Symbol:
Mir761
Name:
microRNA 761
RGD ID:
2325411
Description:
Orthologous to human MIR761 (microRNA 761); INTERACTS WITH cadmium atom; cadmium dichloride; hydrogen peroxide.
Type:
ncrna (Ensembl: miRNA)
RefSeq Status:
PROVISIONAL
Previously known as:
rno-mir-761
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 5 129,005,205 - 129,005,280 (+) NCBI GRCr8 mRatBN7.2 5 123,776,534 - 123,776,609 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 5 123,776,534 - 123,776,609 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 5 126,392,699 - 126,392,774 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 5 128,115,783 - 128,115,858 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 5 128,167,058 - 128,167,133 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 5 128,651,867 - 128,651,942 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 5 128,651,867 - 128,651,942 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 5 132,492,895 - 132,492,970 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 Celera 5 122,507,589 - 122,507,664 (+) NCBI Celera Cytogenetic Map 5 q34 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Mir761 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 5 129,005,205 - 129,005,280 (+) NCBI GRCr8 mRatBN7.2 5 123,776,534 - 123,776,609 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 5 123,776,534 - 123,776,609 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 5 126,392,699 - 126,392,774 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 5 128,115,783 - 128,115,858 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 5 128,167,058 - 128,167,133 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 5 128,651,867 - 128,651,942 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 5 128,651,867 - 128,651,942 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 5 132,492,895 - 132,492,970 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 Celera 5 122,507,589 - 122,507,664 (+) NCBI Celera Cytogenetic Map 5 q34 NCBI
MIR761 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 1 51,836,344 - 51,836,402 (-) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 1 51,836,344 - 51,836,402 (-) Ensembl GRCh38 hg38 GRCh38 GRCh37 1 52,302,016 - 52,302,074 (-) NCBI GRCh37 GRCh37 hg19 GRCh37 Celera 1 50,588,633 - 50,588,691 (-) NCBI Celera Cytogenetic Map 1 p32.3 NCBI HuRef 1 50,418,735 - 50,418,793 (-) NCBI HuRef CHM1_1 1 52,419,340 - 52,419,398 (-) NCBI CHM1_1 T2T-CHM13v2.0 1 51,716,720 - 51,716,778 (-) NCBI T2T-CHM13v2.0
Mir761 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 4 108,874,852 - 108,874,927 (+) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 4 108,874,852 - 108,874,927 (+) Ensembl GRCm39 Ensembl GRCm38 4 109,017,655 - 109,017,730 (+) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 4 109,017,655 - 109,017,730 (+) Ensembl GRCm38 mm10 GRCm38 MGSCv37 4 108,690,260 - 108,690,335 (+) NCBI GRCm37 MGSCv37 mm9 NCBIm37 Cytogenetic Map 4 C7 NCBI cM Map 4 50.77 NCBI
MIR761 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 15 9,455,388 - 9,455,457 (+) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 15 9,455,388 - 9,455,457 (+) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 15 9,607,226 - 9,607,295 (+) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 15 9,579,830 - 9,579,899 (+) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 15 9,579,830 - 9,579,899 (+) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 15 9,390,530 - 9,390,599 (+) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 15 9,479,483 - 9,479,552 (+) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 15 9,497,812 - 9,497,881 (+) NCBI UU_Cfam_GSD_1.0
.
Predicted Targets
Count of predictions: 8298 Count of gene targets: 5745 Count of transcripts: 6251 Interacting mature miRNAs: rno-miR-761 Prediction methods: Microtar, Miranda, Pita, Rnahybrid, Targetscan Result types: miRGate_prediction
1549845 Scl44 Serum cholesterol level QTL 44 6 blood cholesterol amount (VT:0000180) serum total cholesterol level (CMO:0000363) 5 40128307 148607290 Rat 8552960 Pigfal15 Plasma insulin-like growth factor 1 level QTL 15 blood insulin-like growth factor amount (VT:0010479) plasma insulin-like growth factor 1 level (CMO:0001299) 5 111416838 156416838 Rat 1298070 Scl18 Serum cholesterol level QTL 18 3.7 blood LDL cholesterol amount (VT:0000181) calculated plasma low density lipoprotein cholesterol level (CMO:0001245) 5 79584860 124584860 Rat 61452 Ciaa5 CIA Autoantibody QTL 5 3.5 blood autoantibody amount (VT:0003725) calculated serum anti-rat type 2 collagen autoantibody titer (CMO:0001281) 5 94858972 143070159 Rat 1582230 Bw78 Body weight QTL 78 3.2 0.0016 epididymal fat pad mass (VT:0010421) epididymal fat pad weight to body weight ratio (CMO:0000658) 5 119085612 128034027 Rat 7411582 Foco3 Food consumption QTL 3 7.5 0.001 eating behavior trait (VT:0001431) feed conversion ratio (CMO:0001312) 5 87468046 132468046 Rat 1598859 Cm66 Cardiac mass QTL 66 2 heart mass (VT:0007028) heart weight to body weight ratio (CMO:0000074) 5 79584860 124584860 Rat 1302790 Scl20 Serum cholesterol level QTL 20 6.4 0.0001 blood cholesterol amount (VT:0000180) plasma total cholesterol level (CMO:0000585) 5 82394392 166664054 Rat 1578766 Tcas11 Tongue tumor susceptibility QTL 11 4.12 tongue integrity trait (VT:0010553) number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950) 5 46711509 161317411 Rat 1549838 Bss4 Bone structure and strength QTL 4 9.2 femur strength trait (VT:0010010) femur midshaft polar moment of inertia (CMO:0001669) 5 106906205 151906205 Rat 2317753 Glom24 Glomerulus QTL 24 3.1 kidney glomerulus integrity trait (VT:0010546) kidney sclerotic glomeruli count to total glomeruli count ratio (CMO:0001269) 5 97570330 136479578 Rat 7411564 Bw135 Body weight QTL 135 0.001 body mass (VT:0001259) body weight gain (CMO:0000420) 5 87468046 132468046 Rat 8657050 Bw146 Body weight QTL 146 19.84 0.001 body mass (VT:0001259) body weight gain (CMO:0000420) 5 108938288 153938288 Rat 1641912 Alcrsp18 Alcohol response QTL 18 response to alcohol trait (VT:0010489) duration of loss of righting reflex (CMO:0002289) 5 35189153 141643988 Rat 2317056 Wbc3 White blood cell count QTL 3 2.51 0.01 leukocyte quantity (VT:0000217) white blood cell count (CMO:0000027) 5 105999803 150999803 Rat 2293642 Bss37 Bone structure and strength QTL 37 4.64 0.0001 femur strength trait (VT:0010010) femur ultimate force (CMO:0001675) 5 120740824 151018848 Rat 1358909 Kidm25 Kidney mass QTL 25 1.87 kidney mass (VT:0002707) both kidneys wet weight to body weight ratio (CMO:0000340) 5 90067849 128034027 Rat 1578673 Bmd13 Bone mineral density QTL 13 4.9 femur mineral mass (VT:0010011) trabecular volumetric bone mineral density (CMO:0001729) 5 103689353 148689353 Rat 70189 Mcs5 Mammary carcinoma susceptibility QTL 5 10.51 mammary gland integrity trait (VT:0010552) mammary tumor number (CMO:0000343) 5 55805606 132207589 Rat 7207488 Bss110 Bone structure and strength QTL 1 8.4 femur strength trait (VT:0010010) femur stiffness (CMO:0001674) 5 106906205 151906205 Rat 8694441 Bw169 Body weight QTL 169 17.61 0.001 retroperitoneal fat pad mass (VT:0010430) retroperitoneal fat pad weight to body weight ratio (CMO:0000635) 5 111416838 156416838 Rat 7207491 Bss112 Bone structure and strength QTL 112 7 femur morphology trait (VT:0000559) femur midshaft cortical cross-sectional area (CMO:0001663) 5 106906205 151906205 Rat 2290448 Scl54 Serum cholesterol level QTL 54 2.93 blood cholesterol amount (VT:0000180) plasma total cholesterol level (CMO:0000585) 5 31663789 131345958 Rat 8694198 Abfw3 Abdominal fat weight QTL 3 16.13 0.001 visceral adipose mass (VT:0010063) abdominal fat pad weight to body weight ratio (CMO:0000095) 5 111416838 156416838 Rat 1298086 Bp156 Blood pressure QTL 156 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 5 84132602 129132602 Rat 2306971 Anxrr21 Anxiety related response QTL 21 9.47 fear/anxiety-related behavior trait (VT:1000241) number of entries into a discrete space in an experimental apparatus (CMO:0000960) 5 66174080 124160948 Rat 1298089 Scl14 Serum cholesterol level QTL 14 5.8 0.0004 blood cholesterol amount (VT:0000180) plasma total cholesterol level (CMO:0000585) 5 108845856 153845856 Rat 1358895 Bp254 Blood pressure QTL 254 3.6 0.0003 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 5 58829236 128034027 Rat 1358889 Bp261 Blood pressure QTL 261 2.86 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 5 90067849 128034027 Rat 1331796 Thshl2 Thyroid stimulating hormone level QTL 2 2.3 blood thyroid-stimulating hormone amount (VT:0005119) serum thyroid stimulating hormone level (CMO:0001248) 5 97059760 147465714 Rat 70212 Niddm25 Non-insulin dependent diabetes mellitus QTL 25 3.54 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 5 1 131345958 Rat 7794739 Bp372 Blood pressure QTL 372 0.0058 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 5 117913688 125222967 Rat 1331801 Rf33 Renal function QTL 33 4.149 kidney blood vessel physiology trait (VT:0100012) absolute change in renal vascular resistance (CMO:0001900) 5 43726656 129132602 Rat 61393 Bp7 Blood pressure QTL 7 4.5 0.0001 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 5 60293434 161481680 Rat 7207486 Bss109 Bone structure and strength QTL 109 femur strength trait (VT:0010010) femur total energy absorbed before break (CMO:0001677) 5 106906205 151906205 Rat 7207481 Bss106 Bone structure and strength QTL 106 7.9 femur strength trait (VT:0010010) femur ultimate force (CMO:0001675) 5 106906205 151906205 Rat 1641920 Colcs1 Colorectal carcinoma susceptibility QTL 1 2.99 0.0055 intestine integrity trait (VT:0010554) benign colorectal tumor surface area measurement (CMO:0001799) 5 121846814 166846814 Rat 1581510 Cm54 Cardiac mass QTL 54 3.4 0.05 heart left ventricle mass (VT:0007031) heart left ventricle weight to body weight ratio (CMO:0000530) 5 120740824 143608494 Rat 1576312 Emca8 Estrogen-induced mammary cancer QTL 8 4.1 mammary gland integrity trait (VT:0010552) mammary tumor number (CMO:0000343) 5 50328551 141643988 Rat 7411601 Foco12 Food consumption QTL 12 19.7 0.001 eating behavior trait (VT:0001431) feed conversion ratio (CMO:0001312) 5 87468046 132468046 Rat 1576314 Eutr1 Estrogen induced uterine response QTL 1 uterus integrity trait (VT:0010575) pyometritis severity score (CMO:0002009) 5 2138965 166875058 Rat 1598846 Bp293 Blood pressure QTL 293 3.9 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 5 79584860 124584860 Rat 1598847 Cm62 Cardiac mass QTL 62 3.4 heart mass (VT:0007028) heart weight to body weight ratio (CMO:0000074) 5 108845856 153845856 Rat 631527 Tls1 T-lymphoma susceptibility QTL 1 0 0.001 thymus integrity trait (VT:0010555) post-insult time to onset of T-cell lymphoma (CMO:0001907) 5 90450144 135450144 Rat 8694389 Bw160 Body weight QTL 160 6.17 0.001 body lean mass (VT:0010483) lean tissue morphological measurement (CMO:0002184) 5 111416838 156416838 Rat 61426 Scl2 Serum cholesterol level QTL 2 7.3 0.001 blood cholesterol amount (VT:0000180) serum total cholesterol level (CMO:0000363) 5 59793399 143070159 Rat 1354598 Srn6 Serum renin concentration QTL 6 3.8 blood renin amount (VT:0003349) plasma renin activity level (CMO:0000116) 5 69540295 151018848 Rat 6903316 Bw113 Body weight QTL 113 2 0.0103 body mass (VT:0001259) body weight (CMO:0000012) 5 87765973 132765973 Rat 1358187 Emca1 Estrogen-induced mammary cancer QTL 1 4.4 mammary gland integrity trait (VT:0010552) post-insult time to mammary tumor formation (CMO:0000345) 5 99216724 148607142 Rat
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
Ensembl Acc Id:
ENSRNOT00000062177
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 5 123,776,534 - 123,776,609 (+) Ensembl Rnor_6.0 Ensembl 5 128,651,867 - 128,651,942 (+) Ensembl
RefSeq Acc Id:
NR_032765
RefSeq Status:
PROVISIONAL
Type:
NON-CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 5 129,005,205 - 129,005,280 (+) NCBI mRatBN7.2 5 123,776,534 - 123,776,609 (+) NCBI Rnor_6.0 5 128,651,867 - 128,651,942 (+) NCBI Rnor_5.0 5 132,492,895 - 132,492,970 (+) NCBI Celera 5 122,507,589 - 122,507,664 (+) NCBI
Sequence:
TGGCAAGTGGAGGAGCAGCAGGGTGAAACTGACACAGTTCTGGTGAGTTTCACTTTGCTGCTCCTCCTGATTCCCA
hide sequence
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2015-04-09
Mir761
microRNA 761
Mir761
microRNA mir-761
Name updated
61478 APPROVED
2010-06-02
Mir761
microRNA mir-761
Symbol and Name status set to provisional
70820 PROVISIONAL
