Symbol:
Crkl
Name:
CRK like proto-oncogene, adaptor protein
RGD ID:
1308531
Description:
Predicted to enable several functions, including identical protein binding activity; phosphotyrosine residue binding activity; and receptor tyrosine kinase binding activity. Predicted to be involved in several processes, including positive regulation of skeletal muscle acetylcholine-gated channel clustering; positive regulation of substrate adhesion-dependent cell spreading; and regulation of intracellular signal transduction. Predicted to act upstream of or within several processes, including cell surface receptor signaling pathway; circulatory system development; and nervous system development. Predicted to be located in cytosol; nucleoplasm; and synapse. Predicted to be part of protein-containing complex. Predicted to be active in cytoplasm and neuromuscular junction. Predicted to be extrinsic component of postsynaptic membrane. Human ortholog(s) of this gene implicated in chronic myeloid leukemia. Orthologous to human CRKL (CRK like proto-oncogene, adaptor protein); PARTICIPATES IN ephrin - ephrin receptor bidirectional signaling axis; erythropoietin signaling pathway; insulin-like growth factor signaling pathway; INTERACTS WITH ammonium chloride; bisphenol A; Brodifacoum.
Type:
protein-coding
RefSeq Status:
PROVISIONAL
Previously known as:
crk-like protein; crk-like protein-like; LOC100911248; LOC287942; v-crk avian sarcoma virus CT10 oncogene homolog-like; v-crk sarcoma virus CT10 oncogene homolog (avian)-like; v-crk sarcoma virus CT10 oncogene homolog-like
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 11 97,033,033 - 97,067,457 (-) NCBI GRCr8 mRatBN7.2 11 83,528,788 - 83,563,214 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 11 83,526,530 - 83,563,238 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 11 92,256,298 - 92,290,727 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 11 84,917,451 - 84,951,879 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 11 83,971,055 - 84,005,485 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 11 87,338,606 - 87,356,644 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 11 87,778,312 - 87,815,043 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 11 90,397,653 - 90,408,448 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 11 85,520,244 - 85,554,667 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 11 85,560,841 - 85,595,264 (-) NCBI Celera 11 82,297,248 - 82,331,672 (-) NCBI Celera Cytogenetic Map 11 q23 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Crkl Rat (1->4)-beta-D-glucan multiple interactions ISO Crkl (Mus musculus) 6480464 [perfluorooctane sulfonic acid co-treated with Cellulose] results in decreased expression of CRKL mRNA CTD PMID:36331819 Crkl Rat 1-chloro-2,4-dinitrobenzene affects binding ISO CRKL (Homo sapiens) 6480464 Dinitrochlorobenzene binds to CRKL protein CTD PMID:32991956 Crkl Rat 17beta-estradiol affects expression ISO CRKL (Homo sapiens) 6480464 Estradiol affects the expression of CRKL mRNA CTD PMID:14699072 Crkl Rat 17beta-estradiol increases expression ISO CRKL (Homo sapiens) 6480464 Estradiol results in increased expression of CRKL mRNA CTD PMID:19167446 Crkl Rat 17beta-estradiol multiple interactions ISO CRKL (Homo sapiens) 6480464 [Estradiol binds to ESR2 protein] which results in increased expression of CRKL mRNA CTD PMID:20404318 Crkl Rat 2,3',4,4',5-Pentachlorobiphenyl increases expression ISO Crkl (Mus musculus) 6480464 2 more ... CTD PMID:31388691 Crkl Rat 2,3,7,8-tetrachlorodibenzodioxine affects expression ISO Crkl (Mus musculus) 6480464 Tetrachlorodibenzodioxin affects the expression of CRKL mRNA CTD PMID:21570461 Crkl Rat 2-palmitoylglycerol increases expression ISO CRKL (Homo sapiens) 6480464 2-palmitoylglycerol results in increased expression of CRKL mRNA CTD PMID:37199045 Crkl Rat 3,4-methylenedioxymethamphetamine decreases expression ISO Crkl (Mus musculus) 6480464 N-Methyl-3 and 4-methylenedioxyamphetamine results in decreased expression of CRKL mRNA CTD PMID:26251327 Crkl Rat 3-isobutyl-1-methyl-7H-xanthine multiple interactions ISO Crkl (Mus musculus) 6480464 [Dexamethasone co-treated with rosiglitazone co-treated with 1-Methyl-3-isobutylxanthine co-treated with INS1 protein] results in decreased expression of CRKL mRNA CTD PMID:16054899 Crkl Rat 3-methylcholanthrene multiple interactions ISO CRKL (Homo sapiens) 6480464 Methylcholanthrene promotes the reaction [AHR protein binds to CRKL promoter] CTD PMID:20348232 Crkl Rat 3-phenylprop-2-enal decreases phosphorylation ISO CRKL (Homo sapiens) 6480464 cinnamaldehyde results in decreased phosphorylation of CRKL protein CTD PMID:21729535 Crkl Rat 4,4'-sulfonyldiphenol increases expression ISO Crkl (Mus musculus) 6480464 bisphenol S results in increased expression of CRKL mRNA CTD PMID:39298647 Crkl Rat 4,4'-sulfonyldiphenol increases expression ISO CRKL (Homo sapiens) 6480464 bisphenol S results in increased expression of CRKL protein CTD PMID:34186270 Crkl Rat 4-vinylcyclohexene dioxide affects expression ISO Crkl (Mus musculus) 6480464 4-vinyl-1-cyclohexene dioxide affects the expression of CRKL mRNA CTD PMID:20829426 Crkl Rat acrolein multiple interactions ISO CRKL (Homo sapiens) 6480464 [Acrolein co-treated with methacrylaldehyde co-treated with Ozone] results in increased expression of CRKL mRNA CTD PMID:32845096 Crkl Rat actinomycin D multiple interactions ISO CRKL (Homo sapiens) 6480464 [Dactinomycin co-treated with nutlin 3] results in increased secretion of CRKL protein CTD PMID:38460933 Crkl Rat all-trans-retinoic acid multiple interactions ISO Crkl (Mus musculus) 6480464 [CRKL gene mutant form co-treated with TBX1 gene mutant form] affects the abundance of Tretinoin CTD PMID:16399080 Crkl Rat alvocidib multiple interactions ISO CRKL (Homo sapiens) 6480464 [alvocidib co-treated with Bortezomib co-treated with ABL1] results in decreased phosphorylation of CRKL protein CTD PMID:15039284 Crkl Rat ammonium chloride decreases expression EXP 6480464 Ammonium Chloride results in decreased expression of CRKL protein CTD PMID:16483693 Crkl Rat arsenous acid multiple interactions ISO CRKL (Homo sapiens) 6480464 [nilotinib co-treated with Arsenic Trioxide] results in decreased phosphorylation of CRKL protein CTD PMID:23883479 Crkl Rat ATP multiple interactions ISO CRKL (Homo sapiens) 6480464 [ABL1 protein mutant form co-treated with Adenosine Triphosphate] results in increased phosphorylation of CRKL protein more ... CTD PMID:19366808 Crkl Rat benzo[a]pyrene affects methylation ISO CRKL (Homo sapiens) 6480464 Benzo(a)pyrene affects the methylation of CRKL intron CTD PMID:30157460 Crkl Rat bis(2-ethylhexyl) phthalate increases expression ISO Crkl (Mus musculus) 6480464 Diethylhexyl Phthalate results in increased expression of CRKL mRNA CTD PMID:34319233 Crkl Rat bisphenol A decreases expression EXP 6480464 bisphenol A results in decreased expression of CRKL mRNA CTD PMID:25181051 Crkl Rat bisphenol A increases expression ISO Crkl (Mus musculus) 6480464 bisphenol A results in increased expression of CRKL mRNA CTD PMID:33221593 Crkl Rat bisphenol A increases expression ISO CRKL (Homo sapiens) 6480464 bisphenol A results in increased expression of CRKL mRNA and bisphenol A results in increased expression of CRKL protein CTD PMID:33670352 and PMID:37567409 Crkl Rat Bisphenol B increases expression ISO CRKL (Homo sapiens) 6480464 bisphenol B results in increased expression of CRKL protein CTD PMID:34186270 Crkl Rat bortezomib multiple interactions ISO CRKL (Homo sapiens) 6480464 [alvocidib co-treated with Bortezomib co-treated with ABL1] results in decreased phosphorylation of CRKL protein CTD PMID:15039284 Crkl Rat Brodifacoum decreases expression EXP 6480464 bromfenacoum results in decreased expression of CRKL protein CTD PMID:28903499 Crkl Rat cadmium dichloride decreases expression ISO CRKL (Homo sapiens) 6480464 Cadmium Chloride results in decreased expression of CRKL mRNA CTD PMID:26472689 and PMID:38568856 Crkl Rat chloropicrin decreases expression ISO CRKL (Homo sapiens) 6480464 chloropicrin results in decreased expression of CRKL mRNA CTD PMID:26352163 Crkl Rat choline multiple interactions ISO Crkl (Mus musculus) 6480464 [Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in decreased expression of CRKL mRNA CTD PMID:20938992 Crkl Rat cobalt dichloride increases expression EXP 6480464 cobaltous chloride results in increased expression of CRKL mRNA CTD PMID:24386269 Crkl Rat copper atom multiple interactions ISO CRKL (Homo sapiens) 6480464 [Chelating Agents binds to Copper] which results in increased expression of CRKL mRNA CTD PMID:30911355 Crkl Rat copper(0) multiple interactions ISO CRKL (Homo sapiens) 6480464 [Chelating Agents binds to Copper] which results in increased expression of CRKL mRNA CTD PMID:30911355 Crkl Rat crizotinib multiple interactions ISO CRKL (Homo sapiens) 6480464 [[crizotinib results in decreased phosphorylation of MET protein] which results in increased expression of HGF protein] which results in increased phosphorylation of CRKL protein CTD PMID:22683780 Crkl Rat crocidolite asbestos affects expression ISO CRKL (Homo sapiens) 6480464 Asbestos and Crocidolite affects the expression of CRKL mRNA CTD PMID:17331233 Crkl Rat deguelin increases expression ISO CRKL (Homo sapiens) 6480464 deguelin results in increased expression of CRKL mRNA CTD PMID:33512557 Crkl Rat dexamethasone multiple interactions ISO Crkl (Mus musculus) 6480464 [Dexamethasone co-treated with rosiglitazone co-treated with 1-Methyl-3-isobutylxanthine co-treated with INS1 protein] results in decreased expression of CRKL mRNA CTD PMID:16054899 Crkl Rat diarsenic trioxide multiple interactions ISO CRKL (Homo sapiens) 6480464 [nilotinib co-treated with Arsenic Trioxide] results in decreased phosphorylation of CRKL protein CTD PMID:23883479 Crkl Rat Dibutyl phosphate affects expression ISO CRKL (Homo sapiens) 6480464 di-n-butylphosphoric acid affects the expression of CRKL mRNA CTD PMID:37042841 Crkl Rat doxorubicin increases expression ISO CRKL (Homo sapiens) 6480464 Doxorubicin results in increased expression of CRKL mRNA CTD PMID:29803840 Crkl Rat enzyme inhibitor multiple interactions ISO CRKL (Homo sapiens) 6480464 [Enzyme Inhibitors results in decreased activity of OGA protein] which results in increased O-linked glycosylation of CRKL protein CTD PMID:23301498 Crkl Rat ethanol affects splicing ISO Crkl (Mus musculus) 6480464 Ethanol affects the splicing of CRKL mRNA CTD PMID:30319688 Crkl Rat folic acid multiple interactions ISO Crkl (Mus musculus) 6480464 [Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in decreased expression of CRKL mRNA CTD PMID:20938992 Crkl Rat folpet increases expression ISO Crkl (Mus musculus) 6480464 folpet results in increased expression of CRKL mRNA CTD PMID:31558096 Crkl Rat FR900359 increases phosphorylation ISO CRKL (Homo sapiens) 6480464 FR900359 results in increased phosphorylation of CRKL protein CTD PMID:37730182 Crkl Rat gentamycin increases expression EXP 6480464 Gentamicins results in increased expression of CRKL mRNA CTD PMID:33387578 Crkl Rat ivermectin decreases expression ISO CRKL (Homo sapiens) 6480464 Ivermectin results in decreased expression of CRKL protein CTD PMID:32959892 Crkl Rat L-methionine multiple interactions ISO Crkl (Mus musculus) 6480464 [Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in decreased expression of CRKL mRNA CTD PMID:20938992 Crkl Rat lead diacetate decreases expression ISO Crkl (Mus musculus) 6480464 lead acetate results in decreased expression of CRKL mRNA CTD PMID:22609695 Crkl Rat methamphetamine increases expression EXP 6480464 Methamphetamine results in increased expression of CRKL mRNA CTD PMID:19564919 Crkl Rat methyl methanesulfonate increases expression ISO CRKL (Homo sapiens) 6480464 Methyl Methanesulfonate results in increased expression of CRKL mRNA CTD PMID:23649840 Crkl Rat microcystin RR increases expression ISO CRKL (Homo sapiens) 6480464 microcystin RR results in increased expression of CRKL protein CTD PMID:19111056 Crkl Rat nickel atom affects expression ISO CRKL (Homo sapiens) 6480464 Nickel affects the expression of CRKL mRNA CTD PMID:14575637 Crkl Rat nickel atom multiple interactions ISO CRKL (Homo sapiens) 6480464 trichostatin A inhibits the reaction [Nickel affects the expression of CRKL mRNA] CTD PMID:14575637 Crkl Rat nilotinib multiple interactions ISO CRKL (Homo sapiens) 6480464 [nilotinib co-treated with Arsenic Trioxide] results in decreased phosphorylation of CRKL protein and nilotinib inhibits the reaction [ABL1 protein mutant form results in increased phosphorylation of CRKL protein] CTD PMID:19878872 and PMID:23883479 Crkl Rat nilotinib decreases phosphorylation ISO CRKL (Homo sapiens) 6480464 nilotinib results in decreased phosphorylation of CRKL protein CTD PMID:23883479 Crkl Rat nitrates multiple interactions ISO Crkl (Mus musculus) 6480464 [Particulate Matter results in increased abundance of Nitrates] which results in increased expression of CRKL mRNA CTD PMID:35964746 Crkl Rat Nutlin-3 multiple interactions ISO CRKL (Homo sapiens) 6480464 [Dactinomycin co-treated with nutlin 3] results in increased secretion of CRKL protein CTD PMID:38460933 Crkl Rat ozone multiple interactions ISO CRKL (Homo sapiens) 6480464 [Acrolein co-treated with methacrylaldehyde co-treated with Ozone] results in increased expression of CRKL mRNA CTD PMID:32845096 Crkl Rat paracetamol decreases expression ISO Crkl (Mus musculus) 6480464 Acetaminophen results in decreased expression of CRKL mRNA CTD PMID:17585979 Crkl Rat perfluorooctane-1-sulfonic acid multiple interactions ISO Crkl (Mus musculus) 6480464 [perfluorooctane sulfonic acid co-treated with Cellulose] results in decreased expression of CRKL mRNA CTD PMID:36331819 Crkl Rat ponatinib multiple interactions ISO CRKL (Homo sapiens) 6480464 ponatinib inhibits the reaction [ABL1 protein mutant form results in increased phosphorylation of CRKL protein] CTD PMID:19878872 Crkl Rat ponatinib decreases phosphorylation ISO Crkl (Mus musculus) 6480464 ponatinib results in decreased phosphorylation of CRKL protein CTD PMID:19878872 Crkl Rat ponatinib decreases phosphorylation ISO CRKL (Homo sapiens) 6480464 ponatinib results in decreased phosphorylation of CRKL protein CTD PMID:25304212 Crkl Rat potassium dichromate decreases expression ISO Crkl (Mus musculus) 6480464 Potassium Dichromate results in decreased expression of CRKL mRNA CTD PMID:23608068 Crkl Rat rotenone increases expression ISO CRKL (Homo sapiens) 6480464 Rotenone results in increased expression of CRKL mRNA CTD PMID:33512557 Crkl Rat SB 431542 multiple interactions ISO CRKL (Homo sapiens) 6480464 [LDN 193189 co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide co-treated with FGF2 protein] results in increased expression of CRKL protein CTD PMID:37664457 Crkl Rat sorafenib multiple interactions ISO CRKL (Homo sapiens) 6480464 sorafenib inhibits the reaction [[ABL1 protein mutant form co-treated with Adenosine Triphosphate] results in increased phosphorylation of CRKL protein] and sorafenib inhibits the reaction [[BCR protein mutant form co-treated with Adenosine Triphosphate] results in increased phosphorylation of CRKL protein] CTD PMID:19366808 Crkl Rat sorafenib decreases phosphorylation ISO CRKL (Homo sapiens) 6480464 sorafenib results in decreased phosphorylation of CRKL protein CTD PMID:19366808 Crkl Rat thioacetamide increases expression EXP 6480464 Thioacetamide results in increased expression of CRKL mRNA CTD PMID:34492290 Crkl Rat titanium dioxide decreases methylation ISO Crkl (Mus musculus) 6480464 titanium dioxide results in decreased methylation of CRKL gene CTD PMID:35295148 Crkl Rat trichloroethene increases expression ISO Crkl (Mus musculus) 6480464 Trichloroethylene results in increased expression of CRKL mRNA CTD PMID:15363585 Crkl Rat trichloroethene multiple interactions ISO Crkl (Mus musculus) 6480464 PPARA protein inhibits the reaction [Trichloroethylene results in increased expression of CRKL protein] CTD PMID:15363585 Crkl Rat trichostatin A multiple interactions ISO CRKL (Homo sapiens) 6480464 trichostatin A inhibits the reaction [Nickel affects the expression of CRKL mRNA] CTD PMID:14575637 Crkl Rat valproic acid affects expression ISO Crkl (Mus musculus) 6480464 Valproic Acid affects the expression of CRKL mRNA CTD PMID:17292431 Crkl Rat vorinostat multiple interactions ISO Crkl (Mus musculus) 6480464 [Dasatinib co-treated with vorinostat] results in decreased phosphorylation of CRKL protein CTD PMID:17020995 Crkl Rat vorinostat multiple interactions ISO CRKL (Homo sapiens) 6480464 [Dasatinib co-treated with vorinostat] results in decreased phosphorylation of CRKL protein CTD PMID:17020995
Imported Annotations - KEGG (archival)
Imported Annotations - PID (archival)
(1->4)-beta-D-glucan (ISO) 1-chloro-2,4-dinitrobenzene (ISO) 17beta-estradiol (ISO) 2,3',4,4',5-Pentachlorobiphenyl (ISO) 2,3,7,8-tetrachlorodibenzodioxine (ISO) 2-palmitoylglycerol (ISO) 3,4-methylenedioxymethamphetamine (ISO) 3-isobutyl-1-methyl-7H-xanthine (ISO) 3-methylcholanthrene (ISO) 3-phenylprop-2-enal (ISO) 4,4'-sulfonyldiphenol (ISO) 4-vinylcyclohexene dioxide (ISO) acrolein (ISO) actinomycin D (ISO) all-trans-retinoic acid (ISO) alvocidib (ISO) ammonium chloride (EXP) arsenous acid (ISO) ATP (ISO) benzo[a]pyrene (ISO) bis(2-ethylhexyl) phthalate (ISO) bisphenol A (EXP,ISO) Bisphenol B (ISO) bortezomib (ISO) Brodifacoum (EXP) cadmium dichloride (ISO) chloropicrin (ISO) choline (ISO) cobalt dichloride (EXP) copper atom (ISO) copper(0) (ISO) crizotinib (ISO) crocidolite asbestos (ISO) deguelin (ISO) dexamethasone (ISO) diarsenic trioxide (ISO) Dibutyl phosphate (ISO) doxorubicin (ISO) enzyme inhibitor (ISO) ethanol (ISO) folic acid (ISO) folpet (ISO) FR900359 (ISO) gentamycin (EXP) ivermectin (ISO) L-methionine (ISO) lead diacetate (ISO) methamphetamine (EXP) methyl methanesulfonate (ISO) microcystin RR (ISO) nickel atom (ISO) nilotinib (ISO) nitrates (ISO) Nutlin-3 (ISO) ozone (ISO) paracetamol (ISO) perfluorooctane-1-sulfonic acid (ISO) ponatinib (ISO) potassium dichromate (ISO) rotenone (ISO) SB 431542 (ISO) sorafenib (ISO) thioacetamide (EXP) titanium dioxide (ISO) trichloroethene (ISO) trichostatin A (ISO) valproic acid (ISO) vorinostat (ISO)
1.
Met, metastasis, motility and more.
Birchmeier C, etal., Nat Rev Mol Cell Biol. 2003 Dec;4(12):915-25.
2.
Phylogenetic-based propagation of functional annotations within the Gene Ontology consortium.
Gaudet P, etal., Brief Bioinform. 2011 Sep;12(5):449-62. doi: 10.1093/bib/bbr042. Epub 2011 Aug 27.
3.
Rat ISS GO annotations from GOA human gene data--August 2006
GOA data from the GO Consortium
4.
Phosphorylation levels of BCR-ABL, CrkL, AKT and STAT5 in imatinib-resistant chronic myeloid leukemia cells implicate alternative pathway usage as a survival strategy.
Jilani I, etal., Leuk Res. 2008 Apr;32(4):643-9. doi: 10.1016/j.leukres.2007.08.009. Epub 2007 Sep 27.
5.
Rat ISS GO annotations from MGI mouse gene data--August 2006
MGD data from the GO Consortium
6.
KEGG Annotation Import Pipeline
Pipeline to import KEGG annotations from KEGG into RGD
7.
PID Annotation Import Pipeline
Pipeline to import Pathway Interaction Database annotations from NCI into RGD
8.
GOA pipeline
RGD automated data pipeline
9.
ClinVar Automated Import and Annotation Pipeline
RGD automated import pipeline for ClinVar variants, variant-to-disease annotations and gene-to-disease annotations
10.
Data Import for Chemical-Gene Interactions
RGD automated import pipeline for gene-chemical interactions
11.
Comprehensive gene review and curation
RGD comprehensive gene curation
12.
CrkL functions as a nuclear adaptor and transcriptional activator in Bcr-Abl-expressing cells.
Rhodes J, etal., Exp Hematol. 2000 Mar;28(3):305-10.
13.
Active (p)CrkL is overexpressed in human malignancies: potential role as a surrogate parameter for therapeutic tyrosine kinase inhibition.
Singer CF, etal., Oncol Rep. 2006 Feb;15(2):353-9.
14.
Overexpression of CRKL correlates with malignant cell proliferation in breast cancer.
Zhao T, etal., Tumour Biol. 2013 Oct;34(5):2891-7. doi: 10.1007/s13277-013-0851-7. Epub 2013 May 19.
Crkl Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 11 97,033,033 - 97,067,457 (-) NCBI GRCr8 mRatBN7.2 11 83,528,788 - 83,563,214 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 11 83,526,530 - 83,563,238 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 11 92,256,298 - 92,290,727 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 11 84,917,451 - 84,951,879 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 11 83,971,055 - 84,005,485 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 11 87,338,606 - 87,356,644 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 11 87,778,312 - 87,815,043 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 11 90,397,653 - 90,408,448 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 11 85,520,244 - 85,554,667 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 11 85,560,841 - 85,595,264 (-) NCBI Celera 11 82,297,248 - 82,331,672 (-) NCBI Celera Cytogenetic Map 11 q23 NCBI
CRKL Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 22 20,917,407 - 20,953,747 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 22 20,917,407 - 20,953,747 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 22 21,271,695 - 21,308,035 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 22 19,601,714 - 19,637,890 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 22 19,596,267 - 19,632,443 NCBI Celera 22 4,763,059 - 4,799,374 (+) NCBI Celera Cytogenetic Map 22 q11.21 ENTREZGENE HuRef 22 4,539,711 - 4,576,600 (+) NCBI HuRef CHM1_1 22 21,271,912 - 21,308,243 (+) NCBI CHM1_1 T2T-CHM13v2.0 22 21,326,128 - 21,362,450 (+) NCBI T2T-CHM13v2.0
Crkl Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 16 17,269,849 - 17,305,304 (+) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 16 17,269,851 - 17,305,298 (+) Ensembl GRCm39 Ensembl GRCm38 16 17,451,985 - 17,487,440 (+) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 16 17,451,987 - 17,487,434 (+) Ensembl GRCm38 mm10 GRCm38 MGSCv37 16 17,452,080 - 17,486,348 (+) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 16 17,365,550 - 17,399,818 (+) NCBI MGSCv36 mm8 Celera 16 18,025,071 - 18,059,338 (+) NCBI Celera Cytogenetic Map 16 A3 NCBI cM Map 16 10.82 NCBI
Crkl Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955442 19,358,081 - 19,388,815 (-) Ensembl ChiLan1.0 ChiLan1.0 NW_004955442 19,358,202 - 19,388,552 (-) NCBI ChiLan1.0 ChiLan1.0
CRKL Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 23 30,622,858 - 30,660,228 (+) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 22 33,172,806 - 33,209,143 (+) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 22 3,141,147 - 3,177,448 (+) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 22 19,632,359 - 19,668,858 (+) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 22 19,632,359 - 19,668,858 (+) Ensembl panpan1.1 panPan2
CRKL Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 26 30,542,276 - 30,582,479 (-) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 26 30,545,311 - 30,581,964 (-) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 26 30,499,506 - 30,540,212 (-) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 26 31,950,077 - 31,990,503 (-) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 26 31,950,075 - 31,990,495 (-) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 26 29,995,836 - 30,036,268 (-) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 26 29,619,771 - 29,660,610 (-) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 26 30,708,885 - 30,749,836 (-) NCBI UU_Cfam_GSD_1.0
Crkl Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024405118 140,267,911 - 140,306,379 (-) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936619 2,447,614 - 2,479,805 (+) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936619 2,447,686 - 2,479,589 (+) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
CRKL Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 14 50,528,955 - 50,558,662 (+) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 14 50,528,950 - 50,558,664 (+) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 14 53,977,699 - 54,007,396 (+) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
LOC103222955 Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 19 4,855,633 - 4,889,674 (+) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 19 4,855,611 - 4,890,302 (+) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666085 2,080,371 - 2,099,812 (-) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Crkl
.
Predicted Target Of
Count of predictions: 177 Count of miRNA genes: 132 Interacting mature miRNAs: 151 Transcripts: ENSRNOT00000002552 Prediction methods: Miranda, Rnahybrid, Targetscan Result types: miRGate_prediction
724554 Iddm17 Insulin dependent diabetes mellitus QTL 17 0.001 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 11 18976208 86241447 Rat 10058954 Gmadr7 Adrenal mass QTL 7 2.49 0.0049 adrenal gland mass (VT:0010420) both adrenal glands wet weight to body weight ratio (CMO:0002411) 11 60346590 86241447 Rat 1354593 Stl12 Serum triglyceride level QTL 12 3.36 blood triglyceride amount (VT:0002644) serum triglyceride level (CMO:0000360) 11 66422148 86241447 Rat 724561 Plsm4 Polydactyly-luxate syndrome (PLS) morphotypes QTL 4 0.0003 forelimb integrity trait (VT:0010562) front foot phalanges count (CMO:0001947) 11 54457534 86241447 Rat 634339 Niddm50 Non-insulin dependent diabetes mellitus QTL 50 3.32 blood glucose amount (VT:0000188) plasma glucose level (CMO:0000042) 11 66422148 86241447 Rat 7411658 Foco27 Food consumption QTL 27 16.2 0.001 eating behavior trait (VT:0001431) feed conversion ratio (CMO:0001312) 11 56351424 86241447 Rat
RH132604
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 11 83,529,687 - 83,529,878 (-) MAPPER mRatBN7.2 mRatBN7.2 11 83,529,687 - 83,529,878 (+) MAPPER mRatBN7.2 Rnor_6.0 11 87,781,496 - 87,781,686 NCBI Rnor6.0 Rnor_6.0 11 87,355,554 - 87,355,744 NCBI Rnor6.0 Rnor_5.0 11 90,407,358 - 90,407,548 UniSTS Rnor5.0 Rnor_5.0 11 90,833,905 - 90,834,095 UniSTS Rnor5.0 RGSC_v3.4 11 85,521,144 - 85,521,334 UniSTS RGSC3.4 Celera 11 82,298,148 - 82,298,338 UniSTS RH 3.4 Map 11 714.5 UniSTS Cytogenetic Map 11 q23 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
6
6
31
34
30
18
6
18
6
58
24
19
10
19
12
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000002552 ⟹ ENSRNOP00000002552
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 11 83,526,530 - 83,563,181 (-) Ensembl Rnor_6.0 Ensembl 11 87,778,312 - 87,815,043 (-) Ensembl
Ensembl Acc Id:
ENSRNOT00000115018 ⟹ ENSRNOP00000096058
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 11 83,528,831 - 83,563,238 (-) Ensembl
RefSeq Acc Id:
NM_001008284 ⟹ NP_001008285
RefSeq Status:
PROVISIONAL
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 11 97,033,033 - 97,067,457 (-) NCBI mRatBN7.2 11 83,528,788 - 83,563,214 (-) NCBI Rnor_6.0 11 87,338,606 - 87,356,644 (+) NCBI Rnor_5.0 11 90,397,653 - 90,408,448 (+) NCBI RGSC_v3.4 11 85,520,244 - 85,554,667 (-) RGD Celera 11 82,297,248 - 82,331,672 (-) RGD
Sequence:
GCCCGGTCGCTTCTCCCGCGTCCGCCATTTTGTTGCTGTGGCTATTGGGAACGGGTAGGGTAGGACGGTCCGGGAGGCGCGACTGTTGTTGGAGTGCGGTGCTTCGTGTGACGGCGAGGAACCGTGCG
hide sequence
RefSeq Acc Id:
NP_001008285 ⟸ NM_001008284
- UniProtKB:
Q5U2U2 (UniProtKB/Swiss-Prot)
- Sequence:
MSSARFDSSDRSAWYMGPVSRQEAQTRLQGQRHGMFLVRDSSTCPGDYVLSVSENSRVSHYIINSLPNRRFKIGDQEFDHLPALLEFYKIHYLDTTTLIEPAPRYPNPPMGSVSAPNLSTAEENLEYV
hide sequence
Ensembl Acc Id:
ENSRNOP00000002552 ⟸ ENSRNOT00000002552
Ensembl Acc Id:
ENSRNOP00000096058 ⟸ ENSRNOT00000115018
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2021-03-09
Crkl
CRK like proto-oncogene, adaptor protein
LOC100911248
crk-like protein-like
Data merged from RGD:6493647
737654 PROVISIONAL
2016-06-22
Crkl
CRK like proto-oncogene, adaptor protein
Crkl
v-crk avian sarcoma virus CT10 oncogene homolog-like
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2013-08-01
Crkl
v-crk avian sarcoma virus CT10 oncogene homolog-like
Crkl
v-crk sarcoma virus CT10 oncogene homolog (avian)-like
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2012-07-05
LOC100911248
crk-like protein-like
Symbol and Name status set to provisional
70820 PROVISIONAL
2005-12-06
Crkl
v-crk sarcoma virus CT10 oncogene homolog (avian)-like
Crkl_predicted
v-crk sarcoma virus CT10 oncogene homolog (avian)-like (predicted)
Symbol and Name updated
1559027 APPROVED
2005-01-12
Crkl_predicted
v-crk sarcoma virus CT10 oncogene homolog (avian)-like (predicted)
Symbol and Name status set to approved
70820 APPROVED
