Symbol:
NFE2L2
Name:
NFE2 like bZIP transcription factor 2
RGD ID:
18411184
Description:
ENCODES a protein that exhibits sequence-specific DNA binding (ortholog); transcription coregulator binding (ortholog); INVOLVED IN aflatoxin catabolic process (ortholog); cellular response to angiotensin (ortholog); cellular response to hypoxia (ortholog); PARTICIPATES IN nuclear factor, erythroid 2 like 2 signaling pathway; oxidative stress response pathway; ASSOCIATED WITH Acidoses (ortholog); acute kidney failure (ortholog); Acute Lung Injury (ortholog); FOUND IN cytosol (ortholog); mediator complex (ortholog); nucleus (ortholog)
Type:
protein-coding
RefSeq Status:
MODEL
Previously known as:
nuclear factor erythroid 2-related factor 2; nuclear factor, erythroid 2 like 2
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Latest Assembly:
ChlSab1.1 - Green Monkey 1.1 Assembly
Position:
Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 10 62,789,647 - 62,825,651 (-) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 10 62,790,124 - 62,825,339 (-) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666040 136,640,202 - 136,820,663 (+) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
JBrowse:
View Region in Genome Browser (JBrowse)
Model
NFE2L2 Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 10 62,789,647 - 62,825,651 (-) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 10 62,790,124 - 62,825,339 (-) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666040 136,640,202 - 136,820,663 (+) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
NFE2L2 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 2 177,230,303 - 177,264,727 (-) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 2 177,218,667 - 177,392,756 (-) Ensembl GRCh38 hg38 GRCh38 GRCh37 2 178,095,031 - 178,129,455 (-) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 2 177,803,282 - 177,837,663 (-) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 2 177,920,542 - 177,954,924 NCBI Celera 2 171,697,459 - 171,732,295 (-) NCBI Celera Cytogenetic Map 2 q31.2 NCBI HuRef 2 169,966,324 - 170,001,125 (-) NCBI HuRef CHM1_1 2 178,100,863 - 178,135,685 (-) NCBI CHM1_1 T2T-CHM13v2.0 2 177,712,539 - 177,746,971 (-) NCBI T2T-CHM13v2.0
Nfe2l2 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 2 75,505,860 - 75,535,007 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 2 75,505,857 - 75,534,985 (-) Ensembl GRCm39 Ensembl GRCm38 2 75,675,513 - 75,704,663 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 2 75,675,513 - 75,704,641 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 2 75,513,576 - 75,542,698 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 2 75,476,358 - 75,505,480 (-) NCBI MGSCv36 mm8 Celera 2 77,336,615 - 77,365,680 (-) NCBI Celera Cytogenetic Map 2 C3 NCBI cM Map 2 44.75 NCBI
Nfe2l2 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 3 81,001,529 - 81,031,165 (-) NCBI GRCr8 mRatBN7.2 3 60,594,239 - 60,621,712 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 3 60,594,242 - 60,621,737 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 3 63,968,507 - 63,995,961 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 3 72,552,163 - 72,579,616 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 3 70,318,419 - 70,345,871 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 3 62,497,568 - 62,525,146 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 3 62,497,571 - 62,524,996 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 3 69,041,641 - 69,069,190 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 3 58,366,693 - 58,394,116 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 3 58,263,064 - 58,290,488 (-) NCBI Celera 3 60,095,041 - 60,122,464 (-) NCBI Celera Cytogenetic Map 3 q23 NCBI
Nfe2l2 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955403 19,532,103 - 19,535,944 (+) Ensembl ChiLan1.0 ChiLan1.0 NW_004955403 19,510,122 - 19,536,428 (+) NCBI ChiLan1.0 ChiLan1.0
NFE2L2 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 13 79,896,932 - 80,058,685 (-) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 2B 79,911,905 - 80,073,664 (-) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 2B 64,509,446 - 64,544,600 (-) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 2B 182,214,116 - 182,248,282 (-) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 2B 182,214,116 - 182,248,085 (-) Ensembl panpan1.1 panPan2
NFE2L2 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 36 20,989,205 - 21,087,044 (-) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 36 20,989,360 - 21,012,524 (-) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 36 21,008,912 - 21,151,059 (-) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 36 21,133,291 - 21,275,953 (-) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 36 21,133,296 - 21,276,012 (-) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 36 21,203,925 - 21,237,606 (-) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 36 21,205,089 - 21,302,516 (-) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 36 21,320,865 - 21,418,596 (-) NCBI UU_Cfam_GSD_1.0
Nfe2l2 Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024405303 138,036,230 - 138,177,608 (-) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936509 6,590,630 - 6,620,262 (-) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936509 6,589,967 - 6,621,171 (-) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
NFE2L2 Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 15 82,973,656 - 83,146,183 (-) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 15 82,967,485 - 83,146,185 (-) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 15 92,433,294 - 92,469,024 (-) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
Nfe2l2
.
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
Ensembl Acc Id:
ENSCSAT00000012447 ⟹ ENSCSAP00000010484
Type:
CODING
Position:
Green Monkey Assembly Chr Position (strand) Source ChlSab1.1 Ensembl 10 62,790,124 - 62,825,339 (-) Ensembl
RefSeq Acc Id:
XM_007965441 ⟹ XP_007963632
Type:
CODING
Position:
Green Monkey Assembly Chr Position (strand) Source ChlSab1.1 10 62,789,647 - 62,825,651 (-) NCBI Vero_WHO_p1.0 NW_023666040 136,784,407 - 136,820,663 (+) NCBI
Sequence:
AGGGAGGCGCAGCTCCTACACCAACGCCTTTCCGGGGCTCCGGGTGTGTTTGTTCCAACTGTTTAAACTGTTTCAAAGCGTCCGAACTCCAGCGACCTTCGCAAATAACTCTTTATCTCGCGGGCGAG
hide sequence
RefSeq Acc Id:
XM_007965442 ⟹ XP_007963633
Type:
CODING
Position:
Green Monkey Assembly Chr Position (strand) Source ChlSab1.1 10 62,789,647 - 62,824,822 (-) NCBI Vero_WHO_p1.0 NW_023666040 136,785,788 - 136,820,663 (+) NCBI
Sequence:
TGAGCCCGCGCGCGTGGGCAGTGGTGGGCGAATCCAGCCGCGTCCTCGGTCCCCAGAGCTGGGC
hide sequence
RefSeq Acc Id:
XM_038000639 ⟹ XP_037856567
Type:
CODING
Position:
Green Monkey Assembly Chr Position (strand) Source Vero_WHO_p1.0 NW_023666040 136,640,202 - 136,820,663 (+) NCBI
RefSeq Acc Id:
XM_038000640 ⟹ XP_037856568
Type:
CODING
Position:
Green Monkey Assembly Chr Position (strand) Source Vero_WHO_p1.0 NW_023666040 136,806,686 - 136,820,663 (+) NCBI
RefSeq Acc Id:
XP_007963632 ⟸ XM_007965441
- Peptide Label:
isoform X1
- UniProtKB:
A0A0D9RPE5 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_007963633 ⟸ XM_007965442
- Peptide Label:
isoform X2
Ensembl Acc Id:
ENSCSAP00000010484 ⟸ ENSCSAT00000012447
RefSeq Acc Id:
XP_037856567 ⟸ XM_038000639
- Peptide Label:
isoform X2
RefSeq Acc Id:
XP_037856568 ⟸ XM_038000640
- Peptide Label:
isoform X2
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2021-10-05
NFE2L2
NFE2 like bZIP transcription factor 2
NFE2L2
nuclear factor, erythroid 2 like 2
Symbol and/or name change
5135510 APPROVED
