RH94735 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: RH94735

Symbol: RH94735
Previously known as: Adrb2; X17607; 
RGD ID: 5051921
Expected Size: 170 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21855,642,580 - 55,642,750 (+)MAPPERmRatBN7.2
Rnor_6.01857,513,914 - 57,514,083NCBIRnor6.0
Rnor_5.01856,740,112 - 56,740,281UniSTSRnor5.0
RGSC_v3.41858,175,080 - 58,175,249UniSTSRGSC3.4
Celera1853,789,970 - 53,790,139UniSTS
RH 3.4 Map18542.9UniSTS
Cytogenetic Map18q12.1UniSTS
Is Marker For: Genes:   Adrb2  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GGTCTGTCTGTTTGGACGGT
Reverse Primer CCACATTCACAGCAGAAAGGT
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
2060Adrb2adrenoceptor beta 2185564245955644501Rat



QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1331733Bp233Blood pressure QTL 2333.97196arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)182479697779788953Rat
1358358Sradr6Stress Responsive Adrenal Weight QTL 62.49adrenal gland mass (VT:0010420)both adrenal glands wet weight (CMO:0000164)181194429959330563Rat
1331730Scl27Serum cholesterol level QTL 273.826blood HDL cholesterol amount (VT:0000184)serum high density lipoprotein cholesterol level (CMO:0000361)185229287559796643Rat
1331741Bp232Blood pressure QTL 2323.59112arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)182137289383213037Rat
1331742Bp228Blood pressure QTL 2283.88752arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)183135940859796643Rat
1298072Cia26Collagen induced arthritis QTL 263.6joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)185470976983828827Rat
1331736Bp227Blood pressure QTL 2272.791arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)184671876359796643Rat
1300125Rf26Renal function QTL 263.2urine potassium amount (VT:0010539)urine potassium excretion rate (CMO:0000761)185253986365844950Rat
6893683Bw110Body weight QTL 1102.70.002body mass (VT:0001259)body weight (CMO:0000012)184334502283828827Rat
1331727Bp237Blood pressure QTL 2373.053arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)183135940861698465Rat
9589041Epfw12Epididymal fat weight QTL 1217.080.001epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)184664067583828827Rat
8694432Bw165Body weight QTL 1653.810.001body lean mass (VT:0010483)lean tissue morphological measurement (CMO:0002184)184664067583828827Rat
9589816Gluco68Glucose level QTL 687.250.001blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)182979296574792965Rat
1331774Bp226Blood pressure QTL 2264.41065arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)183135940859796643Rat
61360EaeyExperimental allergic encephalomyelitis QTL y3nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis duration (CMO:0001424)184698893960377753Rat
2300177Bmd65Bone mineral density QTL 6519.70.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)182896485373964853Rat
1578667Bss21Bone structure and strength QTL 213.5femur morphology trait (VT:0000559)femoral neck cortical cross-sectional area (CMO:0001702)181179151883218561Rat
2303120Mamtr8Mammary tumor resistance QTL 80.001mammary gland integrity trait (VT:0010552)mammary tumor growth rate (CMO:0000344)183135940883218561Rat
12880368Bw187Body weight QTL 1870.045body mass (VT:0001259)body weight (CMO:0000012)185253976376104388Rat
61367Iddm4Insulin dependent diabetes mellitus QTL 42.330.0074blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)183819245583192455Rat
2293658Bmd23Bone mineral density QTL 237.30.0001femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)185146473363636873Rat
1359020Ppulsi2Prepulse inhibition QTL 22.71prepulse inhibition trait (VT:0003088)acoustic startle response measurement (CMO:0001519)185229287573997283Rat
2299160Iddm35Insulin dependent diabetes mellitus QTL 352.79blood glucose amount (VT:0000188)age at onset/diagnosis of type 1 diabetes mellitus (CMO:0001140)18420794160377792Rat
9590318Scort22Serum corticosterone level QTL 227.640.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)182979296574792965Rat
1331752Bw27Body weight QTL 272.963body mass (VT:0001259)body weight (CMO:0000012)185229287565845095Rat
1578661Bss20Bone structure and strength QTL 203.7femur morphology trait (VT:0000559)femoral neck cross-sectional area (CMO:0001697)181179151883218561Rat
1331754Bp230Blood pressure QTL 2304.61609arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)182979296574792965Rat
12904069Cm123Cardiac mass QTL 1230.001heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)185253976376104388Rat
1331798Bp224Blood pressure QTL 2243.53873arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)183135940859796643Rat
12904070Cm124Cardiac mass QTL 1240.01heart right ventricle mass (VT:0007033)heart right ventricle weight to body weight ratio (CMO:0000914)185253976376104388Rat
2303584Gluco55Glucose level QTL 552blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)184852004483828827Rat
12904071Am18Aortic mass QTL 180.001aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)185253976376104388Rat
61383Bp47Blood pressure QTL 4717.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)183127168160377755Rat
12904067Cm122Cardiac mass QTL 1220.001heart mass (VT:0007028)heart wet weight to body weight ratio (CMO:0002408)185253976376104388Rat
1331806Bp229Blood pressure QTL 2294.36484arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)184671876357867167Rat
2301417Bp319Blood pressure QTL 3190.002arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)185253976376104388Rat
12904073Kidm71Kidney mass QTL 710.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)185253976376104388Rat
1331780Bp238Blood pressure QTL 2383.269arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)184671876359796643Rat
738008Hcar14Hepatocarcinoma resistance QTL 144.3liver integrity trait (VT:0010547)liver nonremodeling tumorous lesion number (CMO:0001462)185146473383218561Rat
1331776Bp225Blood pressure QTL 2252.829arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)183135940859796643Rat
6903359Bp355Blood pressure QTL 3553.6arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)181194454459796478Rat
631518Bw11Body weight QTL 112.8body mass (VT:0001259)body weight (CMO:0000012)183587072380870723Rat
6903345Bp349Blood pressure QTL 3493.9arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)184671893559796478Rat
2313082Bss85Bone structure and strength QTL 850.80.0001long bone metaphysis morphology trait (VT:0000133)tibia midshaft total cross-sectional area (CMO:0001715)181495133759951337Rat
6903347Bp350Blood pressure QTL 3504.4arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)183135953059796478Rat
8694366Abfw8Abdominal fat weight QTL 86.380.001visceral adipose mass (VT:0010063)abdominal fat pad weight to body weight ratio (CMO:0000095)184664067583828827Rat
6903349Bp351Blood pressure QTL 3513.5arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)184671893559796478Rat
631509Sald2Serum aldosterone level QTL 22.9blood aldosterone amount (VT:0005346)serum aldosterone level (CMO:0000487)185253976369140759Rat
2300157Bmd66Bone mineral density QTL 6613.10.0001lumbar vertebra mineral mass (VT:0010511)volumetric bone mineral density (CMO:0001553)182896485373964853Rat
738005Anxrr11Anxiety related response QTL 113.4exploratory behavior trait (VT:0010471)number of entries into a discrete space in an experimental apparatus (CMO:0000960)183003981375039813Rat
6903351Bp352Blood pressure QTL 3523.3arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)184671893559796478Rat
631274Sprol1Serum protein level QTL 15.3blood total protein amount (VT:0005567)serum total protein level (CMO:0000661)183139332077209694Rat
1358193Emca2Estrogen-induced mammary cancer QTL 21.6mammary gland integrity trait (VT:0010552)post-insult time to mammary tumor formation (CMO:0000345)181800759963571040Rat
2293704Bss35Bone structure and strength QTL 354.590.0002femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)182896485373964853Rat
2325839Bp348Blood pressure QTL 3480.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)182557098570570985Rat
1600373Mamtr6Mammary tumor resistance QTL 6mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)181927890183218561Rat
2293708Bss46Bone structure and strength QTL 468.80.0001lumbar vertebra morphology trait (VT:0010494)lumbar vertebra cortical cross-sectional area (CMO:0001690)181179151863636873Rat
8694378Bw157Body weight QTL 1573.590.001body lean mass (VT:0010483)lean tissue morphological measurement (CMO:0002184)182979296574792965Rat
1600375Mcs22Mammary carcinoma susceptibility QTL 223.3mammary gland integrity trait (VT:0010552)mammary tumor growth rate (CMO:0000344)185253976363933058Rat
2303571Bw92Body weight QTL 923body mass (VT:0001259)body weight (CMO:0000012)184852004483828827Rat
1598826Anxrr20Anxiety related response QTL 203.04body movement coordination trait (VT:0005424)number of rearing movements in an experimental apparatus (CMO:0001752)184143297183828827Rat
61429Cia17Collagen induced arthritis QTL 174.6joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)183135940870263868Rat
7411719Strs5Sensitivity to stroke QTL 59.4cerebrum integrity trait (VT:0010549)percentage of study population developing cerebrovascular lesions during a period of time (CMO:0000932)184999995865845095Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 24176 UniSTS