q32 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Vamp8 Rat (+)-schisandrin B multiple interactions EXP 6480464 schizandrin B inhibits the reaction [Carbon Tetrachloride results in decreased expression of VAMP8 mRNA] CTD PMID:31150632 Vamp8 Rat (-)-epigallocatechin 3-gallate multiple interactions ISO RGD:1347649 6480464 [potassium chromate(VI) co-treated with epigallocatechin gallate] results in decreased expression of VAMP8 mRNA CTD PMID:22079256 Vamp8 Rat 1,2-dimethylhydrazine multiple interactions ISO RGD:731713 6480464 Folic Acid inhibits the reaction [1,2-Dimethylhydrazine results in increased expression of VAMP8 mRNA] CTD PMID:22206623 Vamp8 Rat 1,2-dimethylhydrazine increases expression ISO RGD:731713 6480464 1,2-Dimethylhydrazine results in increased expression of VAMP8 mRNA CTD PMID:22206623 Vamp8 Rat 17alpha-ethynylestradiol increases expression ISO RGD:731713 6480464 Ethinyl Estradiol results in increased expression of VAMP8 mRNA CTD PMID:17942748 Vamp8 Rat 17alpha-ethynylestradiol multiple interactions ISO RGD:731713 6480464 [Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of VAMP8 mRNA CTD PMID:17942748 Vamp8 Rat 17beta-estradiol multiple interactions EXP 6480464 [bisphenol A co-treated with Estradiol] results in decreased expression of VAMP8 mRNA CTD PMID:26496021 Vamp8 Rat 2,3,7,8-tetrachlorodibenzodioxine decreases expression ISO RGD:1347649 6480464 Tetrachlorodibenzodioxin results in decreased expression of VAMP8 mRNA CTD PMID:11007951 Vamp8 Rat 2,3,7,8-tetrachlorodibenzodioxine decreases expression EXP 6480464 Tetrachlorodibenzodioxin results in decreased expression of VAMP8 mRNA CTD PMID:33387578 Vamp8 Rat 2,3,7,8-tetrachlorodibenzodioxine decreases expression ISO RGD:731713 6480464 Tetrachlorodibenzodioxin results in decreased expression of VAMP8 mRNA CTD PMID:33956508 Vamp8 Rat 2,3,7,8-tetrachlorodibenzodioxine affects expression ISO RGD:731713 6480464 Tetrachlorodibenzodioxin affects the expression of VAMP8 mRNA CTD PMID:21570461 Vamp8 Rat 2,3,7,8-tetrachlorodibenzodioxine increases expression ISO RGD:1347649 6480464 Tetrachlorodibenzodioxin results in increased expression of VAMP8 mRNA CTD PMID:20106945|PMID:21632981 Vamp8 Rat 2,3,7,8-tetrachlorodibenzodioxine multiple interactions ISO RGD:731713 6480464 [Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of VAMP8 mRNA CTD PMID:17942748 Vamp8 Rat 2,6-dimethoxyphenol multiple interactions ISO RGD:1347649 6480464 [Sodium Chloride co-treated with pyrogallol 1,3-dimethyl ether] results in increased expression of and affects the more ... CTD PMID:38598786 Vamp8 Rat 2-hydroxypropanoic acid decreases expression ISO RGD:1347649 6480464 Lactic Acid results in decreased expression of VAMP8 mRNA CTD PMID:30851411 Vamp8 Rat 2-methoxyethanol increases expression EXP 6480464 methyl cellosolve results in increased expression of VAMP8 mRNA CTD PMID:21061450 Vamp8 Rat 3-Nitrobenzanthrone decreases expression ISO RGD:1347649 6480464 3-nitrobenzanthrone results in decreased expression of VAMP8 mRNA CTD PMID:34036453 Vamp8 Rat 4,4'-sulfonyldiphenol increases expression ISO RGD:731713 6480464 bisphenol S results in increased expression of VAMP8 mRNA CTD PMID:30951980|PMID:39298647 Vamp8 Rat 5-aza-2'-deoxycytidine affects expression ISO RGD:1347649 6480464 Decitabine affects the expression of VAMP8 mRNA CTD PMID:17145863 Vamp8 Rat 6-propyl-2-thiouracil decreases expression EXP 6480464 Propylthiouracil results in decreased expression of VAMP8 mRNA CTD PMID:30047161 Vamp8 Rat aconitine increases expression EXP 6480464 Aconitine results in increased expression of VAMP8 protein CTD PMID:33236894 Vamp8 Rat acrylamide decreases expression EXP 6480464 Acrylamide results in decreased expression of VAMP8 mRNA CTD PMID:28959563 Vamp8 Rat acrylamide decreases expression ISO RGD:731713 6480464 Acrylamide results in decreased expression of VAMP8 mRNA CTD PMID:35032568 Vamp8 Rat actinomycin D multiple interactions ISO RGD:1347649 6480464 [Dactinomycin co-treated with nutlin 3] results in increased expression of VAMP8 mRNA CTD PMID:38460933 Vamp8 Rat aflatoxin B1 increases methylation ISO RGD:1347649 6480464 Aflatoxin B1 results in increased methylation of VAMP8 gene CTD PMID:27153756 Vamp8 Rat all-trans-retinoic acid increases expression ISO RGD:1347649 6480464 Tretinoin results in increased expression of VAMP8 mRNA CTD PMID:21934132|PMID:33167477 Vamp8 Rat all-trans-retinoic acid increases expression EXP 6480464 Tretinoin results in increased expression of VAMP8 mRNA CTD PMID:20488242 Vamp8 Rat amitrole decreases expression EXP 6480464 Amitrole results in decreased expression of VAMP8 mRNA CTD PMID:30047161 Vamp8 Rat ammonium chloride affects expression EXP 6480464 Ammonium Chloride affects the expression of VAMP8 mRNA CTD PMID:16483693 Vamp8 Rat amphetamine increases expression EXP 6480464 Amphetamine results in increased expression of VAMP8 mRNA CTD PMID:30779732 Vamp8 Rat antirheumatic drug decreases expression ISO RGD:1347649 6480464 Antirheumatic Agents results in decreased expression of VAMP8 mRNA CTD PMID:24449571 Vamp8 Rat aristolochic acid A increases expression ISO RGD:1347649 6480464 aristolochic acid I results in increased expression of VAMP8 mRNA CTD PMID:33212167 Vamp8 Rat benzene decreases expression ISO RGD:1347649 6480464 Benzene results in decreased expression of VAMP8 mRNA CTD PMID:20036648 Vamp8 Rat benzo[a]pyrene increases expression ISO RGD:731713 6480464 Benzo(a)pyrene results in increased expression of VAMP8 mRNA CTD PMID:22228805 Vamp8 Rat benzo[a]pyrene decreases methylation ISO RGD:1347649 6480464 Benzo(a)pyrene results in decreased methylation of VAMP8 5' UTR; Benzo(a)pyrene results in decreased methylation of more ... CTD PMID:27901495 Vamp8 Rat benzo[a]pyrene increases expression ISO RGD:1347649 6480464 Benzo(a)pyrene results in increased expression of VAMP8 mRNA CTD PMID:20106945|PMID:21632981 Vamp8 Rat bexarotene increases expression ISO RGD:1347649 6480464 bexarotene results in increased expression of VAMP8 mRNA CTD PMID:17178900 Vamp8 Rat bis(2-ethylhexyl) phthalate increases expression ISO RGD:1347649 6480464 Diethylhexyl Phthalate results in increased expression of VAMP8 mRNA CTD PMID:31163220 Vamp8 Rat bis(2-ethylhexyl) phthalate increases expression ISO RGD:731713 6480464 Diethylhexyl Phthalate results in increased expression of VAMP8 mRNA CTD PMID:33754040 Vamp8 Rat bis(2-ethylhexyl) phthalate decreases expression ISO RGD:731713 6480464 Diethylhexyl Phthalate results in decreased expression of VAMP8 mRNA CTD PMID:35550907 Vamp8 Rat bisphenol A multiple interactions EXP 6480464 [bisphenol A co-treated with Estradiol] results in decreased expression of VAMP8 mRNA CTD PMID:26496021 Vamp8 Rat bisphenol A increases expression ISO RGD:731713 6480464 bisphenol A results in increased expression of VAMP8 mRNA CTD PMID:30951980|PMID:34585602 Vamp8 Rat bisphenol A affects expression ISO RGD:1347649 6480464 bisphenol A affects the expression of VAMP8 mRNA CTD PMID:30903817 Vamp8 Rat bisphenol A decreases expression EXP 6480464 bisphenol A results in decreased expression of VAMP8 mRNA CTD PMID:30816183|PMID:32528016 Vamp8 Rat bisphenol A affects expression EXP 6480464 bisphenol A affects the expression of VAMP8 mRNA CTD PMID:25181051 Vamp8 Rat bisphenol F increases expression ISO RGD:731713 6480464 bisphenol F results in increased expression of VAMP8 mRNA CTD PMID:30951980 Vamp8 Rat cadmium dichloride increases expression EXP 6480464 Cadmium Chloride results in increased expression of VAMP8 mRNA CTD PMID:33453195 Vamp8 Rat caffeine increases phosphorylation ISO RGD:1347649 6480464 Caffeine results in increased phosphorylation of VAMP8 protein CTD PMID:35688186 Vamp8 Rat camptothecin increases expression ISO RGD:1347649 6480464 Camptothecin results in increased expression of VAMP8 mRNA CTD PMID:38460933 Vamp8 Rat chloropicrin increases expression ISO RGD:1347649 6480464 chloropicrin results in increased expression of VAMP8 mRNA CTD PMID:26352163 Vamp8 Rat cisplatin multiple interactions ISO RGD:1347649 6480464 [Cisplatin co-treated with jinfukang] results in increased expression of VAMP8 mRNA CTD PMID:27392435 Vamp8 Rat cisplatin increases expression ISO RGD:1347649 6480464 Cisplatin results in increased expression of VAMP8 mRNA CTD PMID:27392435 Vamp8 Rat clothianidin increases expression ISO RGD:1347649 6480464 clothianidin results in increased expression of VAMP8 mRNA CTD PMID:31626844 Vamp8 Rat cobalt dichloride decreases expression ISO RGD:1347649 6480464 cobaltous chloride results in decreased expression of VAMP8 mRNA CTD PMID:19376846 Vamp8 Rat copper atom decreases expression EXP 6480464 Copper results in decreased expression of VAMP8 mRNA CTD PMID:30556269 Vamp8 Rat copper(0) decreases expression EXP 6480464 Copper results in decreased expression of VAMP8 mRNA CTD PMID:30556269 Vamp8 Rat copper(II) sulfate decreases expression ISO RGD:1347649 6480464 Copper Sulfate results in decreased expression of VAMP8 mRNA CTD PMID:19549813 Vamp8 Rat cyclosporin A decreases expression ISO RGD:1347649 6480464 Cyclosporine results in decreased expression of VAMP8 mRNA CTD PMID:20106945 Vamp8 Rat Dibutyl phosphate affects expression ISO RGD:1347649 6480464 di-n-butylphosphoric acid affects the expression of VAMP8 mRNA CTD PMID:37042841 Vamp8 Rat dicrotophos decreases expression ISO RGD:1347649 6480464 dicrotophos results in decreased expression of VAMP8 mRNA CTD PMID:28302478 Vamp8 Rat diethylstilbestrol increases expression EXP 6480464 Diethylstilbestrol results in increased expression of VAMP8 mRNA CTD PMID:37077353 Vamp8 Rat dorsomorphin multiple interactions ISO RGD:1347649 6480464 [NOG protein co-treated with entinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression more ... CTD PMID:27188386 Vamp8 Rat elemental selenium increases expression ISO RGD:1347649 6480464 Selenium results in increased expression of VAMP8 mRNA CTD PMID:19244175 Vamp8 Rat entinostat increases expression ISO RGD:1347649 6480464 entinostat results in increased expression of VAMP8 mRNA CTD PMID:26272509 Vamp8 Rat entinostat multiple interactions ISO RGD:1347649 6480464 [NOG protein co-treated with entinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression more ... CTD PMID:27188386 Vamp8 Rat epoxiconazole increases expression ISO RGD:731713 6480464 epoxiconazole results in increased expression of VAMP8 mRNA CTD PMID:35436446 Vamp8 Rat ethyl methanesulfonate increases expression ISO RGD:1347649 6480464 Ethyl Methanesulfonate results in increased expression of VAMP8 mRNA CTD PMID:23649840 Vamp8 Rat folic acid decreases expression ISO RGD:731713 6480464 Folic Acid results in decreased expression of VAMP8 mRNA CTD PMID:25629700 Vamp8 Rat folic acid multiple interactions ISO RGD:731713 6480464 Folic Acid inhibits the reaction [1,2-Dimethylhydrazine results in increased expression of VAMP8 mRNA] CTD PMID:22206623 Vamp8 Rat formaldehyde increases expression ISO RGD:1347649 6480464 Formaldehyde results in increased expression of VAMP8 mRNA CTD PMID:23649840 Vamp8 Rat FR900359 increases phosphorylation ISO RGD:1347649 6480464 FR900359 results in increased phosphorylation of VAMP8 protein CTD PMID:37730182 Vamp8 Rat furfural multiple interactions ISO RGD:1347649 6480464 [Sodium Chloride co-treated with Furaldehyde] results in decreased expression of and affects the localization of more ... CTD PMID:38598786 Vamp8 Rat gentamycin increases expression EXP 6480464 Gentamicins results in increased expression of VAMP8 mRNA CTD PMID:22061828 Vamp8 Rat ivermectin decreases expression ISO RGD:1347649 6480464 Ivermectin results in decreased expression of VAMP8 protein CTD PMID:32959892 Vamp8 Rat ketoconazole increases expression EXP 6480464 Ketoconazole results in increased expression of VAMP8 mRNA CTD PMID:37077353 Vamp8 Rat mercury dibromide increases expression ISO RGD:1347649 6480464 mercuric bromide results in increased expression of VAMP8 mRNA CTD PMID:26272509 Vamp8 Rat mercury dibromide multiple interactions ISO RGD:1347649 6480464 [NOG protein co-treated with mercuric bromide co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased more ... CTD PMID:27188386 Vamp8 Rat methamphetamine increases expression EXP 6480464 Methamphetamine results in increased expression of VAMP8 mRNA CTD PMID:34374793 Vamp8 Rat methidathion decreases expression ISO RGD:731713 6480464 methidathion results in decreased expression of VAMP8 mRNA CTD PMID:34813904 Vamp8 Rat methimazole decreases expression EXP 6480464 Methimazole results in decreased expression of VAMP8 mRNA CTD PMID:30047161 Vamp8 Rat methyl methanesulfonate increases expression ISO RGD:1347649 6480464 Methyl Methanesulfonate results in increased expression of VAMP8 mRNA CTD PMID:23649840 Vamp8 Rat methylmercury chloride decreases expression ISO RGD:1347649 6480464 methylmercuric chloride results in decreased expression of VAMP8 mRNA CTD PMID:23179753 Vamp8 Rat N-nitrosodiethylamine multiple interactions EXP 6480464 [Diethylnitrosamine co-treated with caffeic acid phenethyl ester] results in decreased expression of VAMP8 mRNA; [Diethylnitrosamine more ... CTD PMID:20360939|PMID:25374375 Vamp8 Rat nitrates multiple interactions ISO RGD:731713 6480464 [Particulate Matter results in increased abundance of Nitrates] which results in increased expression of VAMP8 more ... CTD PMID:35964746 Vamp8 Rat Nutlin-3 multiple interactions ISO RGD:1347649 6480464 [Dactinomycin co-treated with nutlin 3] results in increased expression of VAMP8 mRNA CTD PMID:38460933 Vamp8 Rat paclitaxel affects response to substance ISO RGD:1347649 6480464 VAMP8 protein affects the susceptibility to Paclitaxel CTD PMID:16217747 Vamp8 Rat panobinostat increases expression ISO RGD:1347649 6480464 panobinostat results in increased expression of VAMP8 mRNA CTD PMID:26272509 Vamp8 Rat panobinostat multiple interactions ISO RGD:1347649 6480464 [NOG protein co-treated with Panobinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression more ... CTD PMID:27188386 Vamp8 Rat paracetamol decreases expression ISO RGD:1347649 6480464 Acetaminophen results in decreased expression of VAMP8 mRNA CTD PMID:21420995|PMID:29067470 Vamp8 Rat paracetamol decreases expression EXP 6480464 Acetaminophen results in decreased expression of VAMP8 mRNA CTD PMID:33387578 Vamp8 Rat phenethyl caffeate multiple interactions EXP 6480464 [Diethylnitrosamine co-treated with caffeic acid phenethyl ester] results in decreased expression of VAMP8 mRNA CTD PMID:20360939 Vamp8 Rat phenobarbital affects expression ISO RGD:1347649 6480464 Phenobarbital affects the expression of VAMP8 mRNA CTD PMID:19159669 Vamp8 Rat phenobarbital multiple interactions EXP 6480464 [Diethylnitrosamine co-treated with Phenobarbital] results in decreased expression of VAMP8 mRNA; [Diethylnitrosamine co-treated with Phenobarbital] more ... CTD PMID:25374375 Vamp8 Rat phenylmercury acetate increases expression ISO RGD:1347649 6480464 Phenylmercuric Acetate results in increased expression of VAMP8 mRNA CTD PMID:26272509 Vamp8 Rat phenylmercury acetate multiple interactions ISO RGD:1347649 6480464 [NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased more ... CTD PMID:27188386 Vamp8 Rat potassium chromate multiple interactions ISO RGD:1347649 6480464 [potassium chromate(VI) co-treated with epigallocatechin gallate] results in decreased expression of VAMP8 mRNA CTD PMID:22079256 Vamp8 Rat potassium chromate decreases expression ISO RGD:1347649 6480464 potassium chromate(VI) results in decreased expression of VAMP8 mRNA CTD PMID:22079256 Vamp8 Rat rac-lactic acid decreases expression ISO RGD:1347649 6480464 Lactic Acid results in decreased expression of VAMP8 mRNA CTD PMID:30851411 Vamp8 Rat SB 431542 multiple interactions ISO RGD:1347649 6480464 [NOG protein co-treated with entinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression more ... CTD PMID:27188386 Vamp8 Rat selenium atom increases expression ISO RGD:1347649 6480464 Selenium results in increased expression of VAMP8 mRNA CTD PMID:19244175 Vamp8 Rat silicon dioxide decreases expression ISO RGD:1347649 6480464 Silicon Dioxide analog results in decreased expression of VAMP8 mRNA CTD PMID:25895662 Vamp8 Rat sodium arsenite increases expression ISO RGD:1347649 6480464 sodium arsenite results in increased expression of VAMP8 mRNA CTD PMID:34032870 Vamp8 Rat sodium chloride multiple interactions ISO RGD:1347649 6480464 [Sodium Chloride co-treated with Furaldehyde] results in decreased expression of and affects the localization of more ... CTD PMID:38598786 Vamp8 Rat sulfadimethoxine decreases expression EXP 6480464 Sulfadimethoxine results in decreased expression of VAMP8 mRNA CTD PMID:30047161 Vamp8 Rat tetrachloromethane multiple interactions EXP 6480464 schizandrin B inhibits the reaction [Carbon Tetrachloride results in decreased expression of VAMP8 mRNA] CTD PMID:31150632 Vamp8 Rat tetrachloromethane decreases expression ISO RGD:731713 6480464 Carbon Tetrachloride results in decreased expression of VAMP8 mRNA CTD PMID:31919559 Vamp8 Rat tetrachloromethane decreases expression EXP 6480464 Carbon Tetrachloride results in decreased expression of VAMP8 mRNA CTD PMID:31150632|PMID:33387578 Vamp8 Rat thioacetamide decreases expression EXP 6480464 Thioacetamide results in decreased expression of VAMP8 mRNA CTD PMID:34492290 Vamp8 Rat thiram decreases expression ISO RGD:1347649 6480464 Thiram results in decreased expression of VAMP8 mRNA CTD PMID:38568856 Vamp8 Rat toluene decreases expression EXP 6480464 Toluene results in decreased expression of VAMP8 mRNA CTD PMID:22967744 Vamp8 Rat trichostatin A increases expression ISO RGD:1347649 6480464 trichostatin A results in increased expression of VAMP8 mRNA CTD PMID:24935251|PMID:26272509 Vamp8 Rat trichostatin A multiple interactions ISO RGD:1347649 6480464 [NOG protein co-treated with trichostatin A co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased more ... CTD PMID:27188386 Vamp8 Rat trimellitic anhydride increases expression ISO RGD:731713 6480464 trimellitic anhydride results in increased expression of VAMP8 mRNA CTD PMID:16141432 Vamp8 Rat valproic acid decreases expression ISO RGD:1347649 6480464 Valproic Acid results in decreased expression of VAMP8 mRNA CTD PMID:29154799 Vamp8 Rat valproic acid multiple interactions ISO RGD:1347649 6480464 [NOG protein co-treated with Valproic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased more ... CTD PMID:27188386 Vamp8 Rat valproic acid increases expression ISO RGD:1347649 6480464 Valproic Acid results in increased expression of VAMP8 mRNA CTD PMID:23179753|PMID:23527032|PMID:24383497|PMID:24935251|PMID:26272509 Vamp8 Rat vinclozolin affects expression EXP 6480464 vinclozolin affects the expression of VAMP8 mRNA CTD PMID:19015723 Vamp8 Rat vinclozolin decreases expression EXP 6480464 vinclozolin results in decreased expression of VAMP8 mRNA CTD PMID:23034163 Vamp8 Rat vorinostat increases expression ISO RGD:1347649 6480464 vorinostat results in increased expression of VAMP8 mRNA CTD PMID:26272509 Vamp8 Rat vorinostat multiple interactions ISO RGD:1347649 6480464 [NOG protein co-treated with Vorinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression more ... CTD PMID:27188386
Molecular Function
Only show annotations with direct experimental evidence (0 objects hidden)
Vamp8 Rat chloride channel inhibitor activity enables IEA UniProtKB:Q9BV40|ensembl:ENSP00000263864 1600115 GO_REF:0000107 Ensembl GO_REF:0000107 Vamp8 Rat chloride channel inhibitor activity enables ISO RGD:1347649 1624291 PMID:18570918 RGD PMID:18570918 Vamp8 Rat protein binding IPI RGD:1311556 1549677 RGD Vamp8 Rat protein binding enables ISO RGD:1347649 1624291 UniProtKB:O15400|UniProtKB:O95721|UniProtKB:P56962|UniProtKB:Q13492 PMID:19557002, PMID:22118466, PMID:23217709, PMID:25419848, PMID:31806350, PMID:33422265, PMID:33947832, PMID:33961781, PMID:35271311, PMID:37821429 RGD PMID:19557002|PMID:22118466|PMID:23217709|PMID:25419848|PMID:31806350|PMID:33422265|PMID:33947832|PMID:33961781|PMID:35271311|PMID:37821429 Vamp8 Rat protein binding enables ISO RGD:731713 1624291 PR:Q8R307|UniProtKB:O55012 PMID:14668490, PMID:22118466 RGD PMID:14668490|PMID:22118466 Vamp8 Rat SNAP receptor activity enables IDA 4892614 PMID:15133481 FlyBase Vamp8 Rat SNAP receptor activity enables IBA FB:FBgn0013342|PANTHER:PTN005236497|RGD:620421|SGD:S000000028|SGD:S000005854 1600115 GO_REF:0000033 GO_Central GO_REF:0000033 Vamp8 Rat SNAP receptor activity enables IDA 2306549 PMID:19109692 FlyBase Vamp8 Rat syntaxin binding IPI RGD:619747 4892614 RGD Vamp8 Rat syntaxin binding enables IBA MGI:1313277|PANTHER:PTN005236497|RGD:3949|RGD:61880|RGD:620421|UniProtKB:P63026|UniProtKB:P63027 1600115 GO_REF:0000033 GO_Central GO_REF:0000033
(+)-schisandrin B (EXP) (-)-epigallocatechin 3-gallate (ISO) 1,2-dimethylhydrazine (ISO) 17alpha-ethynylestradiol (ISO) 17beta-estradiol (EXP) 2,3,7,8-tetrachlorodibenzodioxine (EXP,ISO) 2,6-dimethoxyphenol (ISO) 2-hydroxypropanoic acid (ISO) 2-methoxyethanol (EXP) 3-Nitrobenzanthrone (ISO) 4,4'-sulfonyldiphenol (ISO) 5-aza-2'-deoxycytidine (ISO) 6-propyl-2-thiouracil (EXP) aconitine (EXP) acrylamide (EXP,ISO) actinomycin D (ISO) aflatoxin B1 (ISO) all-trans-retinoic acid (EXP,ISO) amitrole (EXP) ammonium chloride (EXP) amphetamine (EXP) antirheumatic drug (ISO) aristolochic acid A (ISO) benzene (ISO) benzo[a]pyrene (ISO) bexarotene (ISO) bis(2-ethylhexyl) phthalate (ISO) bisphenol A (EXP,ISO) bisphenol F (ISO) cadmium dichloride (EXP) caffeine (ISO) camptothecin (ISO) chloropicrin (ISO) cisplatin (ISO) clothianidin (ISO) cobalt dichloride (ISO) copper atom (EXP) copper(0) (EXP) copper(II) sulfate (ISO) cyclosporin A (ISO) Dibutyl phosphate (ISO) dicrotophos (ISO) diethylstilbestrol (EXP) dorsomorphin (ISO) elemental selenium (ISO) entinostat (ISO) epoxiconazole (ISO) ethyl methanesulfonate (ISO) folic acid (ISO) formaldehyde (ISO) FR900359 (ISO) furfural (ISO) gentamycin (EXP) ivermectin (ISO) ketoconazole (EXP) mercury dibromide (ISO) methamphetamine (EXP) methidathion (ISO) methimazole (EXP) methyl methanesulfonate (ISO) methylmercury chloride (ISO) N-nitrosodiethylamine (EXP) nitrates (ISO) Nutlin-3 (ISO) paclitaxel (ISO) panobinostat (ISO) paracetamol (EXP,ISO) phenethyl caffeate (EXP) phenobarbital (EXP,ISO) phenylmercury acetate (ISO) potassium chromate (ISO) rac-lactic acid (ISO) SB 431542 (ISO) selenium atom (ISO) silicon dioxide (ISO) sodium arsenite (ISO) sodium chloride (ISO) sulfadimethoxine (EXP) tetrachloromethane (EXP,ISO) thioacetamide (EXP) thiram (ISO) toluene (EXP) trichostatin A (ISO) trimellitic anhydride (ISO) valproic acid (ISO) vinclozolin (EXP) vorinostat (ISO)
Biological Process
autophagosome maturation (IEA,ISO,ISS) autophagosome membrane docking (IEA,ISO) autophagy (IEA) cellular response to type II interferon (ISO) defense response to virus (IEA) eosinophil degranulation (ISO) establishment of localization in cell (ISO) membrane fusion (IDA) mucus secretion (IBA,IEA,ISO) negative regulation of secretion by cell (IEA,ISO) neutrophil degranulation (ISO) positive regulation of histamine secretion by mast cell (IEA,ISO) positive regulation of pancreatic amylase secretion (ISO) protein transport (IEA) protein-containing complex assembly (IDA) regulation of endocytosis (ISO) regulation of protein localization to plasma membrane (IEA,ISO) SNARE complex assembly (IBA,ISO) symbiont entry into host cell (IEA,ISO) vesicle fusion (IBA,IDA,ISO) vesicle-mediated transport (IDA,IEA) zymogen granule exocytosis (ISO)
Cellular Component
azurophil granule membrane (IEA,ISO) basal part of cell (ISO) basolateral part of cell (ISO) basolateral plasma membrane (ISO) cell surface (ISO) cytoplasm (IEA,ISO) cytoplasmic vesicle (IEA) cytosol (IEA,ISO) early endosome membrane (IEA) endomembrane system (IEA) endosome (IEA) late endosome membrane (IDA,IEA,ISO) lysosomal membrane (IDA,IEA,ISO) lysosome (IEA,ISO) membrane (IEA,ISO) midbody (IDA,IEA) mucin granule (IBA,IEA,ISO) perinuclear region of cytoplasm (IEA,ISO) phagocytic vesicle (ISO) plasma membrane (IBA,IEA,ISO) recycling endosome (IDA,IEA,ISO) secretory granule (ISO) secretory granule membrane (IEA,ISO) SNARE complex (IBA,IDA,IEA,ISO) vesicle (IEA,ISO) zymogen granule (ISO) zymogen granule membrane (IEA)
1.
Crystal structure of the endosomal SNARE complex reveals common structural principles of all SNAREs.
Antonin W, etal., Nat Struct Biol 2002 Feb;9(2):107-11.
2.
Mixed and non-cognate SNARE complexes. Characterization of assembly and biophysical properties.
Fasshauer D, etal., J Biol Chem 1999 May 28;274(22):15440-6.
3.
Phylogenetic-based propagation of functional annotations within the Gene Ontology consortium.
Gaudet P, etal., Brief Bioinform. 2011 Sep;12(5):449-62. doi: 10.1093/bib/bbr042. Epub 2011 Aug 27.
4.
Syntaxin 2 and endobrevin are required for the terminal step of cytokinesis in mammalian cells.
Low SH, etal., Dev Cell 2003 May;4(5):753-9.
5.
Rat ISS GO annotations from MGI mouse gene data--August 2006
MGD data from the GO Consortium
6.
Electronic Transfer of LocusLink and RefSeq Data
NCBI rat LocusLink and RefSeq merged data July 26, 2002
7.
Combinatorial SNARE complexes with VAMP7 or VAMP8 define different late endocytic fusion events.
Pryor PR, etal., EMBO Rep. 2004 Jun;5(6):590-5. Epub 2004 May 7.
8.
GOA pipeline
RGD automated data pipeline
9.
Data Import for Chemical-Gene Interactions
RGD automated import pipeline for gene-chemical interactions
10.
Mammalian late vacuole protein sorting orthologues participate in early endosomal fusion and interact with the cytoskeleton.
Richardson SC, etal., Mol Biol Cell 2004 Mar;15(3):1197-210. Epub 2003 Dec 10.
11.
Membrane fusion between liposomes containing SNARE proteins involved in mast cell exocytosis.
Sakiyama H, etal., Inflamm Res. 2009 Mar;58(3):139-42.
12.
A tubular endosomal fraction from rat liver: biochemical evidence of receptor sorting by default.
Verges M, etal., Proc Natl Acad Sci U S A. 1999 Aug 31;96(18):10146-51.
Vamp8 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 4 106,000,570 - 106,011,081 (-) NCBI GRCr8 mRatBN7.2 4 104,442,383 - 104,452,884 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 4 104,442,393 - 104,452,897 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 4 109,822,062 - 109,827,133 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 4 105,597,175 - 105,602,246 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 4 104,210,202 - 104,215,278 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 4 100,250,301 - 100,252,756 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 4 100,250,301 - 100,252,755 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 4 165,020,594 - 165,023,049 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 4 105,692,451 - 105,694,908 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 4 105,936,931 - 105,939,387 (-) NCBI Celera 4 93,595,511 - 93,597,967 (-) NCBI Celera Cytogenetic Map 4 q32 NCBI
VAMP8 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 2 85,577,586 - 85,582,031 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 2 85,561,562 - 85,582,031 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 2 85,804,709 - 85,809,154 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 2 85,658,228 - 85,662,665 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 2 85,716,374 - 85,720,811 NCBI Celera 2 85,632,880 - 85,637,440 (+) NCBI Celera Cytogenetic Map 2 p11.2 NCBI HuRef 2 85,701,916 - 85,706,329 (+) NCBI HuRef CHM1_1 2 85,734,420 - 85,738,962 (+) NCBI CHM1_1 T2T-CHM13v2.0 2 85,579,646 - 85,584,091 (+) NCBI T2T-CHM13v2.0
Vamp8 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 6 72,362,204 - 72,367,650 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 6 72,362,206 - 72,367,686 (-) Ensembl GRCm39 Ensembl GRCm38 6 72,385,221 - 72,390,667 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 6 72,385,223 - 72,390,703 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 6 72,335,215 - 72,340,661 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 6 72,314,732 - 72,320,090 (-) NCBI MGSCv36 mm8 Celera 6 74,475,546 - 74,480,987 (-) NCBI Celera Cytogenetic Map 6 C1 NCBI cM Map 6 32.27 NCBI
Vamp8 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955424 1,923,092 - 1,926,728 (-) Ensembl ChiLan1.0 ChiLan1.0 NW_004955424 1,922,830 - 1,926,844 (-) NCBI ChiLan1.0 ChiLan1.0
VAMP8 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 12 40,800,606 - 40,805,134 (-) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 2A 40,803,367 - 40,807,896 (-) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 2A 85,627,678 - 85,632,205 (+) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 2A 87,180,681 - 87,185,195 (+) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 2A 87,180,681 - 87,185,195 (+) Ensembl panpan1.1 panPan2
VAMP8 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 17 39,497,628 - 39,501,734 (-) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 17 39,497,785 - 39,501,739 (-) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 17 39,169,004 - 39,173,102 (-) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 17 40,244,282 - 40,248,381 (-) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 17 40,244,432 - 40,248,386 (-) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 17 39,373,788 - 39,377,885 (-) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 17 39,445,831 - 39,449,930 (-) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 17 39,845,443 - 39,849,546 (-) NCBI UU_Cfam_GSD_1.0
Vamp8 Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024406292 79,167,736 - 79,170,322 (+) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936712 1,688,093 - 1,689,816 (-) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936712 1,688,126 - 1,689,742 (-) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
VAMP8 Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 3 59,185,735 - 59,193,128 (-) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 3 59,187,900 - 59,193,165 (-) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 3 62,249,017 - 62,254,147 (-) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
VAMP8 Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 14 21,575,057 - 21,580,054 (-) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 14 21,575,161 - 21,579,820 (-) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666045 90,888,891 - 90,893,763 (+) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Vamp8
.
Predicted Target Of
Count of predictions: 64 Count of miRNA genes: 61 Interacting mature miRNAs: 63 Transcripts: ENSRNOT00000017301 Prediction methods: Miranda, Rnahybrid, Targetscan Result types: miRGate_prediction
1582232 Gluco25 Glucose level QTL 25 3.6 0.0023 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 4 85253748 148090731 Rat 631689 Scl4 Serum cholesterol level QTL 4 1.9 0.008 blood cholesterol amount (VT:0000180) serum total cholesterol level (CMO:0000363) 4 95174120 140174120 Rat 1358352 Srcrt3 Stress Responsive Cort QTL 3 2.29 blood corticosterone amount (VT:0005345) plasma corticosterone level (CMO:0001173) 4 38465774 146803430 Rat 1578655 Bmd11 Bone mineral density QTL 11 11 femur mineral mass (VT:0010011) total volumetric bone mineral density (CMO:0001728) 4 90850165 135850165 Rat 10755501 Bp390 Blood pressure QTL 390 2.5 arterial blood pressure trait (VT:2000000) diastolic blood pressure (CMO:0000005) 4 26775591 168368347 Rat 1357342 Bw40 Body weight QTL 40 0.001 body mass (VT:0001259) body weight (CMO:0000012) 4 76647384 117676292 Rat 631556 Bp135 Blood pressure QTL 135 0.017 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 4 78881294 117676292 Rat 61330 Eau1 Experimental allergic uveoretinitis QTL 1 0.0003 uvea integrity trait (VT:0010551) experimental autoimmune uveitis score (CMO:0001504) 4 70362013 132642728 Rat 70167 Bw22 Body weight QTL 22 3.1 body mass (VT:0001259) body weight (CMO:0000012) 4 76647384 117676292 Rat 1549839 Bw52 Body weight QTL 52 0.0001 body mass (VT:0001259) body weight gain (CMO:0000420) 4 61697658 115089733 Rat 70177 Xhs1 X-ray hypersensitivity QTL 1 25.1 intestine integrity trait (VT:0010554) post-insult time to onset of moribundity (CMO:0001896) 4 82798864 152731274 Rat 724522 Bp146 Blood pressure QTL 146 2.2 0.0021 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 4 73630210 118630210 Rat 61476 Aia3 Adjuvant induced arthritis QTL 3 3.9 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 4 86730991 131730991 Rat 1641919 Alc22 Alcohol consumption QTL 22 0.0005 drinking behavior trait (VT:0001422) ethanol drink intake rate (CMO:0001407) 4 81192555 126192555 Rat 1354660 Salc1 Saline consumption QTL 1 11.26 drinking behavior trait (VT:0001422) saline drink intake rate (CMO:0001627) 4 44463908 148090542 Rat 2300179 Bmd50 Bone mineral density QTL 50 5.9 0.0001 femur mineral mass (VT:0010011) volumetric bone mineral density (CMO:0001553) 4 60928534 105928534 Rat 1298082 Stresp4 Stress response QTL 4 blood corticosterone amount (VT:0005345) plasma corticosterone level (CMO:0001173) 4 50119848 146803430 Rat 70192 BpQTLcluster5 Blood pressure QTL cluster 5 4.183 arterial blood pressure trait (VT:2000000) absolute change in mean arterial blood pressure (CMO:0000533) 4 62933508 114921294 Rat 1578670 Bss14 Bone structure and strength QTL 14 16.4 femur morphology trait (VT:0000559) bone trabecular cross-sectional area (CMO:0002311) 4 87327165 132327165 Rat 2317588 Eae27 Experimental allergic encephalomyelitis QTL 27 nervous system integrity trait (VT:0010566) percentage of study population developing experimental autoimmune encephalomyelitis during a period of time (CMO:0001047) 4 103194805 112478794 Rat 1300139 Hrtrt6 Heart rate QTL 6 2.85 heart pumping trait (VT:2000009) heart rate (CMO:0000002) 4 39524264 116179656 Rat 70200 Alc18 Alcohol consumption QTL 18 9.2 drinking behavior trait (VT:0001422) ethanol intake volume to total fluid intake volume ratio (CMO:0001591) 4 56647873 149491524 Rat 1578657 Bss12 Bone structure and strength QTL 12 8.9 femur morphology trait (VT:0000559) femoral neck cross-sectional area (CMO:0001697) 4 60220938 105220938 Rat 1578658 Bss13 Bone structure and strength QTL 13 8 femur strength trait (VT:0010010) femoral neck polar moment of inertia (CMO:0001670) 4 60220938 105220938 Rat 2316958 Gluco58 Glucose level QTL 58 10 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 4 11320076 180699135 Rat 6478684 Anxrr30 Anxiety related response QTL 30 0.00087 defecation behavior trait (VT:0010462) defecation rate (CMO:0000998) 4 62753847 107753847 Rat 1578662 Bss15 Bone structure and strength QTL 15 19.6 femur width (VT:1000666) femoral neck width (CMO:0001695) 4 87327165 132327165 Rat 2302051 Pia28 Pristane induced arthritis QTL 28 5.3 0.001 blood autoantibody amount (VT:0003725) serum immunoglobulin G-type rheumatoid factor level relative to an arbitrary reference serum (CMO:0002112) 4 73630210 118630210 Rat 738009 Sach4 Saccharine consumption QTL 4 4.9 0.000016 consumption behavior trait (VT:0002069) saccharin intake volume to total fluid intake volume ratio (CMO:0001601) 4 59948935 154902892 Rat 2312567 Glom19 Glomerulus QTL 19 1.9 0.006 kidney glomerulus morphology trait (VT:0005325) index of glomerular damage (CMO:0001135) 4 45456990 146803430 Rat 738015 Pia9 Pristane induced arthritis QTL 9 4.5 0.048 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 4 80694870 125694870 Rat 6478772 Anxrr49 Anxiety related response QTL 49 0.15488 defecation behavior trait (VT:0010462) defecation rate (CMO:0000998) 4 62753847 107753847 Rat 634335 Anxrr16 Anxiety related response QTL 16 7.22 locomotor behavior trait (VT:0001392) number of entries into a discrete space in an experimental apparatus (CMO:0000960) 4 93308457 167139447 Rat 631646 Stl4 Serum triglyceride level QTL 4 6.5 0.0001 blood triglyceride amount (VT:0002644) plasma triglyceride level (CMO:0000548) 4 73169846 132642728 Rat 634334 Xhs3 X-ray hypersensitivity QTL 3 10 intestine integrity trait (VT:0010554) post-insult time to onset of moribundity (CMO:0001896) 4 84728680 129854654 Rat 1354612 Foco1 Food consumption QTL 1 8.87 eating behavior trait (VT:0001431) food intake rate (CMO:0000427) 4 44463908 148090542 Rat 634344 Hcar7 Hepatocarcinoma resistance QTL 7 7.8 liver integrity trait (VT:0010547) liver tumorous lesion number (CMO:0001068) 4 70808386 115808386 Rat 2303168 Bp330 Blood pressure QTL 330 4.25 0.017 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 4 5214602 146446691 Rat 738031 Alc14 Alcohol consumption QTL 14 7.6 0.00003 consumption behavior trait (VT:0002069) ethanol drink intake rate to body weight ratio (CMO:0001616) 4 59948935 154902892 Rat 1576316 Ept5 Estrogen-induced pituitary tumorigenesis QTL 5 3.8 pituitary gland mass (VT:0010496) pituitary gland wet weight (CMO:0000853) 4 83428419 177635233 Rat 631662 Hcar2 Hepatocarcinoma resistance QTL 2 3.1 0.0003 liver integrity trait (VT:0010547) volume of individual liver tumorous lesion (CMO:0001078) 4 78878504 123878504 Rat 1576305 Emca6 Estrogen-induced mammary cancer QTL 6 5.8 mammary gland integrity trait (VT:0010552) mammary tumor number (CMO:0000343) 4 44463720 155883716 Rat 61418 Pia5 Pristane induced arthritis QTL 5 4.5 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 4 62277855 128289560 Rat 631651 Bp124 Blood pressure QTL 124 3 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 4 62879517 107879517 Rat 738016 Alc16 Alcohol consumption QTL 16 3.6 0.00015 consumption behavior trait (VT:0002069) ethanol drink intake rate to body weight ratio (CMO:0001616) 4 59948935 154902892 Rat 1358202 Gluco11 Glucose level QTL 11 2.4 0.02 adipocyte glucose uptake trait (VT:0004185) absolute change in adipocyte glucose uptake (CMO:0000873) 4 85379421 167139601 Rat 1641833 Alc21 Alcohol consumption QTL 21 8.6 0.0001 drinking behavior trait (VT:0001422) ethanol drink intake rate (CMO:0001407) 4 56698790 126192555 Rat 2306899 Bp338 Blood pressure QTL 338 0.071 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 4 81006124 120102625 Rat 631674 Iddm14 Insulin dependent diabetes mellitus QTL 14 blood glucose amount (VT:0000188) plasma glucose level (CMO:0000042) 4 64528739 157573521 Rat 6478743 Anxrr40 Anxiety related response QTL 40 0.83076 defecation behavior trait (VT:0010462) defecation rate (CMO:0000998) 4 62753847 107753847 Rat 12798523 Anxrr56 Anxiety related response QTL 56 2.83 0.05 locomotor behavior trait (VT:0001392) amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958) 4 85253748 150276390 Rat 61434 Cia3 Collagen induced arthritis QTL 3 4.8 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 4 103194656 148194656 Rat 12798520 Anxrr55 Anxiety related response QTL 55 4.45 0.01 locomotor behavior trait (VT:0001392) number of rearing movements with lid-pushing in an experimental apparatus (CMO:0002715) 4 32583980 114627242 Rat
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
11
49
113
91
90
59
25
59
6
218
97
93
45
60
31
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000017301 ⟹ ENSRNOP00000017301
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 4 104,442,393 - 104,452,897 (-) Ensembl Rnor_6.0 Ensembl 4 100,250,301 - 100,252,755 (-) Ensembl
Ensembl Acc Id:
ENSRNOT00000096938 ⟹ ENSRNOP00000083978
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 4 104,442,393 - 104,447,514 (-) Ensembl
Ensembl Acc Id:
ENSRNOT00000115330 ⟹ ENSRNOP00000088625
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 4 104,442,393 - 104,445,670 (-) Ensembl
RefSeq Acc Id:
NM_031827 ⟹ NP_114015
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 106,000,570 - 106,005,642 (-) NCBI mRatBN7.2 4 104,442,383 - 104,447,457 (-) NCBI Rnor_6.0 4 100,250,301 - 100,252,756 (-) NCBI Rnor_5.0 4 165,020,594 - 165,023,049 (-) NCBI RGSC_v3.4 4 105,692,451 - 105,694,908 (-) RGD Celera 4 93,595,511 - 93,597,967 (-) NCBI
Sequence:
ATGGAGGCCAGTGGGAGTGCCGGAAATGACCGAGTCAGGAACCTGCAGAGTGAGGTGGAGGGAGTCAAGAATATTATGACCCAGAATGTGGAGCGGATCTTGGCCCGAGGGGAGAACCTGGACCATCT
hide sequence
RefSeq Acc Id:
XM_039108449 ⟹ XP_038964377
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 106,000,574 - 106,011,081 (-) NCBI mRatBN7.2 4 104,442,387 - 104,452,884 (-) NCBI
RefSeq Acc Id:
NP_114015 ⟸ NM_031827
- UniProtKB:
Q9WUF4 (UniProtKB/Swiss-Prot), A6IAB7 (UniProtKB/TrEMBL), A0A8I6AB54 (UniProtKB/TrEMBL)
- Sequence:
MEASGSAGNDRVRNLQSEVEGVKNIMTQNVERILARGENLDHLRNKTEDLEATSEHFKTTSQKVARKFWWKNVKMIVIICVIVLIILILIILFATGTIPT
hide sequence
Ensembl Acc Id:
ENSRNOP00000017301 ⟸ ENSRNOT00000017301
RefSeq Acc Id:
XP_038964377 ⟸ XM_039108449
- Peptide Label:
isoform X1
- UniProtKB:
F1LNT8 (UniProtKB/TrEMBL), A0A8I6AB54 (UniProtKB/TrEMBL)
Ensembl Acc Id:
ENSRNOP00000083978 ⟸ ENSRNOT00000096938
Ensembl Acc Id:
ENSRNOP00000088625 ⟸ ENSRNOT00000115330
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2005-01-20
Vamp8
vesicle-associated membrane protein 8
vesicle-associated membrane protein 8 (endobrevin)
Name updated
1299863 APPROVED
2002-08-07
Vamp8
vesicle-associated membrane protein 8 (endobrevin)
Symbol and Name status set to provisional
70820 PROVISIONAL
Note Type
Note
Reference
gene_physical_interaction
interacts with other SNARE proteins and forms stable ternary complex, reversibly dissociated by the soluble ATPase NSF
634238
