| 12879431 | Jcl:WI | Wistar rats | This strain is a rat strain originating from the Wistar Institute in Philadelphia (USA). The Wistar Institute was named as a memorial to the famous anatomist Professor Casper Wistar at t he University of Pennsylvania. CLEA Japan, Inc. started the production and supply of this strain after it was introduced from Carworth (UK). | CLEA Japan, Inc | outbred | 1 | origin , name , old_strain_symbol , old_qtl_symbol |
| 11041108 | CV/Iet | | The Laboratory of Reproductive Toxicology at the Institute of Environmental Toxicology has been maintaining a Wistar derived PD strain of rats. In 1986, 1 female and 2 males exhibiting very short and sparse vibrissae were found in a litter of 7 parented by a pd/ pd female and phenotypically normal pd/+ male. In 2008, a male Wistar rat and F56 female were crossed, and obtained heterozygous rats were sib-mated. After that, sib mating between homozygous rats was started. | National BioResource Project for the Rat in Japan | mutant | 1 | origin |
| 13506739 | GK/Jcl | | The Goto-Kakizaki (GK) rat is a non-obese Wistar substrain which develops Type 2 diabetes mellitus early in life. The model was developed by Goto and Kakizaki at Tohoku University, Sendai, Japan in 1975. The GK line was established by repeated inbreeding from Wi star rats selected at the upper limit of normal distribution for glucose tolerance. Repeated selection of rats with tendency to lowest glucose tolerance resulted in clear-cut glucose intolerance after five generations.This strain was introduced from Tohoku University, and CLEA Japan Inc started its production and supply as GK/Jcl. | CLEA Japan, Inc | inbred | 10 | origin |
| 152999023 | SD-Aif1tm(EGFP)Apps/Mmmc | | Applied StemCell, Inc (Milpitas, CA) was contracted to generate the Iba1-EGFP knock-in rat model using
CRISPR/Cas9 technology in the Sprague Dawley rat strain. The donor construct inserted consisted of the
EGFP coding sequence (minus the first ATG), followed by the 22 amino acid sequence of the porc ine
teschovirus-1 2A (P2A) self-cleaving peptide, and then the first exon of the rat Iba1 gene immediately
downstream of the translational start site. Guide RNA with the following sequence: 5'- TACCCTGCAAATCCTTGCTCTGG-3' targeting the Iba1 gene just
downstream of the translational start site were used. | Rat Resource and Research Center | mutant | 1 | origin |
| 2312511 | WF/IcoCrl | Wistar Rats | Furth developed this strain at Roswell Park Memorial Institute, Buffalo, NY, USA in 1945 starting from a commercial colony of Wistar rats. Acquired by Charles River from the MIcrobiological Associates, Bethesda, Maryland, US A. Introduced to Charles River France in 1970. | Charles River Laboratories | inbred | 1 | origin , name |
| 68012 | CAP | | Polish Academy of Sciences, Krakow (Stark et al 1968a). | | inbred | 1 | origin |
| 67936 | WR | | Sykora, Rosice (Stark et al 1968b). No further infromation. | | inbred | 2 | origin |
| 70424 | AGA | | Nakic, Zagreb (Stark et al 1968b). Used for immunological studies. | | inbred | 1 | origin |
| 61009 | AVN | | Unknown. Keil University from O Stark, Charles University, Prague. | | inbred | 1 | origin |
| 329951706 | SD-Adrm1em1Uok | | CRISPR/Cas9-mediated deletion of ATG start site in Exon 2 of Adrm1 gene | Rat Resource and Research Center | mutant | 1 | origin |
| 401900746 | SD-Prl7b1tm1(cre)Soar | | CRISPR/Cas9 system was used to introduce Cre recombinase downstream of the Prl7b1 start site. | Rat Resource and Research Center | mutant | 1 | origin |
| 401900748 | SD-Prl7b1tm1(cre)Soar/Rrrc | | CRISPR/Cas9 system was used to introduce Cre recombinase downstream of the Prl7b1 start site. | Rat Resource and Research Center | mutant | 1 | origin |
| 1598798 | BBDP/WorN | | Diabetes prone BB rats maintained in NIH. Developed from a closed colony of outbred wistar rats which spontaneously developed autoimmune diabetes mellitus at the Bio-Breeding Laboratories, Ontario. University of Massachusetts Medical Center star ght:700;'>started inbreeding these in 1977. In 1983 NIH established a reference colony from this inbred colony. | | inbred | 6 | origin |
| 1598802 | BBDR/WorN | | Diabetes resistant BB rats maintained in NIH. Developed from a closed colony of outbred wistar rats which spontaneously developed autoimmune diabetes mellitus at the Bio-Breeding Laboratories, Ontario. University of Massachusetts Medical Center star -weight:700;'>started inbreeding these in 1977. In 1983 NIH established a reference colony from this inbred colony. These were derived from DP rats in the fifth generation | | inbred | 2 | origin |
| 1598803 | BBNB/WorN | | Developed from a closed colony of outbred wistar rats which spontaneously developed autoimmune diabetes mellitus at the Bio-Breeding Laboratories, Ontario. University of Massachusetts Medical Center started inbreeding these in 1977. In 1983 NIH established a reference colony from this inbred colony. | Rat Resource and Research Center | inbred | 6 | origin |
| 67975 | BDI | | Druckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cros s of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can _not_ be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable , and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain. | | inbred | 1 | origin |
| 67976 | BDII | | Druckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cros s of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can not be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable , and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain. | | inbred | 1 | origin |
| 67977 | BDIII | | Druckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can _not_ be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable , and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain. | | inbred | 1 | origin |
| 67978 | BDIV | | Druckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can _not_ be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable, and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain. | | inbred | 2 | origin |
| 61002 | BDIX | | Druckrey from a cross between BDI and BDVIII with subsequent selection of brother-sister pairs for agouti coat color and dark, pigmented eyes. NB. Druckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar an> stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can _not_ be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable , and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain. | | inbred | 3 | origin |
| 67981 | BDV | | Druckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can _not_ be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable , and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain. | | inbred | 1 | origin |
| 67983 | BDVI | | Druckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can _not_ be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable , and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain. | | inbred | 1 | origin |
| 67984 | BDVII | | Druckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can _not_ be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable , and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain. Low secondary antibody response to polypeptide (T,G)-Pro-Lys (20/20) (Gunther et al 1976) | | inbred | 1 | origin |
| 67986 | BDVIII | | Druckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can _not_ be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable , and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain. | | inbred | 1 | origin |
| 67987 | BDX | | Druckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can _not_ be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable , and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain. | | inbred | 1 | origin |
| 728198 | BHE/N | Bureau of Home Economics | To N in 1979 from Flow Laboratories. Closed colony since then. BHE was started in 1942 by the Agricultural Research Service. USDA from a cross between a black and white hooded strain from Pennsylvania State College and an albino Os- borne-Mendel (also called the Yale strain) strain from Columbia University. | | inbred | 1 | origin |
| 12743623 | BN.F344-ApcPirc | | The phenotype of the BN.F344-ApcPirc congenic shows high resistance to cancer. The heterozygous animals get spontaneous intestinal lesions (small intestinal and colonic)starting at 60 days of age in males. BN animals are highly resistant to tum or development and can live over 2 years. | Rat Resource and Research Center | mutant | 1 | origin |
| 41408337 | DA.F344-Dpp4DPPIV/SvH | | Generation of the congenic strain was started with an initial cross between F344/Crl(Wiga)SvH-Dpp4m females, homozygous for the loss-of-function mutation in the Dpp4 gene on RNO3 and a DA/Ztm wild type male rat. The DP4 deficient
congenic DA strain is maintain ed via brother=sister mating | | mutant | 24 | origin |
| 38599157 | F344-Depdc5em1Kyo+/- | | TALEN mRNAs targeting exon 2 of rat Depdc5 were microinjected into fertilized eggs of Fisher 344 (F344) rats to yield two founder mutant rats named Depdc5em1kyo (c.40_44delins17/p.Gly15*) and Depdc5em2kyo (c.39_55delinsT/p.Lys13fs*8). The genome edited fragment was identified by PCR. A 267 bp band was detected for wildtype, a 279 bp band for Depdc5em1kyo mutant and a 251 bp band for Depdc5em2kyo mutant. Depdc5 mutant homozygous pups were never observed at birth. Deletion of both alleles resulted in in utero lethality started around E14.5. | National Bio Resource Project Rat in Japan | mutant | 6 | origin |
| 38599158 | F344-Depdc5em2Kyo+/- | | TALEN mRNAs targeting exon 2 of rat Depdc5 were microinjected into fertilized eggs of Fisher 344 (F344) rats to yield two founder mutant rats named Depdc5em1kyo (c.40_44delins17/p.Gly15*) and Depdc5em2kyo (c.39_55delinsT/p.Lys13fs*8). The genome edited fragment was identified by PCR. A 267 bp band was detected for wildtype, a 279 bp band for Depdc5em1kyo mutant and a 251 bp band for Depdc5em2kyo mutant. Depdc5 mutant homozygous pups were never observed at birth. Deletion of both alleles resulted in in utero lethality started around E14.5. | National BioResource Project for the Rat in Japan | mutant | 6 | origin |
| 126790472 | F344.Cg-Foxn1rnu-/+/Jcl | | This congenic strain was established as a strain with the genetic background of F344/N onto which a segment from the nude rat containing the Foxn1rnu was transferred. Originally, hairless mutant (rnu) was observed in a colony of outbred hooded rats maintained at the Rowett R esearch Institute in Scotland. Backcrossing started at Central Institute for Experimental Animals in 1979 and thereafter the subline was transported to CLEA Japan, Inc for production and supply of these rats. | CLEA Japan, Inc | congenic | 1 | origin |
| 126790469 | F344.Cg-Foxn1rnu-/-/Jcl | | This congenic strain was established as a strain with the genetic background of F344/N onto which a segment from the nude rat containing the Foxn1rnu was transferred. Originally, hairless mutant (rnu) was observed in a colony of outbred hooded rats maintained at the Rowett R esearch Institute in Scotland. Backcrossing started at Central Institute for Experimental Animals in 1979 and thereafter the subline was transported to CLEA Japan, Inc for production and supply of these rats. | CLEA Japan, Inc | congenic | 1 | origin |
| 2303996 | F344.Cg-Foxn1rnu/Kyo | | This congenic strain was established as a strain with the genetic background of F344/N onto which a segment from the nude rat containing the Foxn1rnu was transferred. Originally, hairless mutant (rnu) was observed in a colony of outbred hooded rats maintained at the Rowett R esearch Institute in Scotland. Backcrossing started at Central Institute for Experimental Animals in 1979 and thereafter the subline was transported to the Institute of Laboratory Animals Graduate School of Medicine, Kyoto University. | National BioResource Project for the Rat in Japan | congenic | 1 | origin |
| 734478 | F344/DuCrl | | This colony was originated by mating F344 rats which were purchased from local breeder(Fischer) by M.R. Curtis, Columbia University Institute for Cancer Research, 1920. Dunning at Columbia inbred to form the strain starting in 1920. Dunning to CRL in 1960 at F68 . Caesarean rederived in 1960. | Charles River Laboratories | inbred | 5 | origin |
| 60984 | GH | | University of Otago Medical School from rats of Wistar origin imported from England in 1930. Selection for high blood pressure started by Smirk in 1955. A number of sublines have been developed. Closely related to strain AS (Heslop and Phelan 1973). | | inbred | 2 | origin |
| 13464268 | GH/Htru | | University of Otago Medical School from rats of Wistar origin imported from England in 1930. Selection for high blood pressure started by Smirk in 1955. A number of sublines have been developed. Closely related to strain AS (Heslop and Phelan 1973). Characteristics Develops hypertension, cardiac hypertrophy and vascular disease (Phelan 1968, Simpson and Phelan 1984, Simpson et al, 1994). | National BioResource Project for the Rat in Japan | inbred | 1 | origin |
| 8548817 | KDP.PVG-RT1a/u/Nyo | | MHC haplotype (RT1.BaDa) of PVG.R23 was transferred onto the genetic background of KDP/Tky strain (RT1.BuDu). This allele has been maintained in heterozygous condition. Backcrossing has started since 2003 and afterwards maintained by sib mating | National BioResource Project for the Rat in Japan | congenic | 1 | origin |
| 2314365 | KFRS2/Kyo | | A male rat "SRR-Do Your Best" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "SRR-Do Your Best" and a female PVG/Seac. | National BioResource Project for the Rat in Japan | mutant | 1 | origin |
| 7800673 | KFRS2/Kyo-/+ | KFRS2-/+ | A male rat "SRR-Do Your Best" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "SRR-Do Your Best" and a female PVG/Seac. | National BioResource Project for the Rat in Japan | mutant | 1 | origin |
| 2314383 | KFRS3A/Kyo | | A male rat "SRR-Rocket Science" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "SRR-Rocket Science" and a female PVG/Seac. Hom ozygous rats for mink were selected for inbreeding. | National BioResource Project for the Rat in Japan | mutant | 1 | origin |
| 7800676 | KFRS3A/Kyo+/+ | | A male rat "SRR-Rocket Science" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "SRR-Rocket Science" and a female PVG/Seac. Hom ozygous rats for mink were selected for inbreeding. | National BioResource Project for the Rat in Japan | mutant | 1 | origin |
| 2314377 | KFRS3B/Kyo | | A male rat "SRR-Rocket Science" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "SRR-Rocket Science" and a female PVG/Seac. Hom ozygous rats for grey mutation were selected for inbreeding. | National BioResource Project for the Rat in Japan | mutant | 1 | origin |
| 2314376 | KFRS4/Kyo | | A male rat "TSR Louis" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "TSR Louis" and a female PVG/Seac. This strain carries t wo mutations, head spot (hs) which causes white spotting on the head, and dumbo (dmbo) which causes abnormal ear morphology (Kuramoto, 2010, RGD:7800655). Ears are set lower on the head, and are larger and rounder. Genetic analyses mapped hs to Chr 15 and dmbo to Chr 14. | National BioResource Project for the Rat in Japan | mutant | 15 | origin |
| 2314381 | KFRS5A/Kyo | | A male rat "SRR Coming Home" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "SRR Coming Home" and a female TM/Kyo. | National BioResource Project for the Rat in Japan | mutant | 6 | origin |
| 2314379 | KFRS6/Kyo | | A male rat "SRR Tustin" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "SRR Tustin" and a female TM/Kyo. | National BioResource Project for the Rat in Japan | mutant | 1 | origin |
| 598092582 | LE-Calcaem4(cre)Daiyi | | Genetic background is Iar:Long-Evans (Institute for Animal Reproduction). Cre and T2A were inserted into the start codon (methionine) of the second exon of the Calca gene using CRISPR/Cas9. | National BioResource Project for the Rat in Japan | mutant | 1 | origin |
| 407431636 | LE-Drd3em3(cre)Davis | | This rat model was generated using CRISPR-Cas9 technology insert a Cre-P2A cassette into the ATG start site of rat Drd3. | Deposited at RRRC. Contact RRRC@missouri.edu for availability. | mutant | | origin |
| 407431637 | LE-Galem2(cre)Davis | | This rat model was generated using CRISPR-Cas9 technology insert a Cre-P2A cassette into the ATG start site of rat Gal. Created by Daniel Davis at University of Missouri. | Deposited at RRRC. Deposited at RRRC. Contact RRRC@missouri.edu for availability. | mutant | | origin |
| 598092583 | LE-Sstem1(cre)Bfdi | | Cre was inserted at the start codon (methionine) of the somatostatin (Sst) gene. The Sst precursor is then expressed using the T2A peptide as a linker. Genetic background is Iar:Long-Evans (Institute for Animal Reproduction). | National BioResource Project for the Rat in Japan | mutant | 1 | origin |
| 2314375 | LE.AR-Ednrbsl/Okkm | | AR rats were found a by Ikadai et al. at Institute for Animal Reproduction in 1973. From 1997, backcross of AR rats onto Long Evans rats has started. After the 9th generation of backcrossing, it has been maintained by sib mating (F10 in May 2008). | National BioResource Project for the Rat in Japan | mutant | 1 | origin |
| 68073 | LETL | | A rat with spontaneous polyurea, polyphagia and polydipsia was found in a colony of outbred Long Evans rats purchased from Charles River in 1982. Selective breeding for diabetes with brother x sister mating was subsequently started at the Tokushima Research Ins titute, Otsuka Pharmaceutical Co., Japan | | inbred | 6 | origin |
| 60999 | LEW | Lewis | Dr. Margaret Lewis from Wistar stock, to Aptekman and Bogden 1954 at F20, to Silvers in 1958 at F31. Subsequently distributed by Silvers. Used as the inbred partner for a number of congenic strains at the major histocompatibility complex (Star t:700;'>Stark and Kren 1969). A substrain with congenital hydrocephalus due to primary aqueductal stenosis has been described by Yamada et al, (1992) | Harlan Sprague Dawley Inc. Indianapolis, United States | inbred | 32 | origin |
| 728191 | LOU/CN | | To N in 1976 from Bazin at F?. In 1970 Bazin and Beckers started breeding LOU rat ancestors from various stocks kept at Universite Catholique de Louvain (probably of Wis- tar origin); from 28 lines bred in parallel, LOU/C was selected for high immunocytoma incid ence and LOU/M for low immunocytoma incidence. (045) | | inbred | 1 | origin |
| 728188 | LOU/MN | | To NIH in 1975 from Bazin. In 1970 Bazin and Beckers started breeding LOU rat ancestors from various stocks kept at Universite Catholique de Louvain (probably of Wis- tar origin); from 28 lines bred in parallel, LOU/M was selected for low immunocytoma incidence and LOU/C for high immunocytoma incidence. | | inbred | 1 | origin |
| 155269102 | McwiWfsmAap:HS | Heterogeneous stock | This HS is maintained and distributed from Dr. Palmer's laboratory at UCSD. The colony from Wake Forest maintained by Dr. Solberg Woods's laboratory was sent to Dr. Palmer's laboratory at University of California San Diego Department of Psychiatry in 2022. The Wake Forest HS rats were derived from N Mcwi:HS at the Medical College of Wisconsin and maintained at Wake Forest Baptist Medical Center starting in 2017. | | outbred | 1 | origin |
| 13673907 | NMcwiWfsm:HS | Heterogeneous stock | These HS rats were derived from NMcwi:HS, used to be maintained by Dr. Solberg Woods at Medical College of Wisconsin and now are maintained at Wake Forest Baptist Medical Center by Dr. Solberg Woods's Laboratory starting in 2017. | | outbred | 1 | origin |
| 61014 | OLETF | Otsuka Long-Evans Tokushima fatty | Developed by Kazuya Kawano, Otsuka Pharmaceutical Co., Tokushima, Japan from Long-Evans outbred stock in 1982. A rat with spontaneous polyurea, polyphagia and polydipsia was found in a colony of outbred Long Evans rats purchased from Charles River in 1982. Selective breeding for diabetes with brothe r x sister mating was subsequently started at the Tokushima Research Institute, Otsuka Pharmaceutical Co., Japan to develop this strain Otsuka Long-Evans Tokushima fatty (OLETF). A deletion of 6847 bases in length in the Cckar gene of the OLETF was identified compared to the wild type gene of the LETO gene sequence' | | inbred | 45 | origin |
| 68118 | PKD | PKD | Outbred Han:SPRD-cy/+ Sprague-Dawley rats from the Zentralinstitut furVersuchstierkunde, Hannover, Germany to Dr. Bettina Kranzlin, Mannheim, Germany. Brother xsister inbreeding started in 1991. | | inbred | 2 | origin |
| 728192 | RCS-rdy-p | | This congenic strain is obtained from pink-eyed, tan-hooded RCS rats. Retinal degeneration starts at about 3 weeks. | NIH Autoimmune Rat Model Repository and Development Center | congenic | 1 | origin |
| 14394487 | SD-Bace1em1Sage+/+ | SD-Bace1em1Sage+/Bace1em1Sage+ | The Bace1 (+/+) rats were generated by crossing SD-Bace1em1Sage. The mutant rats were generated by SAGE Labs using zinc-finger nuclease (ZFN) technology to create a 137-base pair deletion spanning the translation initiation start site in exon 1 of the rat Bace1 gene, corresponding to chr8:48,766,315-48,766,452 (RGSC 5.0/rn5 assembly) | | mutant | 1 | origin |
| 14394486 | SD-Bace1em1Sage+/- | SD-Bace1em1Sage+/Bace1em1Sage- | The Bace1 (+/-) rats were generated by SAGE Labs using zinc-finger nuclease (ZFN) technology to create a 137-base pair deletion spanning the translation initiation start site in exon 1 of the rat Bace1 gene, corresponding to chr8:48,766,315-48,766,452 (RGSC 5.0/ rn5 assembly) | | mutant | 1 | origin |
| 13782146 | SD-Bace1em1Sage-/- | SD-Bace1em1Sage-/Bace1em1Sage- | Bace1 (-/-) rats were generated by SAGE Labs using zinc-finger nuclease (ZFN) technology to create a 137-base pair deletion spanning the translation initiation start site in exon 1 of the rat Bace1 gene, corresponding to chr8:48,766,315-48,766,452 (RGSC 5.0/rn5 assembly) | | mutant | 8 | origin |
| 14394485 | SD-Bace1em1Sage | | The mutant rats were generated by SAGE Labs using zinc-finger nuclease (ZFN) technology to create a 137-base pair deletion spanning the translation initiation start site in exon 1 of the rat Bace1 gene, corresponding to chr8:48,766,315-48,766,452 (RGSC 5.0/rn5 a ssembly) | | mutant | 1 | origin |
| 45073130 | SD-Fmr1em1Mzhe | | The CRISPR/Cas9 system was used to introduce deletions/mutations in exon 4 of the rat Fmr1 gene of outbred Sprague-
Dawley embryos. The resulting mutation is a deletion of five amino acids and a G-A mutation in the Fmr1 gene. This genetic modification results in a frame-shift star ght:700;'>starting from the second Agenet-like 2 domain in the Fmr1 protein. | | mutant | 6 | origin |
| 150429815 | SD-Gnalem1Hpng+/+ | | The homozygous wild type Gnal rats were littermates of SD-Gnalem1Hpng+/- (RGD:150429814) created by CRISPR/Cas9. The heterozygous mutants carried one copy of mutated allele contained a 13- bp deletion in exon1 that corresponded to position 34 to 46 downstream of the translation star nt-weight:700;'>start point ATG of theGnal splicing variant 2 was detected resulting in an early stop at position150 and producing a truncated protein with 50 amino acids . | | mutant | 1 | origin |
| 150429814 | SD-Gnalem1Hpng+/- | | The heterozygousGnal mutant rats were created by CRISPR/Cas9. Guide RNA sequences targeting the first exon of the rat Gnal gene isoform 2 were designed. The mutated allele contained a 13- bp deletion in exon1 that corresponded to
position 34 to 46 downstream of the translation star weight:700;'>start point ATG of the
Gnal splicing variant 2 was detected resulting in an early stop at position
150 and producing a truncated protein with 50 amino acids . | European Mouse Mutant Archive(EMMA) | mutant | 7 | origin |
| 150429817 | SD-Gnalem1Hpng-/- | | Thehomozygous Gnal mutant rats were created by CRISPR/Cas9. Guide RNA sequences targeting the first exon of the rat Gnal gene isoform 2 were designed. The mutated allele contained a 13- bp deletion in exon1 that corresponded to
position 34 to 46 downstream of the translation star eight:700;'>start point ATG of the
Gnal splicing variant 2 was detected resulting in an early stop at position
150 and producing a truncated protein with 50 amino acids. Only 5% of homozygous Gnal knockout mice could survive till maturity | | mutant | 4 | origin |
| 626419677 | SD-Gnalem2Hpng | | Gnal knockout rats were generated by CRISPR/Cas9 technology. Exon1 of rat Gnal splicing variant 2 was targeted, resulting in a deletion of 1 base pair that corresponds to position 44 downstream of the translation start point ATG of the Gnal splicing variant 2. C RISPR technology details: self-synthesized Cas9 mRNA using px 330 vector, applying T7 transcription kit followed by Poly-Adenylation and Capping. No sequencing performed, whether Cas9 has been inserted into the rat genome is unknown. Homozygous:
Approximately 25% body weight reduction; Smaller body size; Hyperactivity; Better rotarod performance than wild-type littermates.Heterozygous:
No body weight change; No body size change; Hypo-activity; Worse rotarod performance than wild-type littermates. | European Mouse Mutant Archive(EMMA) | mutant | 1 | origin |
| 626419679 | SD-Gnalem3Hpng | | Crl:CD(SD)-KO(Gnal*135)44-178Hpng/Hpng rats were generated by CRISPR/Cas9 technology. A deletion of 135 base pairs, corresponding to position 44-178, downstream of the translation initiation start ATG of the Gnal splicing variant 2, results in a deletion mutatio n. CRISPR technology details: self-synthesized Cas9 mRNA using px 330 vector, applying T7 transcription kit followed by Poly-Adenylation and Capping. No sequencing performed, whether Cas9 has been inserted into the rat genome is unknown. | European Mouse Mutant Archive(EMMA) | mutant | 1 | origin |
| 155260367 | SD-Tg(Cyp2e1-CYP2E1*-Cas9)Synbl | | rat strain in which the rat Cyp2e1 gene is humanized by insertion of a human CYP2E1 minigene (CYP2E1*) insert at the native start codon. The insert also included a CRISPR/Cas9 gene drive element to enable super-Mendelian inheritance of the modified allele when c rossed to a rat expressing Cas9 in the germline. ROBUST AND EFFICIENT ACTIVE GENETICS GENE CONVERSION IN THE RAT AND MOUSE Chenyen Lai, Oscar Alvarez, Kristen Read, Don van Fossan,Christopher M Conner, Shannon Xaing-Ru Xu, Dale O. Cowley, Valentino Gantz, David R. Webb, Kurt Jarnagin URL: Doi:10.1101/2022.08.30.505951 URL: Doi:10.1101/2022.08.30.505951
URL: URL: Doi:10.1101/2022.08.30.505951 | Donated to Rat Resource & Research Center | transgenic | 1 | origin |
| 155260363 | SD-Tg(Cyp2e1-CYP2E1*-Cas9)SynblRrrc | | rat strain in which the rat Cyp2e1 gene is humanized by insertion of a human CYP2E1 minigene (CYP2E1*) insert at the native start codon. The insert also included a CRISPR/Cas9 gene drive element to enable super-Mendelian inheritance of the modified allele when c rossed to a rat expressing Cas9 in the germline. ROBUST AND EFFICIENT ACTIVE GENETICS GENE CONVERSION IN THE RAT AND MOUSE Chenyen Lai, Oscar Alvarez, Kristen Read, Don van Fossan,Christopher M Conner, Shannon Xaing-Ru Xu, Dale O. Cowley, Valentino Gantz, David R. Webb, Kurt Jarnagin URL: Doi:10.1101/2022.08.30.505951 URL: Doi:10.1101/2022.08.30.505951
URL: URL: Doi:10.1101/2022.08.30.505951 | RRRC | transgenic | 1 | origin |
| 7245521 | SD-Tg(Th-SNCA*)3Ins | | the transgene overexpressing double-mutated human alpha-synuclein (A53T and A30P) under the control of rat tyrosine hydroxylase (Th)promoter was microinjected into SD ovocytes to generate 3 transgenic rat lines. The MA3 line has pre-symptomatic olfactory deficits (beginning at 6 months of age) and m otor deficits starting at a later age (19 months of age). | Rat Resource and Research Center | transgenic | 1 | origin |
| 616362805 | sNP | Sardinian alcohol-non-preferring rats | The bidirectional breeding program of sP (Sardinian alcohol-preferring rats) and sNP (Sardinian non-alcohol-preferring) was begun in 1981 by Drs Fabio Fadda and Gian Luigi
Gessa, at the University of Cagliari, Italy.Selection of sP
and sNP rats started from a heterogeneous base population
of outbred Wistar rats purchased from Morini, San Polo d’Enza, RE,
Italy). The sP rats have alcohol preference in two-bottle chocice between water and 10% alcohol, while the sNP rats prefer water. | | outbred | 1 | origin |
| 616362803 | sP | Sardinian alcohol-preferring rats | The bidirectional breeding program of sP (Sardinian alcohol-preferring rats) and sNP (Sardinian non-alcohol-preferring) was begun in 1981 by Drs Fabio Fadda and Gian Luigi
Gessa, at the University of Cagliari, Italy.Selection of sP
and sNP rats started from a heterogeneous base population
of outbred Wistar rats purchased from Morini, San Polo d’Enza, RE,
Italy). The sP rats have alcohol preference in two-bottle chocice between water and 10% alcohol, while the sNP rats prefer water. | | outbred | 18 | origin |
| 6903881 | SR/NEisSlc | | 1962: Dr. L. K. Dahl found the mutant rat from SD at NIH; 1989: Moved to Eisai (Eisai Co., Ltd.); 1991: Moved to BMR Institute for breeding; 1994: Started selling by SLC, Shizuoka, Japan | | inbred | 1 | origin |
| 5143994 | SS-Plcd3em7Mcwi | | This strain was produced by injecting ZFNs targeting the sequence GCCCGCGTCATCCGAtagcagCACCAAAAGGCCCGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 142-bp deletion, overlapping the start codon | | mutant | 1 | origin |
| 13800875 | SS-Prltm1(PRL)Mcwi | | CRISPR/Cas9 and plasmid donor containing floxed human prolactin cDNA were used to insert the human cDNA into the start coden of rat prolactin gene | Contact MCW rat distribution at mcwcustomrats@mcw.edu | mutant | 1 | origin |
| 6903879 | SS/NEisSlc | | 1962: Dr. L. K. Dahl found the mutant rat from SD at NIH; 1989: Moved to Eisai (Eisai Co., Ltd.); 1991: Moved to BMR Institute for breeding; 1994: Started selling by SLC, Shizuoka, Japan | | inbred | 1 | origin |
| 1579693 | T2DN/Mcwi | | Generated by crossing GK/Swe with female FHH/EurMcwi. During the F1 studies, the GK/Swe started to die out. In order to preserve the GK strain, single male GK was serially crossed to the ongoing GK-FHH cross. This resulted in rapid fixation of the original GK ge nome except for mitochondrial DNA. In the sixth generation male and female T2DN were intercrossed and strict b x s mating was maintained. | | inbred | 15 | origin |
| 68147 | THE/Utp | Tsukuba high-emotional rat | Wistar albino rats selected for low ambulation in a bright runway out of a dark starting box (high emotionality) (see also TLE). | National BioResource Project for the Rat in Japan | inbred | 1 | origin |
| 68148 | TLE/Utp | Tsukuba low-emotional rat | Wistar albino rats selected for high ambulation in a bright runway out of a dark starting box (low emotionality) (see also THE). | National BioResource Project for the Rat in Japan | inbred | 1 | origin |
| 329845586 | W;WIAR-Izumo1em1Osb | | Izumo1 KO strain was established by CRISPR/Cas9 system using inbred WIAR (RGD:2304222) (SLC, Inc.). sgRNA:GGTGGCTGCAATAAAGACTT, PAM sequence：TGG. A 7-bp deletion（CTTTGGA）after start codon (Met) in exon2 of Izumo1 gene was detected. After establishment of WIAR ba ckground KO rats, this strain was mated with Slc:Wistar (RGD:2314928), hence this mutant is in mix background.Izumo1-deficient male rats are infertile. In female rats, no specific phenotype is observed. | National BioResource Project for the Rat in Japan | mutant | 1 | origin |
| 626168247 | WI-Tg(Avp-CHRM3*-mCherry)Tuch | | A chimeric AVP-hM3Dq-mCherry BAC clone transgene construct was
purified for microinjections. hM3Dq is a modified form of the human M3 muscarinic receptor (hM3; CHRM3*). It can be activated by the inert clozapine metabolite clozapine-N-oxide (CNO), engaging the Gq signaling pathway.The hM3Dq-mCherry sequence from the hM3Dq-mCherry cassette (Plasmid
#44361, Addgene, Cambridge, MA, USA) was used for the transgene. Next, SV40 poly A sequence was framed to the hM3Dq-mCherry sequence. Finally, this
hM3Dq-mCherry-SV40 poly A cassette was introduced into the rat Avp gene in place of the genomic start
codon. Thus, hM3Dq-mCherry should be specifically expressed under the Avp promoter in the transgenic rat
brain. | | transgenic | 1 | origin |
| 7245527 | WKHA/Edh | | derived from a cross between SHR/N and WKY/N starting in 1980; followed by selected brother/sister inbreedings from F2 generation forward, selecting WKHA for highest activity and lowest blood pressure | Rat Resource and Research Center | inbred | 9 | origin |
| 61119 | WKY/NCrlCrlj | | Originated from outbred Wistar of Kyoto University. To NIH from Kyoto University in 1971 and sib mating has started. To Charles River Laboratories, Inc from NIH in 1974 at F11, and to Charles River Japan, Inc. in 1981 at F25 . (May 27, 2010). Used as control strain for the SHR strain. | Charles River Laboratories Japan, National BioResource Project for the Rat in Japan | inbred | 6 | origin |
