RH137690 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: RH137690

Symbol: RH137690
Previously known as: AW523582; 
RGD ID: 5073876
Expected Size: 120 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21830,157,620 - 30,157,740 (+)MAPPERmRatBN7.2
Rnor_6.01831,470,576 - 31,470,695NCBIRnor6.0
Rnor_5.01831,149,168 - 31,149,287UniSTSRnor5.0
Celera1829,798,353 - 29,798,472UniSTS
RH 3.4 Map18429.6UniSTS




#
Reference Title
Reference Citation
1. UniSTS Pipeline RGD automated pipelines


 
Forward Primer ACCTAGTTTCATCAGCTTGCCG
Reverse Primer CTTGGTGGTCATAGTTGTCCCA
 
GenBank Nucleotide CH473974 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000248 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


1 to 10 of 41 rows
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD ID
Symbol
Name
LOD
P Value
Trait
Sub Trait
Chr
Start
Stop
Species
1331733Bp233Blood pressure QTL 2333.97196arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)182479697779788953Rat
1358358Sradr6Stress Responsive Adrenal Weight QTL 62.49adrenal gland mass (VT:0010420)both adrenal glands wet weight (CMO:0000164)181194429959330563Rat
1331735Rf44Renal function QTL 442.981urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)181823456431359530Rat
61382Bp46Blood pressure QTL 4618.8arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)181194179131393320Rat
2301413Bp318Blood pressure QTL 3180.002arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)182654808246969551Rat
1331741Bp232Blood pressure QTL 2323.59112arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)182137289383213037Rat
61388Bp2Blood pressure QTL 23.23arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)18135374722Rat
6903359Bp355Blood pressure QTL 3553.6arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)181194454459796478Rat
12904668Bw188Body weight QTL 1880.03body mass (VT:0001259)body weight (CMO:0000012)182654808246969551Rat
2313082Bss85Bone structure and strength QTL 850.80.0001long bone metaphysis morphology trait (VT:0000133)tibia midshaft total cross-sectional area (CMO:0001715)181495133759951337Rat

1 to 10 of 41 rows