Symbol:
Prpsap1
Name:
phosphoribosyl pyrophosphate synthetase-associated protein 1
RGD ID:
620206
Description:
Enables enzyme regulator activity and kinase binding activity. Involved in negative regulation of kinase activity. Part of ribose phosphate diphosphokinase complex. Orthologous to human PRPSAP1 (phosphoribosyl pyrophosphate synthetase associated protein 1); INTERACTS WITH 17alpha-ethynylestradiol; 2,3,7,8-tetrachlorodibenzodioxine; 5-methoxy-2-\{[(4-methoxy-3,5-dimethylpyridin-2-yl)methyl]sulfinyl\}-1H-benzimidazole.
Type:
protein-coding
RefSeq Status:
VALIDATED
Previously known as:
39 kDa phosphoribosypyrophosphate synthase-associated protein; 39 kDa phosphoribosypyrophosphate synthetase-associated protein; PAP39; phosphoribosyl pyrophosphate synthase-associated protein 1; phosphoribosylpyrophosphate synthetase-associated protein (39 kDa); PRPP synthase-associated protein 1; PRPP synthetase-associated protein 1
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 10 102,199,949 - 102,221,642 (-) NCBI GRCr8 mRatBN7.2 10 101,701,094 - 101,750,753 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 10 101,701,096 - 101,750,751 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 10 106,757,499 - 106,779,133 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 10 106,220,577 - 106,242,211 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 10 101,621,981 - 101,643,676 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 10 105,430,516 - 105,492,154 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 10 105,430,520 - 105,452,228 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 10 105,092,063 - 105,113,772 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 10 106,582,381 - 106,604,072 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 10 106,596,897 - 106,618,475 (-) NCBI Celera 10 100,273,440 - 100,295,162 (-) NCBI Celera Cytogenetic Map 10 q32.1 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Prpsap1 Rat 1,2-dichloroethane decreases expression ISO Prpsap1 (Mus musculus) 6480464 ethylene dichloride results in decreased expression of PRPSAP1 mRNA CTD PMID:28960355 Prpsap1 Rat 1,2-dimethylhydrazine decreases expression ISO Prpsap1 (Mus musculus) 6480464 1 and 2-Dimethylhydrazine results in decreased expression of PRPSAP1 mRNA CTD PMID:22206623 Prpsap1 Rat 17alpha-ethynylestradiol increases expression ISO Prpsap1 (Mus musculus) 6480464 Ethinyl Estradiol results in increased expression of PRPSAP1 mRNA CTD PMID:17942748 Prpsap1 Rat 17alpha-ethynylestradiol decreases expression EXP 6480464 Ethinyl Estradiol results in decreased expression of PRPSAP1 mRNA CTD PMID:12655037 Prpsap1 Rat 17alpha-ethynylestradiol multiple interactions ISO Prpsap1 (Mus musculus) 6480464 [Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of PRPSAP1 mRNA CTD PMID:17942748 Prpsap1 Rat 17beta-estradiol increases expression ISO Prpsap1 (Mus musculus) 6480464 Estradiol results in increased expression of PRPSAP1 mRNA CTD PMID:39298647 Prpsap1 Rat 2,2',4,4'-Tetrabromodiphenyl ether increases expression ISO PRPSAP1 (Homo sapiens) 6480464 2 more ... CTD PMID:19095052 Prpsap1 Rat 2,3,7,8-tetrachlorodibenzodioxine multiple interactions ISO Prpsap1 (Mus musculus) 6480464 [Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of PRPSAP1 mRNA CTD PMID:17942748 Prpsap1 Rat 2,3,7,8-tetrachlorodibenzodioxine decreases expression EXP 6480464 Tetrachlorodibenzodioxin results in decreased expression of PRPSAP1 mRNA CTD PMID:34747641 Prpsap1 Rat 2,3,7,8-tetrachlorodibenzodioxine increases expression EXP 6480464 Tetrachlorodibenzodioxin results in increased expression of PRPSAP1 mRNA CTD PMID:18796159 Prpsap1 Rat 3,4-methylenedioxymethamphetamine increases expression ISO Prpsap1 (Mus musculus) 6480464 N-Methyl-3 and 4-methylenedioxyamphetamine results in increased expression of PRPSAP1 mRNA CTD PMID:20188158 Prpsap1 Rat 3-isobutyl-1-methyl-7H-xanthine multiple interactions ISO PRPSAP1 (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol F] results in decreased expression of PRPSAP1 mRNA CTD PMID:28628672 Prpsap1 Rat 4,4'-sulfonyldiphenol increases expression ISO Prpsap1 (Mus musculus) 6480464 bisphenol S results in increased expression of PRPSAP1 mRNA CTD PMID:39298647 Prpsap1 Rat 5-methoxy-2-\{[(4-methoxy-3,5-dimethylpyridin-2-yl)methyl]sulfinyl\}-1H-benzimidazole affects expression EXP 6480464 Omeprazole affects the expression of PRPSAP1 mRNA CTD PMID:19483382 Prpsap1 Rat 6-propyl-2-thiouracil affects expression EXP 6480464 Propylthiouracil affects the expression of PRPSAP1 mRNA CTD PMID:19483382 Prpsap1 Rat acrolein multiple interactions ISO PRPSAP1 (Homo sapiens) 6480464 [Acrolein co-treated with methacrylaldehyde co-treated with alpha-pinene co-treated with Ozone] results in increased oxidation of PRPSAP1 mRNA and [Air Pollutants results in increased abundance of [Acrolein co-treated with methacrylaldehyde co-treated with alpha-pinene co-treated with Ozone]] which results in increased oxidation of PRPSAP1 mRNA CTD PMID:32699268 Prpsap1 Rat aflatoxin B1 decreases expression ISO PRPSAP1 (Homo sapiens) 6480464 Aflatoxin B1 results in decreased expression of PRPSAP1 mRNA CTD PMID:22100608 Prpsap1 Rat alpha-pinene multiple interactions ISO PRPSAP1 (Homo sapiens) 6480464 [Acrolein co-treated with methacrylaldehyde co-treated with alpha-pinene co-treated with Ozone] results in increased oxidation of PRPSAP1 mRNA and [Air Pollutants results in increased abundance of [Acrolein co-treated with methacrylaldehyde co-treated with alpha-pinene co-treated with Ozone]] which results in increased oxidation of PRPSAP1 mRNA CTD PMID:32699268 Prpsap1 Rat amiodarone affects expression EXP 6480464 Amiodarone affects the expression of PRPSAP1 mRNA CTD PMID:19483382 Prpsap1 Rat ammonium chloride affects expression EXP 6480464 Ammonium Chloride affects the expression of PRPSAP1 mRNA CTD PMID:16483693 Prpsap1 Rat antirheumatic drug increases expression ISO PRPSAP1 (Homo sapiens) 6480464 Antirheumatic Agents results in increased expression of PRPSAP1 mRNA CTD PMID:24449571 Prpsap1 Rat apigenin increases expression ISO Prpsap1 (Mus musculus) 6480464 Apigenin results in increased expression of PRPSAP1 mRNA CTD PMID:22359648 Prpsap1 Rat arsenite(3-) multiple interactions ISO PRPSAP1 (Homo sapiens) 6480464 arsenite promotes the reaction [G3BP1 protein binds to PRPSAP1 mRNA] CTD PMID:32406909 Prpsap1 Rat benzbromarone affects expression EXP 6480464 Benzbromarone affects the expression of PRPSAP1 mRNA CTD PMID:19483382 Prpsap1 Rat benzo[a]pyrene increases expression ISO Prpsap1 (Mus musculus) 6480464 Benzo(a)pyrene results in increased expression of PRPSAP1 mRNA CTD PMID:19770486 and PMID:21715664 Prpsap1 Rat benzo[a]pyrene affects methylation ISO PRPSAP1 (Homo sapiens) 6480464 Benzo(a)pyrene affects the methylation of PRPSAP1 promoter CTD PMID:27901495 Prpsap1 Rat beta-lapachone decreases expression ISO PRPSAP1 (Homo sapiens) 6480464 beta-lapachone results in decreased expression of PRPSAP1 mRNA CTD PMID:38218311 Prpsap1 Rat bisphenol A affects expression EXP 6480464 bisphenol A affects the expression of PRPSAP1 mRNA CTD PMID:25181051 Prpsap1 Rat bisphenol A increases expression ISO Prpsap1 (Mus musculus) 6480464 bisphenol A results in increased expression of PRPSAP1 mRNA CTD PMID:33221593 Prpsap1 Rat bisphenol A decreases expression EXP 6480464 bisphenol A results in decreased expression of PRPSAP1 mRNA CTD PMID:34947998 Prpsap1 Rat bisphenol A decreases expression ISO PRPSAP1 (Homo sapiens) 6480464 bisphenol A results in decreased expression of PRPSAP1 protein CTD PMID:33376534 Prpsap1 Rat bisphenol A increases expression EXP 6480464 bisphenol A results in increased expression of PRPSAP1 mRNA CTD PMID:32145629 Prpsap1 Rat bisphenol F multiple interactions ISO PRPSAP1 (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol F] results in decreased expression of PRPSAP1 mRNA CTD PMID:28628672 Prpsap1 Rat cadmium dichloride increases expression ISO PRPSAP1 (Homo sapiens) 6480464 Cadmium Chloride results in increased expression of PRPSAP1 protein CTD PMID:24527689 Prpsap1 Rat cadmium dichloride decreases expression ISO PRPSAP1 (Homo sapiens) 6480464 Cadmium Chloride results in decreased expression of PRPSAP1 mRNA CTD PMID:38568856 Prpsap1 Rat caffeine decreases phosphorylation ISO PRPSAP1 (Homo sapiens) 6480464 Caffeine results in decreased phosphorylation of PRPSAP1 protein CTD PMID:35688186 Prpsap1 Rat carbamazepine affects expression ISO PRPSAP1 (Homo sapiens) 6480464 Carbamazepine affects the expression of PRPSAP1 mRNA CTD PMID:25979313 Prpsap1 Rat chlorpyrifos affects expression ISO Prpsap1 (Mus musculus) 6480464 Chlorpyrifos affects the expression of PRPSAP1 mRNA CTD PMID:37019170 Prpsap1 Rat clofibrate affects expression EXP 6480464 Clofibrate affects the expression of PRPSAP1 mRNA CTD PMID:19483382 Prpsap1 Rat copper(II) sulfate decreases expression ISO PRPSAP1 (Homo sapiens) 6480464 Copper Sulfate results in decreased expression of PRPSAP1 mRNA CTD PMID:19549813 Prpsap1 Rat coumarin affects phosphorylation ISO PRPSAP1 (Homo sapiens) 6480464 coumarin affects the phosphorylation of PRPSAP1 protein CTD PMID:35688186 Prpsap1 Rat cyclosporin A decreases expression ISO PRPSAP1 (Homo sapiens) 6480464 Cyclosporine results in decreased expression of PRPSAP1 mRNA CTD PMID:25562108 and PMID:27989131 Prpsap1 Rat dexamethasone multiple interactions ISO PRPSAP1 (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol F] results in decreased expression of PRPSAP1 mRNA CTD PMID:28628672 Prpsap1 Rat dibutyl phthalate increases expression EXP 6480464 Dibutyl Phthalate results in increased expression of PRPSAP1 mRNA CTD PMID:21266533 Prpsap1 Rat dichloroacetic acid increases expression ISO Prpsap1 (Mus musculus) 6480464 Dichloroacetic Acid results in increased expression of PRPSAP1 mRNA CTD PMID:28962523 Prpsap1 Rat diuron decreases expression EXP 6480464 Diuron results in decreased expression of PRPSAP1 mRNA CTD PMID:21551480 Prpsap1 Rat epoxiconazole decreases expression ISO Prpsap1 (Mus musculus) 6480464 epoxiconazole results in decreased expression of PRPSAP1 mRNA CTD PMID:35436446 Prpsap1 Rat ethanol decreases expression EXP 6480464 Ethanol results in decreased expression of PRPSAP1 protein CTD PMID:19609968 Prpsap1 Rat gallic acid decreases expression ISO PRPSAP1 (Homo sapiens) 6480464 Gallic Acid results in decreased expression of PRPSAP1 mRNA CTD PMID:34408198 Prpsap1 Rat gentamycin decreases expression EXP 6480464 Gentamicins results in decreased expression of PRPSAP1 mRNA CTD PMID:33387578 Prpsap1 Rat hydrogen peroxide affects expression ISO PRPSAP1 (Homo sapiens) 6480464 Hydrogen Peroxide affects the expression of PRPSAP1 mRNA CTD PMID:20044591 Prpsap1 Rat indometacin multiple interactions ISO PRPSAP1 (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol F] results in decreased expression of PRPSAP1 mRNA CTD PMID:28628672 Prpsap1 Rat ivermectin decreases expression ISO PRPSAP1 (Homo sapiens) 6480464 Ivermectin results in decreased expression of PRPSAP1 protein CTD PMID:32959892 Prpsap1 Rat L-ethionine affects expression EXP 6480464 Ethionine affects the expression of PRPSAP1 mRNA CTD PMID:19483382 Prpsap1 Rat leflunomide decreases expression ISO PRPSAP1 (Homo sapiens) 6480464 leflunomide results in decreased expression of PRPSAP1 mRNA CTD PMID:28988120 Prpsap1 Rat methylmercury chloride increases expression ISO PRPSAP1 (Homo sapiens) 6480464 methylmercuric chloride results in increased expression of PRPSAP1 mRNA CTD PMID:28001369 Prpsap1 Rat methylparaben increases expression ISO PRPSAP1 (Homo sapiens) 6480464 methylparaben results in increased expression of PRPSAP1 mRNA CTD PMID:31745603 Prpsap1 Rat mifepristone multiple interactions EXP 6480464 Mifepristone inhibits the reaction [Progesterone results in increased expression of PRPSAP1 mRNA] CTD PMID:10888668 Prpsap1 Rat nickel atom decreases expression ISO PRPSAP1 (Homo sapiens) 6480464 Nickel results in decreased expression of PRPSAP1 mRNA CTD PMID:25583101 Prpsap1 Rat omeprazole affects expression EXP 6480464 Omeprazole affects the expression of PRPSAP1 mRNA CTD PMID:19483382 Prpsap1 Rat ozone multiple interactions ISO PRPSAP1 (Homo sapiens) 6480464 [Acrolein co-treated with methacrylaldehyde co-treated with alpha-pinene co-treated with Ozone] results in increased oxidation of PRPSAP1 mRNA more ... CTD PMID:32699268 Prpsap1 Rat paracetamol affects expression ISO Prpsap1 (Mus musculus) 6480464 Acetaminophen affects the expression of PRPSAP1 mRNA CTD PMID:17562736 Prpsap1 Rat paracetamol increases expression EXP 6480464 Acetaminophen results in increased expression of PRPSAP1 mRNA CTD PMID:33387578 Prpsap1 Rat paracetamol decreases expression ISO PRPSAP1 (Homo sapiens) 6480464 Acetaminophen results in decreased expression of PRPSAP1 mRNA CTD PMID:22230336 Prpsap1 Rat pirinixic acid affects expression EXP 6480464 pirinixic acid affects the expression of PRPSAP1 mRNA CTD PMID:19483382 Prpsap1 Rat potassium dichromate decreases expression ISO Prpsap1 (Mus musculus) 6480464 Potassium Dichromate results in decreased expression of PRPSAP1 mRNA CTD PMID:23608068 Prpsap1 Rat progesterone multiple interactions EXP 6480464 Mifepristone inhibits the reaction [Progesterone results in increased expression of PRPSAP1 mRNA] CTD PMID:10888668 Prpsap1 Rat progesterone increases expression EXP 6480464 Progesterone results in increased expression of PRPSAP1 mRNA CTD PMID:10888668 Prpsap1 Rat resveratrol increases expression ISO Prpsap1 (Mus musculus) 6480464 resveratrol results in increased expression of PRPSAP1 protein CTD PMID:25505154 Prpsap1 Rat resveratrol multiple interactions ISO PRPSAP1 (Homo sapiens) 6480464 [Plant Extracts co-treated with Resveratrol] results in increased expression of PRPSAP1 mRNA CTD PMID:23557933 Prpsap1 Rat SB 431542 multiple interactions ISO PRPSAP1 (Homo sapiens) 6480464 [LDN 193189 co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide co-treated with FGF2 protein] results in increased expression of PRPSAP1 protein CTD PMID:37664457 Prpsap1 Rat sunitinib decreases expression ISO PRPSAP1 (Homo sapiens) 6480464 Sunitinib results in decreased expression of PRPSAP1 mRNA CTD PMID:31533062 Prpsap1 Rat tetrahydropalmatine decreases expression ISO PRPSAP1 (Homo sapiens) 6480464 tetrahydropalmatine results in decreased expression of PRPSAP1 protein CTD PMID:20109541 Prpsap1 Rat thioacetamide affects expression EXP 6480464 Thioacetamide affects the expression of PRPSAP1 mRNA CTD PMID:19483382 Prpsap1 Rat titanium dioxide affects methylation ISO Prpsap1 (Mus musculus) 6480464 titanium dioxide affects the methylation of PRPSAP1 gene CTD PMID:35295148 Prpsap1 Rat titanium dioxide increases methylation ISO Prpsap1 (Mus musculus) 6480464 titanium dioxide results in increased methylation of PRPSAP1 promoter CTD PMID:35295148 Prpsap1 Rat triptonide increases expression ISO Prpsap1 (Mus musculus) 6480464 triptonide results in increased expression of PRPSAP1 mRNA CTD PMID:33045310 Prpsap1 Rat valproic acid decreases expression ISO PRPSAP1 (Homo sapiens) 6480464 Valproic Acid results in decreased expression of PRPSAP1 mRNA CTD PMID:23179753 Prpsap1 Rat valproic acid affects expression ISO PRPSAP1 (Homo sapiens) 6480464 Valproic Acid affects the expression of PRPSAP1 mRNA CTD PMID:25979313 Prpsap1 Rat vorinostat decreases expression ISO PRPSAP1 (Homo sapiens) 6480464 vorinostat results in decreased expression of PRPSAP1 mRNA CTD PMID:27188386
1,2-dichloroethane (ISO) 1,2-dimethylhydrazine (ISO) 17alpha-ethynylestradiol (EXP,ISO) 17beta-estradiol (ISO) 2,2',4,4'-Tetrabromodiphenyl ether (ISO) 2,3,7,8-tetrachlorodibenzodioxine (EXP,ISO) 3,4-methylenedioxymethamphetamine (ISO) 3-isobutyl-1-methyl-7H-xanthine (ISO) 4,4'-sulfonyldiphenol (ISO) 5-methoxy-2-\{[(4-methoxy-3,5-dimethylpyridin-2-yl)methyl]sulfinyl\}-1H-benzimidazole (EXP) 6-propyl-2-thiouracil (EXP) acrolein (ISO) aflatoxin B1 (ISO) alpha-pinene (ISO) amiodarone (EXP) ammonium chloride (EXP) antirheumatic drug (ISO) apigenin (ISO) arsenite(3-) (ISO) benzbromarone (EXP) benzo[a]pyrene (ISO) beta-lapachone (ISO) bisphenol A (EXP,ISO) bisphenol F (ISO) cadmium dichloride (ISO) caffeine (ISO) carbamazepine (ISO) chlorpyrifos (ISO) clofibrate (EXP) copper(II) sulfate (ISO) coumarin (ISO) cyclosporin A (ISO) dexamethasone (ISO) dibutyl phthalate (EXP) dichloroacetic acid (ISO) diuron (EXP) epoxiconazole (ISO) ethanol (EXP) gallic acid (ISO) gentamycin (EXP) hydrogen peroxide (ISO) indometacin (ISO) ivermectin (ISO) L-ethionine (EXP) leflunomide (ISO) methylmercury chloride (ISO) methylparaben (ISO) mifepristone (EXP) nickel atom (ISO) omeprazole (EXP) ozone (ISO) paracetamol (EXP,ISO) pirinixic acid (EXP) potassium dichromate (ISO) progesterone (EXP) resveratrol (ISO) SB 431542 (ISO) sunitinib (ISO) tetrahydropalmatine (ISO) thioacetamide (EXP) titanium dioxide (ISO) triptonide (ISO) valproic acid (ISO) vorinostat (ISO)
1.
Phylogenetic-based propagation of functional annotations within the Gene Ontology consortium.
Gaudet P, etal., Brief Bioinform. 2011 Sep;12(5):449-62. doi: 10.1093/bib/bbr042. Epub 2011 Aug 27.
2.
Rat ISS GO annotations from GOA human gene data--August 2006
GOA data from the GO Consortium
3.
Partial reconstitution of mammalian phosphoribosylpyrophosphate synthetase in Escherichia coli cells. Coexpression of catalytic subunits with the 39-kDa associated protein leads to formation of soluble multimeric complexes of various compositions.
Ishijima S, etal., Biochim Biophys Acta. 1997 Sep 26;1342(1):28-36.
4.
Rat liver phosphoribosyl pyrophosphate synthetase: existence of the purified enzyme as heterogeneous aggregates and identification of the catalytic subunit.
Kita K, etal., J Biochem. 1989 May;105(5):736-41.
5.
A novel 39-kDa phosphoribosylpyrophosphate synthetase-associated protein of rat liver. Cloning, high sequence similarity to the catalytic subunits, and a negative regulatory role.
Kita K, etal., J Biol Chem 1994 Mar 18;269(11):8334-40.
6.
Rat ISS GO annotations from MGI mouse gene data--August 2006
MGD data from the GO Consortium
7.
Electronic Transfer of LocusLink and RefSeq Data
NCBI rat LocusLink and RefSeq merged data July 26, 2002
8.
GOA pipeline
RGD automated data pipeline
9.
Data Import for Chemical-Gene Interactions
RGD automated import pipeline for gene-chemical interactions
10.
Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences.
Strausberg RL, etal., Proc Natl Acad Sci U S A. 2002 Dec 24;99(26):16899-903. Epub 2002 Dec 11.
Prpsap1 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 10 102,199,949 - 102,221,642 (-) NCBI GRCr8 mRatBN7.2 10 101,701,094 - 101,750,753 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 10 101,701,096 - 101,750,751 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 10 106,757,499 - 106,779,133 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 10 106,220,577 - 106,242,211 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 10 101,621,981 - 101,643,676 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 10 105,430,516 - 105,492,154 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 10 105,430,520 - 105,452,228 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 10 105,092,063 - 105,113,772 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 10 106,582,381 - 106,604,072 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 10 106,596,897 - 106,618,475 (-) NCBI Celera 10 100,273,440 - 100,295,162 (-) NCBI Celera Cytogenetic Map 10 q32.1 NCBI
PRPSAP1 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 17 76,309,478 - 76,354,198 (-) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 17 76,309,478 - 76,384,521 (-) Ensembl GRCh38 hg38 GRCh38 GRCh37 17 74,305,559 - 74,350,279 (-) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 17 71,818,610 - 71,861,526 (-) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 17 71,818,609 - 71,861,526 NCBI Celera 17 70,901,207 - 70,943,527 (-) NCBI Celera Cytogenetic Map 17 q25.1 NCBI HuRef 17 69,735,400 - 69,778,716 (-) NCBI HuRef CHM1_1 17 74,371,766 - 74,415,154 (-) NCBI CHM1_1 T2T-CHM13v2.0 17 77,206,033 - 77,250,766 (-) NCBI T2T-CHM13v2.0
Prpsap1 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 11 116,361,641 - 116,385,739 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 11 116,361,671 - 116,385,461 (-) Ensembl GRCm39 Ensembl GRCm38 11 116,470,816 - 116,494,913 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 11 116,470,845 - 116,494,202 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 11 116,332,130 - 116,351,660 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 11 116,286,588 - 116,315,017 (-) NCBI MGSCv36 mm8 Celera 11 128,239,926 - 128,259,180 (-) NCBI Celera Cytogenetic Map 11 E2 NCBI cM Map 11 81.34 NCBI
Prpsap1 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955506 5,951,210 - 5,987,658 (+) Ensembl ChiLan1.0 ChiLan1.0 NW_004955506 5,951,210 - 5,987,658 (+) NCBI ChiLan1.0 ChiLan1.0
PRPSAP1 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 19 92,353,684 - 92,397,196 (-) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 17 97,178,894 - 97,222,407 (-) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 17 70,258,663 - 70,302,287 (-) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 17 75,810,423 - 75,853,442 (-) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 17 75,810,423 - 75,853,442 (-) Ensembl panpan1.1 panPan2
PRPSAP1 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 9 4,346,282 - 4,372,067 (+) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 9 4,346,297 - 4,372,067 (+) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 9 5,026,361 - 5,052,101 (+) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 9 5,018,066 - 5,042,293 (+) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 9 5,018,081 - 5,042,694 (+) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 9 5,056,383 - 5,082,115 (+) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 9 5,166,189 - 5,191,954 (+) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 9 5,239,252 - 5,251,685 (+) NCBI UU_Cfam_GSD_1.0
Prpsap1 Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024405602 4,960,002 - 4,985,410 (+) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936594 1,427,122 - 1,456,562 (-) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936594 1,426,549 - 1,451,984 (-) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
PRPSAP1 Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 12 5,144,069 - 5,174,382 (+) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 12 5,141,223 - 5,174,383 (+) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 12 5,047,807 - 5,078,207 (+) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
PRPSAP1 Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 16 45,326,152 - 45,368,636 (+) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 16 45,314,259 - 45,370,274 (+) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666077 16,068,148 - 16,113,868 (+) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Prpsap1
.
Predicted Target Of
Count of predictions: 151 Count of miRNA genes: 118 Interacting mature miRNAs: 123 Transcripts: ENSRNOT00000013573 Prediction methods: Microtar, Miranda, Rnahybrid Result types: miRGate_prediction
1354641 Bvd2 Brain ventricular dilatation QTL 2 6.36 0.001 brain ventricle morphology trait (VT:0000822) hydrocephalus severity score (CMO:0001881) 10 93223816 107057807 Rat 61449 Ciaa2 CIA Autoantibody QTL 2 7.1 blood autoantibody amount (VT:0003725) calculated serum anti-type 2 collagen antibody titer (CMO:0001279) 10 63221094 107211142 Rat 61325 Aia5 Adjuvant induced arthritis QTL 5 0.01 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 10 23444813 104060283 Rat 1298078 Stresp5 Stress response QTL 5 2.99 0.00025 blood corticosterone amount (VT:0005345) plasma corticosterone level (CMO:0001173) 10 42045676 104670812 Rat 1549831 Bss6 Bone structure and strength QTL 6 4 lumbar vertebra strength trait (VT:0010574) vertebra ultimate force (CMO:0001678) 10 57576521 102576521 Rat 1579915 Bp280 Blood pressure QTL 280 0.001 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 10 90404397 107211142 Rat 2298548 Neuinf7 Neuroinflammation QTL 7 3.4 nervous system integrity trait (VT:0010566) spinal cord RT1-B protein level (CMO:0002132) 10 72224939 107211142 Rat 1302404 Cia27 Collagen induced arthritis QTL 27 2.6 0.0045 joint integrity trait (VT:0010548) experimental arthritis severity measurement (CMO:0001459) 10 76452683 107211142 Rat 2317754 Glom25 Glomerulus QTL 25 3.5 urine protein amount (VT:0005160) urine protein level (CMO:0000591) 10 82685200 107211142 Rat 70171 Cari1 Carrageenan-induced inflammation QTL 1 4.9 0.0005 hypodermis integrity trait (VT:0010550) inflammatory exudate volume (CMO:0001429) 10 53797385 107211142 Rat 10450493 Bp382 Blood pressure QTL 382 0.002 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 10 94759759 107211142 Rat 1578672 Bmd16 Bone mineral density QTL 16 6.2 femur mineral mass (VT:0010011) compact volumetric bone mineral density (CMO:0001730) 10 96703043 107057807 Rat 61354 Pia10 Pristane induced arthritis QTL 10 0.01 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 10 23444813 104060283 Rat 2313103 Bss80 Bone structure and strength QTL 80 2 0.0001 tibia strength trait (VT:1000284) tibia midshaft endosteal cross-sectional area (CMO:0001716) 10 62057807 107057807 Rat 2293646 Bss25 Bone structure and strength QTL 25 10.96 0.0001 femur morphology trait (VT:0000559) femur cross-sectional area (CMO:0001661) 10 69738412 107211142 Rat 2303118 Mamtr7 Mammary tumor resistance QTL 7 0.003 mammary gland integrity trait (VT:0010552) mammary tumor growth rate (CMO:0000344) 10 9658275 104670812 Rat 2300172 Bmd57 Bone mineral density QTL 57 9.8 0.0001 femur mineral mass (VT:0010011) volumetric bone mineral density (CMO:0001553) 10 69738412 107211142 Rat 70193 Mcs7 Mammary carcinoma susceptibility QTL 7 2.38 mammary gland integrity trait (VT:0010552) mammary tumor number (CMO:0000343) 10 72224939 107211142 Rat 2313105 Bss79 Bone structure and strength QTL 79 1.8 0.0001 tibia size trait (VT:0100001) tibia midshaft cross-sectional area (CMO:0001717) 10 62057807 107057807 Rat 61363 Oia3 Oil induced arthritis QTL 3 0.001 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 10 87307617 107211142 Rat 2316949 Gluco60 Glucose level QTL 60 3.7 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 10 14487011 107057807 Rat 724530 Bp149 Blood pressure QTL 149 0.0001 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 10 90627439 107211142 Rat 1300137 Bp186 Blood pressure QTL 186 3.57 arterial blood pressure trait (VT:2000000) blood pressure time series experimental set point of the baroreceptor response (CMO:0002593) 10 90627439 107057807 Rat 2293663 Bss33 Bone structure and strength QTL 33 9.34 0.0001 femur strength trait (VT:0010010) femur midshaft polar moment of inertia (CMO:0001669) 10 69738412 107211142 Rat 1578663 Bss18 Bone structure and strength QTL 18 3.6 femur width (VT:1000666) femoral neck width (CMO:0001695) 10 96703043 107057807 Rat 7387312 Bw125 Body weight QTL 125 3 0.0047 retroperitoneal fat pad mass (VT:0010430) retroperitoneal fat pad weight (CMO:0000356) 10 64890616 107211142 Rat 2312672 Insul15 Insulin level QTL 15 0.01 blood insulin amount (VT:0001560) serum insulin level (CMO:0000358) 10 57134272 102134272 Rat 12880384 Cm107 Cardiac mass QTL 107 0.001 heart mass (VT:0007028) heart wet weight to body weight ratio (CMO:0002408) 90404397 107211142 Rat 12880385 Cm108 Cardiac mass QTL 108 0.001 heart left ventricle mass (VT:0007031) heart left ventricle weight to body weight ratio (CMO:0000530) 90404397 107211142 Rat 2317029 Aia19 Adjuvant induced arthritis QTL 19 2.98 joint integrity trait (VT:0010548) left rear ankle joint diameter (CMO:0002149) 10 66978955 107211142 Rat 2303589 Bw87 Body weight QTL 87 2 body mass (VT:0001259) body weight (CMO:0000012) 10 81285008 107211142 Rat 12880396 Am13 Aortic mass QTL 13 0.001 aorta mass (VT:0002845) aorta weight to aorta length to body weight ratio (CMO:0002722) 10 90404397 107211142 Rat 12880398 Kidm67 Kidney mass QTL 67 0.001 kidney mass (VT:0002707) both kidneys wet weight to body weight ratio (CMO:0000340) 10 90404397 107211142 Rat 61387 Bp1 Blood pressure QTL 1 5.1 arterial blood pressure trait (VT:2000000) diastolic blood pressure (CMO:0000005) 10 51770177 107211142 Rat 2317039 Aia6 Adjuvant induced arthritis QTL 6 4.31 joint integrity trait (VT:0010548) right rear ankle joint diameter (CMO:0002150) 10 66978955 107211142 Rat 12880395 Cm109 Cardiac mass QTL 109 0.001 heart right ventricle mass (VT:0007033) heart right ventricle weight to body weight ratio (CMO:0000914) 10 90404397 107211142 Rat 61396 Bp9 Blood pressure QTL 9 4.8 0.0001 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 10 68420376 107211142 Rat 634320 Niddm49 Non-insulin dependent diabetes mellitus QTL 49 4.41 blood glucose amount (VT:0000188) plasma glucose level (CMO:0000042) 10 88539139 107211142 Rat 1331791 Cm31 Cardiac mass QTL 31 3.84606 heart mass (VT:0007028) heart wet weight (CMO:0000069) 10 29299504 107211142 Rat 10450498 Bp384 Blood pressure QTL 384 0.002 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 10 67750049 107211142 Rat 4889492 Pancm2 Pancreatic morphology QTL 2 3.2 pancreatic beta cell morphology trait (VT:0005217) ratio of insulin-positive cell area to total area of splenic region of pancreas (CMO:0001814) 10 76748906 107211142 Rat 6893366 Bw106 Body weight QTL 106 0.3 0.47 body mass (VT:0001259) body weight (CMO:0000012) 10 70199100 107211142 Rat 2293698 Bss43 Bone structure and strength QTL 43 5.33 0.0001 lumbar vertebra size trait (VT:0010518) lumbar vertebra cross-sectional area (CMO:0001689) 10 59209888 104209888 Rat 1576313 Pia25 Pristane induced arthritis QTL 25 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 10 96120911 104060283 Rat 631267 Cia20 Collagen induced arthritis QTL 20 3.2 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 10 23444813 104060283 Rat 1576307 Cia28 Collagen induced arthritis QTL 28 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 10 96120911 104060283 Rat 1576308 Schws1 Schwannoma susceptibility QTL 1 0.0041 nervous system integrity trait (VT:0010566) percentage of study population developing trigeminal nerve neurilemmomas during a period of time (CMO:0002017) 10 40035094 102359817 Rat 631269 Cia22 Collagen induced arthritis QTL 22 8.9 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 10 40035094 104060283 Rat 631268 Cia21 Collagen induced arthritis QTL 21 3.1 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 10 14487011 104060283 Rat 631270 Cia23 Collagen induced arthritis QTL 23 3.9 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 10 40035094 104060283 Rat 2292438 Bp311 Blood pressure QTL 311 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 10 76246085 107211142 Rat 2312662 Slep8 Serum leptin concentration QTL 8 0.05 blood leptin amount (VT:0005667) serum leptin level (CMO:0000780) 10 57134272 102134272 Rat 2292436 Bp310 Blood pressure QTL 310 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 10 94759759 107211142 Rat 1600367 Mcs15 Mammary carcinoma susceptibility QTL 15 4.5 mammary gland integrity trait (VT:0010552) mammary tumor number (CMO:0000343) 10 85565469 103884409 Rat 631539 Oia6 Oil induced arthritis QTL 6 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 10 97010147 104670812 Rat 631538 Oia5 Oil induced arthritis QTL 5 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 10 87055121 107211142 Rat 61436 Cia5 Collagen induced arthritis QTL 5 4.9 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 10 91228102 104060283 Rat 1642980 Bp300 Blood pressure QTL 300 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 10 68383129 107211142 Rat 2312668 Scl65 Serum cholesterol level QTL 65 0.001 blood cholesterol amount (VT:0000180) serum total cholesterol level (CMO:0000363) 10 57134272 102134272 Rat
RH127688
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 10 101,701,122 - 101,701,336 (+) MAPPER mRatBN7.2 Rnor_6.0 10 105,430,547 - 105,430,760 NCBI Rnor6.0 Rnor_5.0 10 105,092,091 - 105,092,304 UniSTS Rnor5.0 RGSC_v3.4 10 106,582,409 - 106,582,622 UniSTS RGSC3.4 Celera 10 100,273,468 - 100,273,681 UniSTS Cytogenetic Map 10 q32.3 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
11
49
113
91
90
59
25
59
6
218
97
93
45
60
31
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000013573 ⟹ ENSRNOP00000013573
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 10 101,701,096 - 101,722,792 (-) Ensembl Rnor_6.0 Ensembl 10 105,430,520 - 105,452,228 (-) Ensembl
Ensembl Acc Id:
ENSRNOT00000114219 ⟹ ENSRNOP00000083670
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 10 101,701,100 - 101,750,751 (-) Ensembl
RefSeq Acc Id:
NM_022545 ⟹ NP_071990
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 10 102,199,949 - 102,221,642 (-) NCBI mRatBN7.2 10 101,701,095 - 101,722,792 (-) NCBI Rnor_6.0 10 105,430,519 - 105,452,228 (-) NCBI Rnor_5.0 10 105,092,063 - 105,113,772 (-) NCBI RGSC_v3.4 10 106,582,381 - 106,604,072 (-) RGD Celera 10 100,273,440 - 100,295,162 (-) RGD
Sequence:
GCGCTCGGTTGCGGCGCTGTTGCCTGTGGTCGGGACGCGGAGGCGGCGCGTCGGTATCGCGCCTCGTCCCTCTGCGCCTCCGCCGGTGGCTGCGTCGGCGTCACAGCTGTGCCCACATCCCGCCCCGC
hide sequence
RefSeq Acc Id:
XM_039086791 ⟹ XP_038942719
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 10 102,199,952 - 102,221,283 (-) NCBI mRatBN7.2 10 101,701,094 - 101,722,433 (-) NCBI
RefSeq Acc Id:
NP_071990 ⟸ NM_022545
- UniProtKB:
Q63468 (UniProtKB/Swiss-Prot), Q63417 (UniProtKB/Swiss-Prot), G3V7B5 (UniProtKB/TrEMBL), Q6AYZ7 (UniProtKB/TrEMBL), A6HKW7 (UniProtKB/TrEMBL)
- Sequence:
MPRKLLLLPQLSACSALRVPRARPAASPAMNAARTGYRVFSANSTAACTELAKRITERLGAELGKSVVYQETNGETRVEIKESVRGQDIFIIQTIPRDVNTAVMELLIMAYALKTACARNIIGVIPYF
hide sequence
Ensembl Acc Id:
ENSRNOP00000013573 ⟸ ENSRNOT00000013573
RefSeq Acc Id:
XP_038942719 ⟸ XM_039086791
- Peptide Label:
isoform X1
- UniProtKB:
A0A8I5ZZP2 (UniProtKB/TrEMBL)
Ensembl Acc Id:
ENSRNOP00000083670 ⟸ ENSRNOT00000114219
RGD ID: 13697916 Promoter ID: EPDNEW_R8441 Type: initiation region Name: Prpsap1_1 Description: phosphoribosyl pyrophosphate synthetase-associated protein 1 SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Rat Assembly Chr Position (strand) Source Rnor_6.0 10 105,452,213 - 105,452,273 EPDNEW
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2005-01-20
Prpsap1
phosphoribosyl pyrophosphate synthetase-associated protein 1
phosphoribosylpyrophosphate synthetase-associated protein (39 kDa)
Name updated
1299863 APPROVED
2002-08-07
Prpsap1
phosphoribosylpyrophosphate synthetase-associated protein (39 kDa)
Symbol and Name status set to provisional
70820 PROVISIONAL
