PMC187450P1 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: PMC187450P1

Symbol: PMC187450P1
Previously known as:
RGD ID: 5501277
Expected Size: 472 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
GRCr8795,485,029 - 95,485,501 (+)Marker Load Pipeline
mRatBN7.2793,595,629 - 93,596,103 (+)MAPPERmRatBN7.2
Rnor_6.07102,588,238 - 102,588,710NCBIRnor6.0
Rnor_5.07103,159,377 - 103,159,849UniSTSRnor5.0
RGSC_v3.4798,955,067 - 98,955,538UniSTSRGSC3.4
Celera790,265,828 - 90,266,293UniSTS
Cytogenetic Map7q33UniSTS
Is Marker For: Genes:   Myc  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CGAGCGTCACTGATAGTAGGG
Reverse Primer GCGACCGCAACATAGGATGGA
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
3130MycMYC proto-oncogene, bHLH transcription factor79548310595488031Rat

Nucleotide Sequences


QTLs in Region (GRCr8)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1300179Kidm5Kidney mass QTL 53.51kidney mass (VT:0002707)left kidney wet weight (CMO:0000083)792388565119280177Rat
1331728Bp214Blood pressure QTL 2142.825arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)782111245123048330Rat
2317035Aia16Adjuvant induced arthritis QTL 162.71joint integrity trait (VT:0010548)right rear ankle joint diameter (CMO:0002150)771103011106126789Rat
1357336Gluco6Glucose level QTL 63.4blood glucose amount (VT:0000188)serum glucose level (CMO:0000543)75170064396700643Rat
1358361Sradr5Stress Responsive Adrenal Weight QTL 55.55adrenal gland mass (VT:0010420)both adrenal glands wet weight (CMO:0000164)731770293110435881Rat
1298525Cm1Cardiac mass QTL 12.7heart mass (VT:0007028)heart wet weight (CMO:0000069)756625161101625161Rat
1357338Stl17Serum triglyceride level QTL 173.23blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)771621154114982716Rat
70159Bp61Blood pressure QTL 610.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)773618702118618702Rat
631687Hcas1Hepatocarcinoma susceptibility QTL 13.90.001liver integrity trait (VT:0010547)liver tumorous lesion volume to total liver volume ratio (CMO:0001082)793302009131686183Rat
61397Bw17Body weight QTL 176.3body mass (VT:0001259)body weight (CMO:0000012)795485047137014596Rat
631504Cm27Cardiac mass QTL 273.45heart left ventricle mass (VT:0007031)heart left ventricle wet weight (CMO:0000071)746307490127866166Rat
634322Bw12Body weight QTL 120body mass (VT:0001259)body weight (CMO:0000012)785043242130043242Rat
70173Niddm19Non-insulin dependent diabetes mellitus QTL 194.330.00005blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)785497398130497398Rat
1549899Stresp8Stress response QTL 84.370.0008stress-related behavior trait (VT:0010451)defensive burying duration (CMO:0001961)792362341137014596Rat
2317052Aia17Adjuvant induced arthritis QTL 172.13joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)783626689128626689Rat
631529Tls2T-lymphoma susceptibility QTL 200.001thymus integrity trait (VT:0010555)percentage of study population developing T-cell lymphomas during a period of time (CMO:0001911)782111382132099989Rat
1300151Bp181Blood pressure QTL 1813.36arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)755498584105834451Rat
1559283Emca4Estrogen-induced mammary cancer QTL 43.7mammary gland integrity trait (VT:0010552)percentage of study population developing mammary tumors during a period of time (CMO:0000948)763889858108889858Rat
1643004Pain2Pain QTL 21mechanical nociception trait (VT:0002734)self mutilation severity score (CMO:0002145)71011291699900612Rat
1300149Cm6Cardiac mass QTL 64.09heart mass (VT:0007028)heart left ventricle weight to body weight ratio (CMO:0000530)71104117804Rat
7411607Foco15Food consumption QTL 150.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)777807807122807807Rat
631201Panci1Pancreas inflammation QTL 100.001pancreas integrity trait (VT:0010560)percentage of study population displaying chronic pancreatitis at a point in time (CMO:0001214)773557047118557047Rat
634336Anxrr17Anxiety related response QTL 173.66locomotor behavior trait (VT:0001392)number of entries into a discrete space in an experimental apparatus (CMO:0000960)71509236116977875Rat
1331768Kidm10Kidney mass QTL 104.62096kidney mass (VT:0002707)left kidney wet weight (CMO:0000083)782111245123048330Rat
61357Bp38Blood pressure QTL 381.60.052arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)740540077123682549Rat
1641908Teswt1Testicular weight QTL 13.28testis mass (VT:1000644)both testes wet weight (CMO:0000175)78211124596700643Rat
2316947Rf58Renal function QTL 587.8kidney glomerulus morphology trait (VT:0005325)index of glomerular damage (CMO:0001135)749682832115766396Rat
10450862Kidm55Kidney mass QTL 554.9kidney mass (VT:0002707)kidney weight (CMO:0000081)772725037117725037Rat
724537Niddm52Non-insulin dependent diabetes mellitus QTL 520.02blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)78211124595485241Rat
1298528Bp169Blood pressure QTL 1690.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)762963207107963207Rat
1331746Kidm9Kidney mass QTL 93.934kidney mass (VT:0002707)right kidney wet weight (CMO:0000082)782111245134948181Rat
1576303Ept7Estrogen-induced pituitary tumorigenesis QTL 73.7pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)763889858108889858Rat
10450856Livw4Liver weight QTL 43.8liver mass (VT:0003402)liver weight (CMO:0000092)772725037117725037Rat
7411654Foco25Food consumption QTL 259.30.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)777807807122807807Rat
2316955Stl24Serum triglyceride level QTL 247.1blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)749682832115766396Rat
10402855Bp379Blood pressure QTL 3790.21arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)778682549123682549Rat
2316952Pur22Proteinuria QTL 225.2urine protein amount (VT:0005160)urine protein level (CMO:0000591)749682832115766396Rat
631540Bw9Body weight QTL 94.5body mass (VT:0001259)body weight (CMO:0000012)771621154119349044Rat
1358891Bp265Blood pressure QTL 2652.21arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)771827901136544683Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 24577 UniSTS