Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Behavioral & Substance Use Disorder Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)
Genes search result for All species
(View Results for all Objects and Ontologies)

90 records found for search term shr
Refine Term:
Sort By:
           Export CSV TAB Print

RGD IDSymbolNameDescriptionChrStartStopSpeciesAnnotationsMatchType
1332440Shroom1shroom family member 1Enables actin filament binding activity and myosin II binding activity. Involved in actin filament bundle assembly and cell morphogenesis. Predicted to be located in cytoplasm and microtubule. Predicted to be active in several cellular components, including adherens junction; apical junction complex115334790453358593Mouse80symbol , PhenoGen , name , description , old_gene_symbolgene, protein-coding, VALIDATED [RefSeq]
1614985Shroom2shroom family member 2Enables actin filament binding activity; beta-catenin binding activity; and protein domain specific binding activity. Involved in cell migration and melanosome organization. Acts upstream of or within cell-cell junction maintenance and negative regulation of actin filament depolymerization. Located X151392505151553784Mouse133symbol , PhenoGen , name , description , old_gene_symbolgene, protein-coding, VALIDATED [RefSeq]
1557949Shroom3shroom family member 3Enables actin binding activity. Acts upstream of or within several processes, including columnar/cuboidal epithelial cell development; neural tube closure; and regulation of cell shape. Located in several cellular components, including adherens junction; apical junction complex; and apical plasma me59283129493113618Mouse155symbol , PhenoGen , name , description , old_gene_symbolgene, protein-coding, VALIDATED [RefSeq]
1620640Shroom4shroom family member 4Enables actin filament binding activity and myosin II binding activity. Acts upstream of or within actin filament organization. Located in several cellular components, including apical plasma membrane; basal plasma membrane; and stress fiber. Colocalizes with cortical actin cytoskeleton. Is expresseX63120126549508Mouse93symbol , PhenoGen , name , description , old_gene_symbolgene, protein-coding, VALIDATED [RefSeq]
2592Fabp6fatty acid binding protein 6ENCODES a protein that exhibits fatty acid binding; INVOLVED IN steroid metabolic process; PARTICIPATES IN eicosanoid signaling pathway via peroxisome proliferator-activated receptor gamma; FOUND IN cytoplasm (inferred); membrane (inferred); INTERACTS WITH 1,1,1-trichloro-2,2-bis(4-hydroxyphenyl)eth102856505428569727Rat94old_gene_namegene, protein-coding, PROVISIONAL [RefSeq]
14371180shrbFlysymbolgene, null
14388459ShroomFlysymbolgene, null
1308066Shroom1shroom family member 1ENCODES a protein that exhibits actin filament binding (ortholog); myosin II binding (ortholog); INVOLVED IN actin filament bundle assembly (ortholog); cell morphogenesis (ortholog); ASSOCIATED WITH COVID-19 (ortholog); FOUND IN cytoskeleton (inferred); microtubule (inferred); INTERACTS WITH 17beta-103812197138134832Rat85symbol , PhenoGen , namegene, protein-coding, MODEL [RefSeq]
1605292SHROOM1shroom family member 1SHROOM family members play diverse roles in the development of the nervous system and other tissues (Hagens et al., 2006 [PubMed 16615870]).[supplied by OMIM, Mar 2008]5132822141132830647Human85symbol , COSMIC , name , description , Human Proteome Mapgene, protein-coding, VALIDATED [RefSeq]
8804283Shroom1shroom family member 1ENCODES a protein that exhibits actin filament binding (ortholog); myosin II binding (ortholog); INVOLVED IN actin filament bundle assembly (ortholog); cell morphogenesis (ortholog); ASSOCIATED WITH COVID-19 (ortholog)NW_00495540841942964218616Chinchilla5symbol , namegene, protein-coding, MODEL [RefSeq]
11824533SHROOM1shroom family member 1ENCODES a protein that exhibits actin filament binding (inferred); myosin II binding (inferred); INVOLVED IN actin filament bundle assembly (inferred); actin filament organization (inferred); cell morphogenesis (inferred); ASSOCIATED WITH COVID-19 (ortholog); FOUND IN adherens junction (inferred); a5128239510128248978Bonobo15symbol , namegene, protein-coding, MODEL [RefSeq]
12060975SHROOM1shroom family member 1ENCODES a protein that exhibits myosin II binding (ortholog); ASSOCIATED WITH COVID-19 (ortholog); FOUND IN cytoskeleton (inferred); microtubule (inferred)112111510321120934Dog14symbol , old_gene_name , namegene, protein-coding, MODEL [RefSeq]
12576585Shroom1shroom family member 1ENCODES a protein that exhibits actin binding (inferred); actin filament binding (inferred); myosin II binding (inferred); INVOLVED IN actin filament bundle assembly (inferred); actin filament organization (inferred); cell morphogenesis (inferred); ASSOCIATED WITH COVID-19 (ortholog); FOUND IN adherNW_00493664723716732385037Squirrel18symbol , old_gene_name , namegene, protein-coding, MODEL [RefSeq]
13885378SHROOM1shroom family member 1ENCODES a protein that exhibits actin binding (inferred); actin filament binding (inferred); myosin II binding (inferred); INVOLVED IN actin filament bundle assembly (inferred); cell morphogenesis (inferred); ASSOCIATED WITH COVID-19 (ortholog); FOUND IN cytoskeleton (inferred); microtubule (inferrePig18symbol , namegene, protein-coding, MODEL [RefSeq]
18717212SHROOM1shroom family member 1ENCODES a protein that exhibits actin binding (inferred); actin filament binding (inferred); myosin II binding (inferred); INVOLVED IN actin filament bundle assembly (inferred); actin filament organization (inferred); cell morphogenesis (inferred); ASSOCIATED WITH COVID-19 (ortholog); FOUND IN adherGreen Monkey18symbol , old_gene_name , namegene, protein-coding, MODEL [RefSeq]
18931736Shroom1shroom family member 1ENCODES a protein that exhibits myosin II binding (ortholog); INVOLVED IN actin filament bundle assembly (inferred); actin filament organization (inferred); cell morphogenesis (inferred); ASSOCIATED WITH COVID-19 (ortholog); FOUND IN adherens junction (inferred); apical junction complex (inferred); Naked Mole-Rat15symbol , old_gene_name , namegene, protein-coding, MODEL [RefSeq]
155250844shroom1Tropical Clawed Frogsymbolgene, null
625900258Shroom1shroom family member 1ENCODES a protein that exhibits actin filament binding (ortholog); myosin II binding (ortholog); INVOLVED IN actin filament bundle assembly (ortholog); cell morphogenesis (ortholog); ASSOCIATED WITH COVID-19 (ortholog)Black Rat5symbol , old_gene_name , namegene, protein-coding, MODEL [RefSeq]
1343092SHROOM2shroom family member 2This gene represents the human homolog of Xenopus laevis apical protein (APX) gene, which is implicated in amiloride-sensitive sodium channel activity. It is expressed in endothelial cells and facilitates the formation of a contractile network within endothelial cells. Depletion of this gene resultsX97864299949443Human131symbol , COSMIC , name , Human Proteome Mapgene, protein-coding, REVIEWED [RefSeq]
1565163Shroom2shroom family member 2ENCODES a protein that exhibits actin binding (ortholog); actin filament binding (ortholog); beta-catenin binding (ortholog); INVOLVED IN actin filament bundle assembly (ortholog); cell migration (ortholog); cell morphogenesis (ortholog); ASSOCIATED WITH Meniere's disease (ortholog); FOUND IN adhereX2530816325480194Rat127symbol , PhenoGen , namegene, protein-coding, VALIDATED [RefSeq]
8751490Shroom2shroom family member 2ENCODES a protein that exhibits actin binding (ortholog); actin filament binding (ortholog); beta-catenin binding (ortholog); INVOLVED IN actin filament bundle assembly (ortholog); cell migration (ortholog); cell morphogenesis (ortholog); ASSOCIATED WITH Meniere's disease (ortholog); FOUND IN adhereNW_00495549980319618103307Chinchilla26symbol , namegene, protein-coding, MODEL [RefSeq]
11860217SHROOM2shroom family member 2ENCODES a protein that exhibits beta-catenin binding (ortholog); protein domain specific binding (ortholog); INVOLVED IN actin filament bundle assembly (ortholog); cell migration (ortholog); cell morphogenesis (ortholog); ASSOCIATED WITH Meniere's disease (ortholog); FOUND IN bicellular tight junctiX24188832580853Bonobo30symbol , namegene, protein-coding, MODEL [RefSeq]
12200608SHROOM2shroom family member 2ENCODES a protein that exhibits beta-catenin binding (ortholog); protein domain specific binding (ortholog); INVOLVED IN actin filament bundle assembly (ortholog); cell migration (ortholog); cell morphogenesis (ortholog); ASSOCIATED WITH Meniere's disease (ortholog); FOUND IN adherens junction (orthX64995706642738Dog28symbol , old_gene_name , namegene, protein-coding, MODEL [RefSeq]
13869049SHROOM2shroom family member 2ENCODES a protein that exhibits beta-catenin binding (ortholog); protein domain specific binding (ortholog); INVOLVED IN actin filament bundle assembly (ortholog); cell migration (ortholog); cell morphogenesis (ortholog); ASSOCIATED WITH Meniere's disease (ortholog); FOUND IN adherens junction (orthPig33symbol , old_gene_name , namegene, protein-coding, MODEL [RefSeq]
18628013SHROOM2shroom family member 2ENCODES a protein that exhibits beta-catenin binding (ortholog); protein domain specific binding (ortholog); INVOLVED IN actin filament bundle assembly (ortholog); cell migration (ortholog); cell morphogenesis (ortholog); ASSOCIATED WITH Meniere's disease (ortholog); FOUND IN bicellular tight junctiGreen Monkey30symbol , old_gene_name , namegene, protein-coding, MODEL [RefSeq]
18910264Shroom2shroom family member 2ENCODES a protein that exhibits beta-catenin binding (ortholog); protein domain specific binding (ortholog); INVOLVED IN actin filament bundle assembly (ortholog); cell migration (ortholog); cell morphogenesis (ortholog); ASSOCIATED WITH Meniere's disease (ortholog); FOUND IN bicellular tight junctiNaked Mole-Rat30symbol , old_gene_name , namegene, protein-coding, MODEL [RefSeq]
155243180shroom2Tropical Clawed Frogsymbolgene, null
408408896SHROOM2ENCODES a protein that exhibits actin filament binding (inferred); FOUND IN cytoskeleton (inferred)Dog2symbolgene, protein-coding
625872072Shroom2shroom family member 2ENCODES a protein that exhibits actin binding (ortholog); actin filament binding (ortholog); beta-catenin binding (ortholog); INVOLVED IN actin filament bundle assembly (ortholog); cell migration (ortholog); cell morphogenesis (ortholog); ASSOCIATED WITH Meniere's disease (ortholog); FOUND IN adhereBlack Rat26symbol , old_gene_name , namegene, protein-coding, MODEL [RefSeq]
629128870Shroom2shroom family member 2INVOLVED IN cell morphogenesis (ortholog); ASSOCIATED WITH Meniere's disease (ortholog); FOUND IN cortical actin cytoskeleton (ortholog)Squirrel4symbol , old_gene_name , namegene, protein-coding, MODEL [RefSeq]
1310470Shroom3shroom family member 3ENCODES a protein that exhibits actin binding (ortholog); INVOLVED IN actin cytoskeleton organization (ortholog); columnar/cuboidal epithelial cell development (ortholog); neural tube closure (ortholog); ASSOCIATED WITH tetralogy of Fallot (ortholog); FOUND IN adherens junction (ortholog); apical ju141538376915681158Rat117symbol , old_gene_name , PhenoGen , name , old_gene_symbolgene, protein-coding, PROVISIONAL [RefSeq]
1602873SHROOM3shroom family member 3This gene encodes a PDZ-domain-containing protein that belongs to a family of Shroom-related proteins. This protein may be involved in regulating cell shape in certain tissues. A similar protein in mice is required for proper neurulation. [provided by RefSeq, Ja47643522976783253Human128symbol , old_gene_name , COSMIC , name , description , Human Proteome Map , old_gene_symbolgene, protein-coding, REVIEWED [RefSeq]
8961022Shroom3shroom family member 3ENCODES a protein that exhibits actin binding (ortholog); INVOLVED IN actin cytoskeleton organization (ortholog); columnar/cuboidal epithelial cell development (ortholog); neural tube closure (ortholog); ASSOCIATED WITH tetralogy of Fallot (ortholog); FOUND IN adherens junction (ortholog); apical juNW_00495543311355891423449Chinchilla13symbol , namegene, protein-coding, MODEL [RefSeq]
11921975SHROOM3shroom family member 3ENCODES a protein that exhibits actin binding (inferred); actin filament binding (inferred); INVOLVED IN actin cytoskeleton organization (ortholog); columnar/cuboidal epithelial cell development (ortholog); neural tube closure (ortholog); ASSOCIATED WITH tetralogy of Fallot (ortholog); FOUND IN apic44742035147767325Bonobo19symbol , namegene, protein-coding, MODEL [RefSeq]
12374907SHROOM3shroom family member 3ENCODES a protein that exhibits actin binding (inferred); actin filament binding (inferred); INVOLVED IN actin cytoskeleton organization (ortholog); columnar/cuboidal epithelial cell development (ortholog); neural tube closure (ortholog); ASSOCIATED WITH tetralogy of Fallot (ortholog); FOUND IN adhe3212185131392014Dog22symbol , old_gene_name , namegene, protein-coding, MODEL [RefSeq]
12597049Shroom3shroom family member 3ENCODES a protein that exhibits actin binding (inferred); actin filament binding (inferred); INVOLVED IN actin cytoskeleton organization (ortholog); columnar/cuboidal epithelial cell development (ortholog); neural tube closure (ortholog); ASSOCIATED WITH tetralogy of Fallot (ortholog); FOUND IN apicNW_004936676533654703549Squirrel20symbol , old_gene_name , namegene, protein-coding, MODEL [RefSeq]
13887862SHROOM3shroom family member 3ENCODES a protein that exhibits actin binding (inferred); actin filament binding (inferred); INVOLVED IN actin cytoskeleton organization (ortholog); columnar/cuboidal epithelial cell development (ortholog); neural tube closure (ortholog); ASSOCIATED WITH tetralogy of Fallot (ortholog); FOUND IN adhePig16symbol , namegene, protein-coding, MODEL [RefSeq]
18617501SHROOM3shroom family member 3ENCODES a protein that exhibits actin binding (inferred); actin filament binding (inferred); INVOLVED IN actin cytoskeleton organization (ortholog); columnar/cuboidal epithelial cell development (ortholog); neural tube closure (ortholog); ASSOCIATED WITH tetralogy of Fallot (ortholog); FOUND IN apicGreen Monkey19symbol , old_gene_name , namegene, protein-coding, MODEL [RefSeq]
18928921Shroom3shroom family member 3ENCODES a protein that exhibits actin binding (inferred); actin filament binding (inferred); INVOLVED IN actin cytoskeleton organization (ortholog); columnar/cuboidal epithelial cell development (ortholog); neural tube closure (ortholog); ASSOCIATED WITH tetralogy of Fallot (ortholog); FOUND IN apicNaked Mole-Rat20symbol , old_gene_name , namegene, protein-coding, MODEL [RefSeq]
155249210shroom3Tropical Clawed Frogsymbolgene, null
625883683Shroom3shroom family member 3ENCODES a protein that exhibits actin binding (ortholog); INVOLVED IN actin cytoskeleton organization (ortholog); columnar/cuboidal epithelial cell development (ortholog); neural tube closure (ortholog); ASSOCIATED WITH tetralogy of Fallot (ortholog); FOUND IN adherens junction (ortholog); apical juBlack Rat13symbol , old_gene_name , namegene, protein-coding, MODEL [RefSeq]
1563434Shroom4shroom family member 4ENCODES a protein that exhibits actin filament binding (ortholog); myosin II binding (ortholog); INVOLVED IN regulation of postsynaptic membrane neurotransmitter receptor levels; actin filament organization (ortholog); brain development (ortholog); ASSOCIATED WITH intellectual disability (ortholog);X1853737118748665Rat93symbol , PhenoGen , namegene, protein-coding, PROVISIONAL [RefSeq]
1606521SHROOM4shroom family member 4This gene encodes a member of the APX/Shroom family, which contain an N-terminal PDZ domain and a C-terminal ASD2 motif. The encoded protein may play a role in cytoskeletal architecture. Mutations in this gene have been linked to the X-linked Stocco dos Santos sX5057553450814194Human113symbol , COSMIC , name , description , Human Proteome Map , old_gene_symbolgene, protein-coding, REVIEWED [RefSeq]
8765133Shroom4shroom family member 4ENCODES a protein that exhibits actin filament binding (ortholog); myosin II binding (ortholog); INVOLVED IN actin filament organization (ortholog); brain development (ortholog); cell morphogenesis (ortholog); ASSOCIATED WITH intellectual disability (ortholog); Stocco Dos Santos type X-linked intellNW_00495554318101252046144Chinchilla21symbol , namegene, protein-coding, MODEL [RefSeq]
11822410SHROOM4shroom family member 4ENCODES a protein that exhibits actin binding (inferred); actin filament binding (inferred); myosin II binding (inferred); INVOLVED IN actin filament organization (ortholog); cell morphogenesis (ortholog); regulation of postsynaptic membrane neurotransmitter receptor levels (ortholog); ASSOCIATED WIX4267396842974947Bonobo30symbol , namegene, protein-coding, MODEL [RefSeq]
12422046SHROOM4shroom family member 4ENCODES a protein that exhibits actin binding (inferred); actin filament binding (inferred); myosin II binding (inferred); INVOLVED IN actin filament organization (ortholog); cell morphogenesis (ortholog); regulation of postsynaptic membrane neurotransmitter receptor levels (ortholog); ASSOCIATED WIX4336692143639525Dog30symbol , old_gene_name , namegene, protein-coding, MODEL [RefSeq]
12726948Shroom4shroom family member 4ENCODES a protein that exhibits actin filament binding (ortholog); myosin II binding (ortholog); INVOLVED IN actin filament organization (ortholog); brain development (ortholog); cell morphogenesis (ortholog); ASSOCIATED WITH intellectual disability (ortholog); Stocco Dos Santos type X-linked intellNW_00493672120687312166537Squirrel21symbol , old_gene_name , namegene, protein-coding, MODEL [RefSeq]
14109377SHROOM4shroom family member 4ENCODES a protein that exhibits actin binding (inferred); actin filament binding (inferred); myosin II binding (inferred); INVOLVED IN actin filament organization (ortholog); cell morphogenesis (ortholog); regulation of postsynaptic membrane neurotransmitter receptor levels (ortholog); ASSOCIATED WIPig30symbol , old_gene_name , namegene, protein-coding, MODEL [RefSeq]
18368088SHROOM4shroom family member 4ENCODES a protein that exhibits actin binding (inferred); actin filament binding (inferred); myosin II binding (inferred); INVOLVED IN actin filament organization (ortholog); cell morphogenesis (ortholog); regulation of postsynaptic membrane neurotransmitter receptor levels (ortholog); ASSOCIATED WIGreen Monkey30symbol , old_gene_name , namegene, protein-coding, MODEL [RefSeq]
18909371Shroom4shroom family member 4ENCODES a protein that exhibits myosin II binding (ortholog); INVOLVED IN actin filament organization (ortholog); brain development (ortholog); cell morphogenesis (ortholog); ASSOCIATED WITH intellectual disability (ortholog); Stocco Dos Santos type X-linked intellectual disability (ortholog); FOUNDNaked Mole-Rat28symbol , old_gene_name , namegene, protein-coding, MODEL [RefSeq]
285447421shroom4Tropical Clawed Frogsymbolgene, null
626149641Shroom4shroom family member 4ENCODES a protein that exhibits actin filament binding (ortholog); myosin II binding (ortholog); INVOLVED IN actin filament organization (ortholog); brain development (ortholog); cell morphogenesis (ortholog); ASSOCIATED WITH intellectual disability (ortholog); Stocco Dos Santos type X-linked intellBlack Rat21symbol , old_gene_name , namegene, protein-coding, MODEL [RefSeq]
155258421shroom1.LAfrican Clawed Frogsymbolgene, null
626184676shroom1.SAfrican Clawed Frogsymbolgene, null
155234941shroom2.LAfrican Clawed Frogsymbolgene, null
626182007shroom2.SAfrican Clawed Frogsymbolgene, null
1351345SHROOM2P1shroom family member 2 pseudogene 1Y1254105812543220Humansymbol , COSMIC , name , Human Proteome Mapgene, pseudo, INFERRED [RefSeq]
155249209shroom3.LAfrican Clawed Frogsymbolgene, null
626174094shroom3.SAfrican Clawed Frogsymbolgene, null
284173989shroom4.LAfrican Clawed Frogsymbolgene, null
21410054SHROOM3-AS1SHROOM3 antisense RNA 147670990676802463Humansymbol , GTEx , COSMIC , name , Human Proteome Mapgene, ncrna, VALIDATED [RefSeq]
629021598SHROOM3-AS2SHROOM3 antisense RNA 2Humansymbol , GTEx , COSMIC , name , Human Proteome Mapgene, ncrna
1315266EXOSC2exosome component 2Predicted to enable RNA binding activity. Involved in RNA catabolic process; RNA processing; and positive regulation of cell growth. Located in cytosol; nucleolus; and nucleoplasm. Part of nuclear exosome (RNase complex). Implicated in short stature, hearing loss, retinitis pigmentosa, and distincti9130693760130704894Human214old_gene_symbolgene, protein-coding, VALIDATED [RefSeq]
10898Mipmajor intrinsic protein of lens fiberEnables water channel activity. A structural constituent of eye lens. Acts upstream of or within lens development in camera-type eye; visual perception; and water transport. Located in plasma membrane. Is expressed in several structures, including eye; femur; and main olfactory bulb. Used to study c10128061679128067681Mouse123old_gene_name , old_gene_symbolgene, protein-coding, VALIDATED [RefSeq]
1624066TtntitinEnables ankyrin binding activity. Involved in heart development; regulation of relaxation of cardiac muscle; and somitogenesis. Acts upstream of or within several processes, including forward locomotion; heart development; and sarcomere organization. Located in M band and Z disc. Is expressed in sev27653432476812901Mouse521old_gene_symbolgene, protein-coding, VALIDATED [RefSeq]
1603390AJAP1adherens junctions associated protein 1Enables beta-catenin binding activity. Involved in negative regulation of cell-matrix adhesion; negative regulation of wound healing; and regulation of polarized epithelial cell differentiation. Located in several cellular components, including adherens junction; basolateral plasma membrane; and cel146546094792534Human86old_gene_name , old_gene_symbolgene, protein-coding, VALIDATED [RefSeq]
12451444LOC101954944protein Shroom2ENCODES a protein that exhibits beta-catenin binding (ortholog); protein domain specific binding (ortholog); INVOLVED IN actin filament bundle assembly (ortholog); cell migration (ortholog); cell morphogenesis (ortholog); FOUND IN bicellular tight junction (ortholog); cell cortex (ortholog); cell-ceNW_00493664442620127481Squirrel27old_gene_name , name , old_gene_symbolgene, protein-coding, MODEL [RefSeq]
14394503Klrb1aem1Mcwikiller cell lectin-like receptor subfamily B, member 1A; CRISPR/Cas9 induced mutant 1, McwiCRISPR/Cas9 system was used to introduce a 5-bp deletion in exon 2 in SHR/NCrl embryos.Ratdescriptiongene, allele
14394505Klrb1aem2Mcwikiller cell lectin-like receptor subfamily B, member 1A; CRISPR/Cas9 induced mutant 2, McwiCRISPR/Cas9 system was used to introduce a 102-bp deletion in exon 2 in SHR/NCrl embryos.Ratdescriptiongene, allele
149735372C3em1Kyocomplement C3; ZFN induced mutant 1, KyoZFN constructs specific for the rat C3 gene were designed to target bases 1803-1841 (NCBI reference sequence: NM_016994) of C3 (target sequence: cagggggcccgagtgggctagtggctgtggacaagggg) by Sigma-Aldrich (Tokyo, Japan). The ZFN systems were injected into the pronucleus of SHRRatdescriptiongene, allele
19259465Camk2n1em1Tjacalcium/calmodulin-dependent protein kinase II inhibitor 1; ZFN induced mutant 1, TjaINVOLVED IN positive regulation of insulin secretion involved in cellular response to glucose stimulus; positive regulation of systemic arterial blood pressure; ASSOCIATED WITH decreased brown adipose tissue mass; decreased epididymal fat pad weight; decreased heart left ventricle weightRat9descriptiongene, allele
127285405Cfbem1Tjacomplement factor B, ZFN induced mutant 1, TjaASSOCIATED WITH decreased brown adipose tissue amount; decreased circulating aldosterone level; decreased circulating cholesterol levelRat13descriptiongene, allele
12791992Gja8m1Cubgap junction protein, alpha 8; mutant 1 CubASSOCIATED WITH abnormal lens capsule morphology; abnormal lens development; abnormal lens epithelium morphology; ASSOCIATED WITH cataract; cataract 1 multiple types; microphthalmiaRat34descriptiongene, allele
10002755Sbf1m1IpcvSET binding factor 1; mutation 1, Institute of Physiology, Czechoslovac Academy of SciencesASSOCIATED WITH arrest of spermiogenesis; azoospermia; decreased testis weightRat4descriptiongene, allele
150340624Zbtb16em1Ipcvzinc finger and BTB domain containing 16; TALEN induced mutant 1, IpcvASSOCIATED WITH cardiac interstitial fibrosis; decreased body weight; decreased circulating cholesterol levelRat10descriptiongene, allele
12910834Zbtb16Lxzinc finger and BTB domain containing 16, Lx mutantASSOCIATED WITH preaxial polydactyly; ASSOCIATED WITH polydactylyRat2descriptiongene, allele
12429847LOC102156087protein Shroom3-like161186912811871492Dognamegene, pseudo, MODEL [RefSeq]
18905146LOC106009480protein Shroom2-likeENCODES a protein that exhibits actin filament binding (inferred); INVOLVED IN actin filament organization (inferred); FOUND IN adherens junction (inferred); apical junction complex (inferred); apical plasma membrane (inferred)Naked Mole-Rat8namegene, protein-coding, MODEL [RefSeq]
625852440LOC116912653protein Shroom3-likeBlack Ratnamegene, protein-coding, MODEL [RefSeq]
40916950LOC119868743protein Shroom2-likeDognamegene, pseudo, MODEL [RefSeq]
40907562LOC119874708protein Shroom3-likeDognamegene, pseudo, MODEL [RefSeq]
40914311LOC119877120protein Shroom3-likeDognamegene, pseudo, MODEL [RefSeq]
40914335LOC119880419protein Shroom3-likeDognamegene, pseudo, MODEL [RefSeq]
329345632LOC129395504protein Shroom2-likeBonobonamegene, pseudo, MODEL [RefSeq]
1590138Ajap1adherens junctions associated protein 1ENCODES a protein that exhibits beta-catenin binding (ortholog); protein domain specific binding (ortholog); protein-containing complex binding (ortholog); INVOLVED IN negative regulation of cell-matrix adhesion (ortholog); negative regulation of wound healing (ortholog); regulation of polarized epi5169190477169302938Rat89old_gene_namegene, protein-coding, PROVISIONAL [RefSeq]
1606338DFFADNA fragmentation factor subunit alphaApoptosis is a cell death process that removes toxic and/or useless cells during mammalian development. The apoptotic process is accompanied by shrinkage and fragmentation of the cells and nuclei and degradation of the chromosomal DNA into nucleosomal units. DNA11045652210472529Human167descriptiongene, protein-coding, REVIEWED [RefSeq]
731033DFFBDNA fragmentation factor subunit betaApoptosis is a cell death process that removes toxic and/or useless cells during mammalian development. The apoptotic process is accompanied by shrinkage and fragmentation of the cells and nuclei and degradation of the chromosomal DNA into nucleosomal units. DNA138574763885429Human161descriptiongene, protein-coding, REVIEWED [RefSeq]
1604485IZUMO1izumo sperm-oocyte fusion 1The sperm-specific protein Izumo, named for a Japanese shrine dedicated to marriage, is essential for sperm-egg plasma membrane binding and fusion (Inoue et al., 2005 [PubMed 15759005]).[supplied by OMIM, Mar 2008]194874085248746909Human63descriptiongene, protein-coding, VALIDATED [RefSeq]
13792814Spp1em2Mcwisecreted phosphoprotein 1; CRISPR/Cas9 induced mutant 2, McwiCRISPR/Cas9 system was used to introduce a mutation in the Spp1 gene of SHRSP/A3NCrl rat embryos. The resulting mutation is a 11-bp deletion in Exon 3 of the Spp1 gene.Ratdescriptiongene, allele
1609478Ajap1adherens junction associated protein 1Enables protein domain specific binding activity. Predicted to be involved in negative regulation of cell-matrix adhesion; negative regulation of wound healing; and regulation of polarized epithelial cell differentiation. Predicted to be located in basolateral plasma membrane and cell surface. Predi4153457678153568313Mouse111old_gene_namegene, protein-coding, VALIDATED [RefSeq]