AI231426 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: AI231426

Symbol: AI231426
Previously known as:
RGD ID: 5085633
Expected Size: 194 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2772,964,153 - 72,964,347 (+)MAPPERmRatBN7.2
Rnor_6.0780,786,582 - 80,786,775NCBIRnor6.0
Rnor_5.0780,810,542 - 80,810,735UniSTSRnor5.0
RGSC_v3.4777,500,852 - 77,501,045UniSTSRGSC3.4
Celera769,980,288 - 69,980,481UniSTS
RH 3.4 Map7634.3UniSTS
Cytogenetic Map7q31UniSTS
Is Marker For: Genes:   Oxr1  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CCCAGTGTAGCACTTGGATCAC
Reverse Primer CCCAATTGTTACCTGTGTCAGC
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
621857Oxr1oxidation resistance 177252875072965666Rat



QTLs in Region (GRCr8)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1300179Kidm5Kidney mass QTL 53.51kidney mass (VT:0002707)left kidney wet weight (CMO:0000083)743747012135012528Rat
2293667Bss42Bone structure and strength QTL 427.250.0001lumbar vertebra size trait (VT:0010518)lumbar vertebra cross-sectional area (CMO:0001689)74765143992651439Rat
10053722Scort27Serum corticosterone level QTL 272.410.0083blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)74322875088228750Rat
2317035Aia16Adjuvant induced arthritis QTL 162.71joint integrity trait (VT:0010548)right rear ankle joint diameter (CMO:0002150)759238038104238038Rat
1300127Srn1Serum renin concentration QTL 13.87blood renin amount (VT:0003349)plasma renin activity level (CMO:0000116)72940968384928080Rat
2293678Bss24Bone structure and strength QTL 246.710.0001femur morphology trait (VT:0000559)femur cross-sectional area (CMO:0001661)74765143992651439Rat
1358361Sradr5Stress Responsive Adrenal Weight QTL 55.55adrenal gland mass (VT:0010420)both adrenal glands wet weight (CMO:0000164)743747012108555253Rat
1357338Stl17Serum triglyceride level QTL 173.23blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)769736356112729554Rat
631513Scl7Serum cholesterol level QTL 74.1blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)73796056982960569Rat
2293685Bmd21Bone mineral density QTL 214.20.0003femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)74765143992651439Rat
10755453Coatc12Coat color QTL 120coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)73111283276112832Rat
631504Cm27Cardiac mass QTL 273.45heart left ventricle mass (VT:0007031)heart left ventricle wet weight (CMO:0000071)744421311118198041Rat
70173Niddm19Non-insulin dependent diabetes mellitus QTL 194.330.00005blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)764002457135012528Rat
634326Hc3Hypercalciuria QTL 32.1urine calcium amount (VT:0002985)urine calcium excretion rate (CMO:0000763)74278731487787314Rat
2293696Bmd32Bone mineral density QTL 325.10.0001femur strength trait (VT:0010010)femoral neck polar moment of inertia (CMO:0001670)74765143992651439Rat
7411605Foco14Food consumption QTL 1424.10.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)73429328279293282Rat
1300151Bp181Blood pressure QTL 1813.36arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)753612714103945643Rat
1559283Emca4Estrogen-induced mammary cancer QTL 43.7mammary gland integrity trait (VT:0010552)percentage of study population developing mammary tumors during a period of time (CMO:0000948)762004452101773158Rat
1643004Pain2Pain QTL 21mechanical nociception trait (VT:0002734)self mutilation severity score (CMO:0002145)7946224698011544Rat
738030Anxrr8Anxiety related response QTL 84.1exploratory behavior trait (VT:0010471)number of entries into a discrete space in an experimental apparatus (CMO:0000960)74659007091590070Rat
1300149Cm6Cardiac mass QTL 64.09heart mass (VT:0007028)heart left ventricle weight to body weight ratio (CMO:0000530)743747099102228765Rat
631534Lnnr1Liver neoplastic nodule remodeling QTL 13.850.001liver integrity trait (VT:0010547)liver remodeling tumorous lesion number to liver total tumorous lesion number ratio (CMO:0001705)73429328279293282Rat
634336Anxrr17Anxiety related response QTL 173.66locomotor behavior trait (VT:0001392)number of entries into a discrete space in an experimental apparatus (CMO:0000960)7924703115097879Rat
2293707Bss32Bone structure and strength QTL 327.640.0001femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)74765143992651439Rat
61357Bp38Blood pressure QTL 381.60.052arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)741333674119109060Rat
2293644Bmd29Bone mineral density QTL 295.40.0001femur size trait (VT:1000369)femoral neck cross-sectional area (CMO:0001697)74765143992651439Rat
2316947Rf58Renal function QTL 587.8kidney glomerulus morphology trait (VT:0005325)index of glomerular damage (CMO:0001135)768938720113886318Rat
2300178Bmd54Bone mineral density QTL 545.30.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)74765143992651439Rat
1298528Bp169Blood pressure QTL 1690.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)761074194106074194Rat
61428Scl3Serum cholesterol level QTL 33.2blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)74486753389867533Rat
1300132Bp182Blood pressure QTL 1823.49arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)71965431784928080Rat
1576303Ept7Estrogen-induced pituitary tumorigenesis QTL 73.7pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)762004452101773158Rat
2316955Stl24Serum triglyceride level QTL 247.1blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)768938720113886318Rat
10402855Bp379Blood pressure QTL 3790.21arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)72940968374409683Rat
2316952Pur22Proteinuria QTL 225.2urine protein amount (VT:0005160)urine protein level (CMO:0000591)768938720113886318Rat
631540Bw9Body weight QTL 94.5body mass (VT:0001259)body weight (CMO:0000012)769736226117455174Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 117520 UniSTS