Symbol:
Zfp24
Name:
zinc finger protein 24
RGD ID:
727963
Description:
Predicted to enable DNA-binding transcription activator activity, RNA polymerase II-specific; RNA polymerase II cis-regulatory region sequence-specific DNA binding activity; and identical protein binding activity. Predicted to be involved in myelination; negative regulation of DNA-templated transcription; and positive regulation of transcription by RNA polymerase II. Predicted to be located in nucleoplasm. Orthologous to human ZNF24 (zinc finger protein 24); INTERACTS WITH 2,4-dinitrotoluene; 3,4-methylenedioxymethamphetamine; acrylamide.
Type:
protein-coding
RefSeq Status:
PROVISIONAL
Previously known as:
zfp-191; Zfp191; zinc finger protein 191; Znf24
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 18 15,573,031 - 15,583,432 (-) NCBI GRCr8 mRatBN7.2 18 15,295,687 - 15,307,319 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 18 15,298,290 - 15,306,799 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 18 15,485,141 - 15,492,250 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 18 16,267,846 - 16,274,955 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 18 15,557,596 - 15,564,706 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 18 15,910,175 - 15,921,757 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 18 15,914,399 - 15,921,734 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 18 15,675,784 - 15,687,354 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 18 15,782,909 - 15,790,125 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 18 15,809,563 - 15,816,771 (-) NCBI Celera 18 15,248,039 - 15,255,255 (-) NCBI Celera Cytogenetic Map 18 p12 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Zfp24 Rat (1->4)-beta-D-glucan multiple interactions ISO Zfp24 (Mus musculus) 6480464 [perfluorooctane sulfonic acid co-treated with Cellulose] results in decreased expression of ZFP24 mRNA CTD PMID:36331819 Zfp24 Rat 1,2-dimethylhydrazine affects expression ISO Zfp24 (Mus musculus) 6480464 1 and 2-Dimethylhydrazine affects the expression of ZFP24 mRNA CTD PMID:22206623 Zfp24 Rat 2,2',4,4'-Tetrabromodiphenyl ether increases expression ISO ZNF24 (Homo sapiens) 6480464 2 more ... CTD PMID:19095052 Zfp24 Rat 2,3,7,8-tetrachlorodibenzodioxine decreases expression ISO Zfp24 (Mus musculus) 6480464 Tetrachlorodibenzodioxin results in decreased expression of ZFP24 mRNA CTD PMID:24058054 Zfp24 Rat 2,3,7,8-tetrachlorodibenzodioxine affects expression ISO Zfp24 (Mus musculus) 6480464 Tetrachlorodibenzodioxin affects the expression of ZFP24 mRNA CTD PMID:21570461 Zfp24 Rat 2,3,7,8-tetrachlorodibenzodioxine increases expression ISO Zfp24 (Mus musculus) 6480464 Tetrachlorodibenzodioxin results in increased expression of ZFP24 mRNA CTD PMID:19465110 Zfp24 Rat 2,4-dinitrotoluene affects expression EXP 6480464 2 and 4-dinitrotoluene affects the expression of ZFP24 mRNA CTD PMID:21346803 Zfp24 Rat 2-hydroxypropanoic acid decreases expression ISO ZNF24 (Homo sapiens) 6480464 Lactic Acid results in decreased expression of ZNF24 mRNA CTD PMID:30851411 Zfp24 Rat 3,4-methylenedioxymethamphetamine decreases expression ISO Zfp24 (Mus musculus) 6480464 N-Methyl-3 and 4-methylenedioxyamphetamine results in decreased expression of ZFP24 mRNA CTD PMID:26251327 Zfp24 Rat 3,4-methylenedioxymethamphetamine decreases expression EXP 6480464 N-Methyl-3 and 4-methylenedioxyamphetamine results in decreased expression of ZFP24 mRNA CTD PMID:30071829 Zfp24 Rat acrolein multiple interactions ISO ZNF24 (Homo sapiens) 6480464 [Acrolein co-treated with methacrylaldehyde co-treated with alpha-pinene co-treated with Ozone] results in increased oxidation of ZNF24 mRNA and [Air Pollutants results in increased abundance of [Acrolein co-treated with methacrylaldehyde co-treated with alpha-pinene co-treated with Ozone]] which results in increased oxidation of ZNF24 mRNA CTD PMID:32699268 Zfp24 Rat acrylamide increases expression EXP 6480464 Acrylamide results in increased expression of ZFP24 mRNA CTD PMID:15749267 Zfp24 Rat aflatoxin B1 decreases methylation ISO ZNF24 (Homo sapiens) 6480464 Aflatoxin B1 results in decreased methylation of ZNF24 gene CTD PMID:27153756 Zfp24 Rat alpha-pinene multiple interactions ISO ZNF24 (Homo sapiens) 6480464 [Acrolein co-treated with methacrylaldehyde co-treated with alpha-pinene co-treated with Ozone] results in increased oxidation of ZNF24 mRNA and [Air Pollutants results in increased abundance of [Acrolein co-treated with methacrylaldehyde co-treated with alpha-pinene co-treated with Ozone]] which results in increased oxidation of ZNF24 mRNA CTD PMID:32699268 Zfp24 Rat antirheumatic drug increases expression ISO ZNF24 (Homo sapiens) 6480464 Antirheumatic Agents results in increased expression of ZNF24 mRNA CTD PMID:24449571 Zfp24 Rat arsane multiple interactions ISO ZNF24 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in increased expression of ZNF24 mRNA and [sodium arsenite results in increased abundance of Arsenic] which results in increased expression of ZNF24 mRNA CTD PMID:39836092 Zfp24 Rat arsenic atom multiple interactions ISO ZNF24 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in increased expression of ZNF24 mRNA and [sodium arsenite results in increased abundance of Arsenic] which results in increased expression of ZNF24 mRNA CTD PMID:39836092 Zfp24 Rat benzo[a]pyrene affects methylation ISO ZNF24 (Homo sapiens) 6480464 Benzo(a)pyrene affects the methylation of ZNF24 promoter CTD PMID:27901495 Zfp24 Rat benzo[a]pyrene diol epoxide I increases expression ISO ZNF24 (Homo sapiens) 6480464 7 more ... CTD PMID:19150397 Zfp24 Rat benzo[a]pyrene diol epoxide I decreases expression ISO ZNF24 (Homo sapiens) 6480464 7 more ... CTD PMID:20018196 Zfp24 Rat beta-lapachone increases expression ISO ZNF24 (Homo sapiens) 6480464 beta-lapachone results in increased expression of ZNF24 mRNA CTD PMID:38218311 Zfp24 Rat bisphenol A increases expression EXP 6480464 bisphenol A results in increased expression of ZNF24 mRNA CTD PMID:25181051 Zfp24 Rat bisphenol A decreases expression EXP 6480464 bisphenol A results in decreased expression of ZFP24 mRNA CTD PMID:34947998 Zfp24 Rat bisphenol A affects methylation ISO Zfp24 (Mus musculus) 6480464 bisphenol A affects the methylation of ZFP24 promoter CTD PMID:27334623 Zfp24 Rat bisphenol A decreases methylation EXP 6480464 bisphenol A results in decreased methylation of ZFP24 gene CTD PMID:28505145 Zfp24 Rat cadmium atom multiple interactions ISO ZNF24 (Homo sapiens) 6480464 [Cadmium Chloride results in increased abundance of Cadmium] which results in increased expression of ZNF24 mRNA CTD PMID:35301059 Zfp24 Rat cadmium dichloride multiple interactions ISO ZNF24 (Homo sapiens) 6480464 [Cadmium Chloride results in increased abundance of Cadmium] which results in increased expression of ZNF24 mRNA CTD PMID:35301059 Zfp24 Rat caffeine increases phosphorylation ISO ZNF24 (Homo sapiens) 6480464 Caffeine results in increased phosphorylation of ZNF24 protein CTD PMID:35688186 Zfp24 Rat cyclophosphamide increases expression EXP 6480464 Cyclophosphamide results in increased expression of ZFP24 mRNA CTD PMID:27281708 Zfp24 Rat cyclosporin A decreases expression ISO Zfp24 (Mus musculus) 6480464 Cyclosporine results in decreased expression of ZFP24 mRNA CTD PMID:19770486 Zfp24 Rat dicrotophos decreases expression ISO ZNF24 (Homo sapiens) 6480464 dicrotophos results in decreased expression of ZNF24 mRNA CTD PMID:28302478 Zfp24 Rat doxorubicin decreases expression ISO ZNF24 (Homo sapiens) 6480464 Doxorubicin results in decreased expression of ZNF24 mRNA CTD PMID:29803840 Zfp24 Rat ethanol affects expression ISO Zfp24 (Mus musculus) 6480464 Ethanol affects the expression of ZFP24 mRNA CTD PMID:30319688 Zfp24 Rat ethanol affects splicing ISO Zfp24 (Mus musculus) 6480464 Ethanol affects the splicing of ZFP24 mRNA CTD PMID:30319688 Zfp24 Rat FR900359 increases phosphorylation ISO ZNF24 (Homo sapiens) 6480464 FR900359 results in increased phosphorylation of ZNF24 protein CTD PMID:37730182 Zfp24 Rat hydrogen cyanide decreases expression ISO Zfp24 (Mus musculus) 6480464 Hydrogen Cyanide results in decreased expression of ZFP24 mRNA CTD PMID:33914522 Zfp24 Rat hydrogen peroxide multiple interactions ISO ZNF24 (Homo sapiens) 6480464 [Hydrogen Peroxide co-treated with Theophylline] results in decreased expression of ZNF24 protein CTD PMID:18951874 Zfp24 Rat hypochlorous acid increases expression ISO Zfp24 (Mus musculus) 6480464 Hypochlorous Acid results in increased expression of ZFP24 mRNA CTD PMID:19376150 Zfp24 Rat indole-3-methanol affects expression EXP 6480464 indole-3-carbinol affects the expression of ZFP24 mRNA CTD PMID:21396975 Zfp24 Rat lipopolysaccharide increases response to substance ISO Zfp24 (Mus musculus) 6480464 ZFP24 results in increased susceptibility to Lipopolysaccharides CTD PMID:22183946 Zfp24 Rat manganese atom multiple interactions ISO ZNF24 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in increased expression of ZNF24 mRNA and [manganese chloride results in increased abundance of Manganese] which results in increased expression of ZNF24 mRNA CTD PMID:39836092 Zfp24 Rat manganese(0) multiple interactions ISO ZNF24 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in increased expression of ZNF24 mRNA and [manganese chloride results in increased abundance of Manganese] which results in increased expression of ZNF24 mRNA CTD PMID:39836092 Zfp24 Rat manganese(II) chloride multiple interactions ISO ZNF24 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in increased expression of ZNF24 mRNA and [manganese chloride results in increased abundance of Manganese] which results in increased expression of ZNF24 mRNA CTD PMID:39836092 Zfp24 Rat methyl methanesulfonate increases expression ISO ZNF24 (Homo sapiens) 6480464 Methyl Methanesulfonate results in increased expression of ZNF24 mRNA CTD PMID:23649840 Zfp24 Rat methylseleninic acid decreases expression ISO ZNF24 (Homo sapiens) 6480464 methylselenic acid results in decreased expression of ZNF24 mRNA CTD PMID:18548127 Zfp24 Rat miconazole decreases expression ISO Zfp24 (Mus musculus) 6480464 Miconazole results in decreased expression of ZFP24 mRNA CTD PMID:27462272 Zfp24 Rat ozone multiple interactions ISO ZNF24 (Homo sapiens) 6480464 [Acrolein co-treated with methacrylaldehyde co-treated with alpha-pinene co-treated with Ozone] results in increased oxidation of ZNF24 mRNA more ... CTD PMID:32699268 and PMID:35430440 Zfp24 Rat paracetamol affects response to substance ISO ZNF24 (Homo sapiens) 6480464 ZNF24 gene polymorphism affects the susceptibility to Acetaminophen CTD PMID:26104854 Zfp24 Rat perfluorooctane-1-sulfonic acid multiple interactions ISO Zfp24 (Mus musculus) 6480464 [perfluorooctane sulfonic acid co-treated with Cellulose] results in decreased expression of ZFP24 mRNA CTD PMID:36331819 Zfp24 Rat phenobarbital affects expression ISO Zfp24 (Mus musculus) 6480464 Phenobarbital affects the expression of ZFP24 mRNA CTD PMID:23091169 Zfp24 Rat potassium cyanide decreases expression ISO Zfp24 (Mus musculus) 6480464 Potassium Cyanide results in decreased expression of ZFP24 mRNA CTD PMID:33914522 Zfp24 Rat potassium dichromate increases expression ISO Zfp24 (Mus musculus) 6480464 Potassium Dichromate results in increased expression of ZFP24 mRNA CTD PMID:23608068 Zfp24 Rat rac-lactic acid decreases expression ISO ZNF24 (Homo sapiens) 6480464 Lactic Acid results in decreased expression of ZNF24 mRNA CTD PMID:30851411 Zfp24 Rat sodium arsenate increases expression ISO Zfp24 (Mus musculus) 6480464 sodium arsenate results in increased expression of ZFP24 mRNA CTD PMID:21795629 Zfp24 Rat sodium arsenite decreases expression ISO ZNF24 (Homo sapiens) 6480464 sodium arsenite results in decreased expression of ZNF24 mRNA CTD PMID:28595984 Zfp24 Rat sodium arsenite multiple interactions ISO ZNF24 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in increased expression of ZNF24 mRNA and [sodium arsenite results in increased abundance of Arsenic] which results in increased expression of ZNF24 mRNA CTD PMID:39836092 Zfp24 Rat sodium arsenite increases expression ISO ZNF24 (Homo sapiens) 6480464 sodium arsenite results in increased expression of ZNF24 mRNA CTD PMID:38568856 Zfp24 Rat sunitinib decreases expression ISO ZNF24 (Homo sapiens) 6480464 Sunitinib results in decreased expression of ZNF24 mRNA CTD PMID:31533062 Zfp24 Rat theophylline multiple interactions ISO ZNF24 (Homo sapiens) 6480464 [Hydrogen Peroxide co-treated with Theophylline] results in decreased expression of ZNF24 protein CTD PMID:18951874 Zfp24 Rat thioacetamide increases expression EXP 6480464 Thioacetamide results in increased expression of ZFP24 mRNA CTD PMID:34492290 Zfp24 Rat thiram increases expression ISO ZNF24 (Homo sapiens) 6480464 Thiram results in increased expression of ZNF24 mRNA CTD PMID:38568856 Zfp24 Rat titanium dioxide decreases methylation ISO Zfp24 (Mus musculus) 6480464 titanium dioxide results in decreased methylation of ZFP24 gene CTD PMID:35295148 Zfp24 Rat tributylstannane decreases expression EXP 6480464 tributyltin results in decreased expression of ZFP24 mRNA CTD PMID:31129395 Zfp24 Rat trichostatin A affects expression ISO ZNF24 (Homo sapiens) 6480464 trichostatin A affects the expression of ZNF24 mRNA CTD PMID:28542535 Zfp24 Rat triphenyl phosphate affects expression ISO ZNF24 (Homo sapiens) 6480464 triphenyl phosphate affects the expression of ZNF24 mRNA CTD PMID:37042841 Zfp24 Rat triptonide increases expression ISO Zfp24 (Mus musculus) 6480464 triptonide results in increased expression of ZFP24 mRNA CTD PMID:33045310 Zfp24 Rat urethane decreases expression ISO ZNF24 (Homo sapiens) 6480464 Urethane results in decreased expression of ZNF24 mRNA CTD PMID:28818685 Zfp24 Rat valproic acid decreases expression ISO Zfp24 (Mus musculus) 6480464 Valproic Acid analog results in decreased expression of ZFP24 mRNA and Valproic Acid results in decreased expression of ZFP24 mRNA CTD PMID:21427059 Zfp24 Rat valproic acid decreases expression ISO ZNF24 (Homo sapiens) 6480464 Valproic Acid results in decreased expression of ZNF24 mRNA CTD PMID:22083351 more ... Zfp24 Rat valproic acid affects expression ISO ZNF24 (Homo sapiens) 6480464 Valproic Acid affects the expression of ZNF24 mRNA CTD PMID:25979313 Zfp24 Rat venlafaxine hydrochloride increases expression EXP 6480464 Venlafaxine Hydrochloride results in increased expression of ZFP24 mRNA CTD PMID:25423262 Zfp24 Rat zinc atom multiple interactions ISO ZNF24 (Homo sapiens) 6480464 [PCI 5002 co-treated with Zinc] results in increased expression of ZNF24 mRNA CTD PMID:18593933 Zfp24 Rat zinc(0) multiple interactions ISO ZNF24 (Homo sapiens) 6480464 [PCI 5002 co-treated with Zinc] results in increased expression of ZNF24 mRNA CTD PMID:18593933
(1->4)-beta-D-glucan (ISO) 1,2-dimethylhydrazine (ISO) 2,2',4,4'-Tetrabromodiphenyl ether (ISO) 2,3,7,8-tetrachlorodibenzodioxine (ISO) 2,4-dinitrotoluene (EXP) 2-hydroxypropanoic acid (ISO) 3,4-methylenedioxymethamphetamine (EXP,ISO) acrolein (ISO) acrylamide (EXP) aflatoxin B1 (ISO) alpha-pinene (ISO) antirheumatic drug (ISO) arsane (ISO) arsenic atom (ISO) benzo[a]pyrene (ISO) benzo[a]pyrene diol epoxide I (ISO) beta-lapachone (ISO) bisphenol A (EXP,ISO) cadmium atom (ISO) cadmium dichloride (ISO) caffeine (ISO) cyclophosphamide (EXP) cyclosporin A (ISO) dicrotophos (ISO) doxorubicin (ISO) ethanol (ISO) FR900359 (ISO) hydrogen cyanide (ISO) hydrogen peroxide (ISO) hypochlorous acid (ISO) indole-3-methanol (EXP) lipopolysaccharide (ISO) manganese atom (ISO) manganese(0) (ISO) manganese(II) chloride (ISO) methyl methanesulfonate (ISO) methylseleninic acid (ISO) miconazole (ISO) ozone (ISO) paracetamol (ISO) perfluorooctane-1-sulfonic acid (ISO) phenobarbital (ISO) potassium cyanide (ISO) potassium dichromate (ISO) rac-lactic acid (ISO) sodium arsenate (ISO) sodium arsenite (ISO) sunitinib (ISO) theophylline (ISO) thioacetamide (EXP) thiram (ISO) titanium dioxide (ISO) tributylstannane (EXP) trichostatin A (ISO) triphenyl phosphate (ISO) triptonide (ISO) urethane (ISO) valproic acid (ISO) venlafaxine hydrochloride (EXP) zinc atom (ISO) zinc(0) (ISO)
Zfp24 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 18 15,573,031 - 15,583,432 (-) NCBI GRCr8 mRatBN7.2 18 15,295,687 - 15,307,319 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 18 15,298,290 - 15,306,799 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 18 15,485,141 - 15,492,250 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 18 16,267,846 - 16,274,955 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 18 15,557,596 - 15,564,706 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 18 15,910,175 - 15,921,757 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 18 15,914,399 - 15,921,734 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 18 15,675,784 - 15,687,354 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 18 15,782,909 - 15,790,125 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 18 15,809,563 - 15,816,771 (-) NCBI Celera 18 15,248,039 - 15,255,255 (-) NCBI Celera Cytogenetic Map 18 p12 NCBI
ZNF24 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 18 35,332,227 - 35,344,420 (-) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 18 35,332,227 - 35,345,482 (-) Ensembl GRCh38 hg38 GRCh38 GRCh37 18 32,912,191 - 32,924,384 (-) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 18 31,169,957 - 31,178,405 (-) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 18 31,169,956 - 31,178,403 NCBI Celera 18 29,720,074 - 29,732,324 (-) NCBI Celera Cytogenetic Map 18 q12.2 NCBI HuRef 18 29,771,791 - 29,784,041 (-) NCBI HuRef CHM1_1 18 32,839,132 - 32,851,381 (-) NCBI CHM1_1 T2T-CHM13v2.0 18 35,523,566 - 35,535,760 (-) NCBI T2T-CHM13v2.0
Zfp24 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 18 24,142,774 - 24,155,294 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 18 24,142,759 - 24,153,867 (-) Ensembl GRCm39 Ensembl GRCm38 18 24,009,717 - 24,020,813 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 18 24,009,702 - 24,020,810 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 18 24,170,768 - 24,179,272 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 18 24,155,277 - 24,163,781 (-) NCBI MGSCv36 mm8 Celera 18 24,502,320 - 24,510,829 (-) NCBI Celera Cytogenetic Map 18 A2 NCBI cM Map 18 12.55 NCBI
Znf24 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955402 22,067,261 - 22,079,216 (-) Ensembl ChiLan1.0 ChiLan1.0 NW_004955402 22,067,261 - 22,079,216 (-) NCBI ChiLan1.0 ChiLan1.0
ZNF24 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 17 52,721,511 - 52,734,457 (-) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 18 38,414,102 - 38,430,756 (-) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 18 28,551,197 - 28,563,351 (-) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 18 32,139,846 - 32,152,397 (-) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 18 32,144,853 - 32,152,242 (-) Ensembl panpan1.1 panPan2
ZNF24 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 7 54,691,212 - 54,702,249 (+) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 7 54,691,555 - 54,697,183 (+) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 7 54,117,106 - 54,127,901 (+) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 7 54,662,616 - 54,673,411 (+) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 7 54,662,723 - 54,670,299 (+) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 7 54,345,258 - 54,372,911 (+) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 7 54,368,570 - 54,379,364 (+) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 7 54,661,702 - 54,689,042 (+) NCBI UU_Cfam_GSD_1.0
Znf24 Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024404944 50,416,647 - 50,427,741 (+) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936517 9,743,973 - 9,752,449 (+) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936517 9,744,087 - 9,752,346 (+) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
ZNF24 Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 6 119,160,530 - 119,167,187 (-) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 6 119,156,507 - 119,167,240 (-) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 6 111,615,234 - 111,625,806 (-) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
ZNF24 Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 18 45,418,556 - 45,430,743 (+) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 18 45,418,568 - 45,425,743 (+) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666050 19,920,846 - 19,933,200 (+) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Znf24
.
Predicted Target Of
Count of predictions: 53 Count of miRNA genes: 51 Interacting mature miRNAs: 53 Transcripts: ENSRNOT00000022304 Prediction methods: Microtar, Rnahybrid, Targetscan Result types: miRGate_prediction
2301410 Bp317 Blood pressure QTL 317 0.004 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 18 11944273 26548295 Rat 1358358 Sradr6 Stress Responsive Adrenal Weight QTL 6 2.49 adrenal gland mass (VT:0010420) both adrenal glands wet weight (CMO:0000164) 18 11944299 59330563 Rat 61382 Bp46 Blood pressure QTL 46 18.8 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 18 11941791 31393320 Rat 8552968 Pigfal19 Plasma insulin-like growth factor 1 level QTL 19 11.4 blood insulin-like growth factor amount (VT:0010479) plasma insulin-like growth factor 1 level (CMO:0001299) 18 1 25758124 Rat 61388 Bp2 Blood pressure QTL 2 3.23 arterial blood pressure trait (VT:2000000) diastolic blood pressure (CMO:0000005) 18 1 35374722 Rat 1331781 Scl28 Serum cholesterol level QTL 28 3.995 blood HDL cholesterol amount (VT:0000184) serum high density lipoprotein cholesterol level (CMO:0000361) 18 11944299 24797117 Rat 6903359 Bp355 Blood pressure QTL 355 3.6 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 18 11944544 59796478 Rat 2313082 Bss85 Bone structure and strength QTL 85 0.8 0.0001 long bone metaphysis morphology trait (VT:0000133) tibia midshaft total cross-sectional area (CMO:0001715) 18 14951337 59951337 Rat 2312568 Glom21 Glomerulus QTL 21 2 0.005 kidney glomerulus morphology trait (VT:0005325) index of glomerular damage (CMO:0001135) 18 5185858 40503530 Rat 1331766 Bp236 Blood pressure QTL 236 3.022 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 18 11944299 31359530 Rat 631264 Scl22 Serum cholesterol level QTL 22 6.2 blood cholesterol amount (VT:0000180) serum total cholesterol level (CMO:0000363) 18 11941791 31393320 Rat 12904680 Bw189 Body weight QTL 189 0.019 body mass (VT:0001259) body weight (CMO:0000012) 18 11944273 26548295 Rat 2293708 Bss46 Bone structure and strength QTL 46 8.8 0.0001 lumbar vertebra morphology trait (VT:0010494) lumbar vertebra cortical cross-sectional area (CMO:0001690) 18 11791518 63636873 Rat 1641910 Colcr3 Colorectal carcinoma resistance QTL 3 5.02 0.000007 intestine integrity trait (VT:0010554) poorly differentiated malignant colorectal tumor number (CMO:0002076) 18 2249477 22066430 Rat 12904693 Am20 Aortic mass QTL 20 0.001 aorta mass (VT:0002845) aorta weight to aorta length to body weight ratio (CMO:0002722) 18 11944273 26548295 Rat 9589153 Insul31 Insulin level QTL 31 7.15 0.05 blood insulin amount (VT:0001560) plasma insulin level (CMO:0000342) 18 1 42547119 Rat 1578667 Bss21 Bone structure and strength QTL 21 3.5 femur morphology trait (VT:0000559) femoral neck cortical cross-sectional area (CMO:0001702) 18 11791518 83218561 Rat 12904695 Kidm73 Kidney mass QTL 73 0.001 kidney mass (VT:0002707) both kidneys wet weight to body weight ratio (CMO:0000340) 18 11944273 26548295 Rat 2312598 Bp340 Blood pressure QTL 340 0.05 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 18 1 30558703 Rat 12904689 Cm128 Cardiac mass QTL 128 0.001 heart mass (VT:0007028) heart wet weight to body weight ratio (CMO:0002408) 18 11944273 26548295 Rat 12904690 Cm129 Cardiac mass QTL 129 0.001 heart left ventricle mass (VT:0007031) heart left ventricle weight to body weight ratio (CMO:0000530) 18 11944273 26548295 Rat 2300180 Bmd67 Bone mineral density QTL 67 4.8 0.0001 femur mineral mass (VT:0010011) bone mineral density (CMO:0001226) 18 1 34291613 Rat 12904691 Cm130 Cardiac mass QTL 130 0.001 heart right ventricle mass (VT:0007033) heart right ventricle weight to body weight ratio (CMO:0000914) 18 11944273 26548295 Rat 9590248 Scort10 Serum corticosterone level QTL 10 19.71 0.001 blood corticosterone amount (VT:0005345) plasma corticosterone level (CMO:0001173) 18 1 25758124 Rat 2299160 Iddm35 Insulin dependent diabetes mellitus QTL 35 2.79 blood glucose amount (VT:0000188) age at onset/diagnosis of type 1 diabetes mellitus (CMO:0001140) 18 4207941 60377792 Rat 1578661 Bss20 Bone structure and strength QTL 20 3.7 femur morphology trait (VT:0000559) femoral neck cross-sectional area (CMO:0001697) 18 11791518 83218561 Rat 1331753 Bp231 Blood pressure QTL 231 3.643 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 18 11944299 52293055 Rat 2293661 Bss50 Bone structure and strength QTL 50 4.64 0.0003 lumbar vertebra size trait (VT:0010518) lumbar vertebra trabecular cross-sectional area (CMO:0001692) 18 1 34291613 Rat 61375 Bp41 Blood pressure QTL 41 2.4 blood pressure trait (VT:0000183) systolic blood pressure (CMO:0000004) 18 11944299 41122201 Rat
RH130696
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 18 15,299,553 - 15,299,763 (+) MAPPER mRatBN7.2 Rnor_6.0 18 15,914,024 - 15,914,233 NCBI Rnor6.0 Rnor_5.0 18 15,679,633 - 15,679,842 UniSTS Rnor5.0 RGSC_v3.4 18 15,782,468 - 15,782,677 UniSTS RGSC3.4 Celera 18 15,247,598 - 15,247,807 UniSTS RH 3.4 Map 18 173.4 UniSTS Cytogenetic Map 18 p12 UniSTS
RH133099
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 18 15,308,334 - 15,308,554 (+) MAPPER mRatBN7.2 Rnor_6.0 18 15,922,804 - 15,923,023 NCBI Rnor6.0 Rnor_5.0 18 15,688,413 - 15,688,632 UniSTS Rnor5.0 RGSC_v3.4 18 15,791,248 - 15,791,467 UniSTS RGSC3.4 Celera 18 15,256,378 - 15,256,597 UniSTS RH 3.4 Map 18 172.7 UniSTS Cytogenetic Map 18 p12 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
11
49
113
91
90
59
25
59
6
218
97
93
45
60
31
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000022304 ⟹ ENSRNOP00000022304
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 18 15,298,290 - 15,306,799 (-) Ensembl Rnor_6.0 Ensembl 18 15,914,399 - 15,921,734 (-) Ensembl
RefSeq Acc Id:
NM_182955 ⟹ NP_892000
RefSeq Status:
PROVISIONAL
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 18 15,574,745 - 15,581,961 (-) NCBI mRatBN7.2 18 15,299,995 - 15,307,211 (-) NCBI Rnor_6.0 18 15,914,465 - 15,921,681 (-) NCBI Rnor_5.0 18 15,675,784 - 15,687,354 (-) NCBI RGSC_v3.4 18 15,782,909 - 15,790,125 (-) RGD Celera 18 15,248,039 - 15,255,255 (-) RGD
Sequence:
CGAGGCTGTGGCGGGTCCCGAGCCAGAGGTCAGCAGCGCGCGGGGGTAGGGTTCGAGGAGGCGGGGGCTCAGGAGTACTTTTGAGGAAAACAGGGTATTTCTGAGGTCTGTACCTTGCCTCAGTTGCC
hide sequence
RefSeq Acc Id:
XM_006254464 ⟹ XP_006254526
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 18 15,573,031 - 15,583,432 (-) NCBI mRatBN7.2 18 15,295,687 - 15,307,319 (-) NCBI Rnor_6.0 18 15,910,175 - 15,921,756 (-) NCBI Rnor_5.0 18 15,675,784 - 15,687,354 (-) NCBI
Sequence:
CGGACCGGAAGCCGTGCGCGCCGGGGGCTTGTGGGAAGCGGCTGAAAGCGGCGGCGCAGCGTCTGCCCGGGACGACGAGGCTGTGGCGGGTCCCGAGCCAGAGGAGTACTTTTGAGGAAAACAGGGTA
hide sequence
RefSeq Acc Id:
XM_006254465 ⟹ XP_006254527
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 18 15,573,031 - 15,581,835 (-) NCBI mRatBN7.2 18 15,295,687 - 15,307,067 (-) NCBI Rnor_6.0 18 15,910,175 - 15,921,595 (-) NCBI Rnor_5.0 18 15,675,784 - 15,687,354 (-) NCBI
Sequence:
GCCGGCGACGCTCAGCATTCCGGGCGTGCGCATAAAAGGCCGCGGCGGCGGAAGGGCGGCGGCGACCTGCGGCACTTCGGGGGTCCGCAGAGCCTCCAGCGCCCGCATCCTCTCCGGCCTGCTTTCCC
hide sequence
RefSeq Acc Id:
NP_892000 ⟸ NM_182955
- UniProtKB:
Q7TNK3 (UniProtKB/Swiss-Prot), A6J2J7 (UniProtKB/TrEMBL)
- Sequence:
MSAQSVEEDSILIIPNPDEEEKILRVKLEEDPDGEEGSSISWNHLPDPEIFRQRFRQFGYQDSPGPREAVSQLRELCRLWLRPETHTKEQILELVVLEQFVAILPRELQTLVREHHPENGEEAVTVLE
hide sequence
RefSeq Acc Id:
XP_006254526 ⟸ XM_006254464
- Peptide Label:
isoform X1
- UniProtKB:
Q7TNK3 (UniProtKB/Swiss-Prot), A6J2J7 (UniProtKB/TrEMBL)
- Sequence:
MSAQSVEEDSILIIPNPDEEEKILRVKLEEDPDGEEGSSISWNHLPDPEIFRQRFRQFGYQDSPGPREAVSQLRELCRLWLRPETHTKEQILELVVLEQFVAILPRELQTLVREHHPENGEEAVTVLE
hide sequence
RefSeq Acc Id:
XP_006254527 ⟸ XM_006254465
- Peptide Label:
isoform X1
- UniProtKB:
Q7TNK3 (UniProtKB/Swiss-Prot), A6J2J7 (UniProtKB/TrEMBL)
- Sequence:
MSAQSVEEDSILIIPNPDEEEKILRVKLEEDPDGEEGSSISWNHLPDPEIFRQRFRQFGYQDSPGPREAVSQLRELCRLWLRPETHTKEQILELVVLEQFVAILPRELQTLVREHHPENGEEAVTVLE
hide sequence
Ensembl Acc Id:
ENSRNOP00000022304 ⟸ ENSRNOT00000022304
RGD ID: 13700662 Promoter ID: EPDNEW_R11185 Type: initiation region Name: Zfp24_1 Description: zinc finger protein 24 SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Rat Assembly Chr Position (strand) Source Rnor_6.0 18 15,921,726 - 15,921,786 EPDNEW
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2015-10-30
Zfp24
zinc finger protein 24
Zfp191
zinc finger protein 191
Name and Symbol changed
629549 APPROVED
2005-07-08
Zfp191
zinc finger protein 191
Symbol and Name status set to approved
1299863 APPROVED
