Symbol:
Acadl
Name:
acyl-CoA dehydrogenase, long chain
RGD ID:
2011
Description:
Enables flavin adenine dinucleotide binding activity; long-chain fatty acyl-CoA dehydrogenase activity; and protein homodimerization activity. Involved in fatty acid beta-oxidation using acyl-CoA dehydrogenase and long-chain fatty acid catabolic process. Located in mitochondrial matrix and mitochondrial membrane. Orthologous to human ACADL (acyl-CoA dehydrogenase long chain); PARTICIPATES IN fatty acid beta degradation pathway; 3-hydroxyacyl-CoA dehydrogenase deficiency pathway; carnitine palmitoyltransferase I deficiency pathway; INTERACTS WITH (+)-schisandrin B; (R)-lipoic acid; 17beta-estradiol.
Type:
protein-coding
RefSeq Status:
PROVISIONAL
Previously known as:
acetyl-Coenzyme A dehydrogenase, long-chain; ACOADA; Acyl Coenzyme A dehydrogenase long chain; Acyl Coenzyme A dehydrogenase, long chain; acyl-Coenzyme A dehydrogenase, long-chain; LCAD; LCAD long chain acyl-CoA dehydrogenase; LCAD, long chain acyl-CoA dehydrogenase; long-chain acyl-CoA dehydrogenase; long-chain specific acyl-CoA dehydrogenase, mitochondrial
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Species
Gene symbol and name
Data Source
Assertion derived from
less info ...
Orthologs 1
Homo sapiens (human):
ACADL (acyl-CoA dehydrogenase long chain) HGNC
EggNOG, Ensembl, HomoloGene, Inparanoid, NCBI, OMA, OrthoDB, OrthoMCL, Panther, PhylomeDB, Treefam
Mus musculus (house mouse):
Acadl (acyl-Coenzyme A dehydrogenase, long-chain) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chinchilla lanigera (long-tailed chinchilla):
Acadl (acyl-CoA dehydrogenase long chain) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Pan paniscus (bonobo/pygmy chimpanzee):
ACADL (acyl-CoA dehydrogenase long chain) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Canis lupus familiaris (dog):
ACADL (acyl-CoA dehydrogenase long chain) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Ictidomys tridecemlineatus (thirteen-lined ground squirrel):
Acadl (acyl-CoA dehydrogenase long chain) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Sus scrofa (pig):
ACADL (acyl-CoA dehydrogenase long chain) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chlorocebus sabaeus (green monkey):
ACADL (acyl-CoA dehydrogenase long chain) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Heterocephalus glaber (naked mole-rat):
Acadl (acyl-CoA dehydrogenase long chain) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Alliance orthologs 3
Mus musculus (house mouse):
Acadl (acyl-Coenzyme A dehydrogenase, long-chain)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Homo sapiens (human):
ACADL (acyl-CoA dehydrogenase long chain)
Alliance
DIOPT (Ensembl Compara|HGNC|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Danio rerio (zebrafish):
acadl (acyl-CoA dehydrogenase long chain)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Drosophila melanogaster (fruit fly):
Egm
Alliance
DIOPT (Ensembl Compara|PANTHER)
Xenopus tropicalis (tropical clawed frog):
acadl
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB)
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 9 75,783,689 - 75,822,077 (-) NCBI GRCr8 mRatBN7.2 9 68,333,981 - 68,372,149 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 9 68,333,980 - 68,372,220 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 9 76,823,956 - 76,861,404 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 9 81,952,887 - 81,990,335 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 9 80,351,815 - 80,389,588 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 9 73,833,368 - 73,871,857 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 9 73,833,388 - 73,871,888 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 9 73,434,371 - 73,472,895 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 9 65,613,130 - 65,651,775 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 9 65,760,111 - 65,798,754 (-) NCBI Celera 9 65,813,263 - 65,851,320 (-) NCBI Celera RH 3.4 Map 9 612.99 RGD Cytogenetic Map 9 q32 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Acadl Rat (+)-schisandrin B multiple interactions EXP 6480464 schizandrin B inhibits the reaction [Carbon Tetrachloride results in decreased expression of ACADL mRNA] CTD PMID:31150632 Acadl Rat (1->4)-beta-D-glucan multiple interactions ISO Acadl (Mus musculus) 6480464 [perfluorooctane sulfonic acid co-treated with Cellulose] results in increased expression of ACADL mRNA CTD PMID:36331819 Acadl Rat (R)-lipoic acid multiple interactions EXP 6480464 Thioctic Acid inhibits the reaction [Dietary Fats results in decreased expression of ACADL mRNA] CTD PMID:22464149 Acadl Rat 1,2-dimethylhydrazine decreases expression ISO Acadl (Mus musculus) 6480464 1 and 2-Dimethylhydrazine results in decreased expression of ACADL mRNA CTD PMID:22206623 Acadl Rat 1,2-dimethylhydrazine multiple interactions ISO Acadl (Mus musculus) 6480464 [1 and 2-Dimethylhydrazine co-treated with Folic Acid] results in decreased expression of ACADL mRNA CTD PMID:22206623 Acadl Rat 17alpha-ethynylestradiol increases expression ISO Acadl (Mus musculus) 6480464 Ethinyl Estradiol results in increased expression of ACADL mRNA CTD PMID:17942748 Acadl Rat 17beta-estradiol multiple interactions EXP 6480464 [Estradiol co-treated with Testosterone] results in increased expression of ACADL mRNA CTD PMID:11375906 Acadl Rat 17beta-estradiol increases expression ISO Acadl (Mus musculus) 6480464 Estradiol results in increased expression of ACADL mRNA CTD PMID:39298647 Acadl Rat 17beta-estradiol decreases expression ISO Acadl (Mus musculus) 6480464 Estradiol results in decreased expression of ACADL mRNA CTD PMID:19484750 Acadl Rat 17beta-hydroxy-5alpha-androstan-3-one increases expression ISO ACADL (Homo sapiens) 6480464 Dihydrotestosterone results in increased expression of ACADL mRNA CTD PMID:29581250 Acadl Rat 2,3,7,8-tetrachlorodibenzodioxine decreases expression ISO ACADL (Homo sapiens) 6480464 Tetrachlorodibenzodioxin results in decreased expression of ACADL mRNA CTD PMID:20106945 Acadl Rat 2,3,7,8-tetrachlorodibenzodioxine affects expression EXP 6480464 Tetrachlorodibenzodioxin affects the expression of ACADL mRNA CTD PMID:34747641 Acadl Rat 2,3,7,8-tetrachlorodibenzodioxine increases expression ISO ACADL (Homo sapiens) 6480464 Tetrachlorodibenzodioxin results in increased expression of ACADL mRNA CTD PMID:21296121 Acadl Rat 2,3,7,8-tetrachlorodibenzodioxine multiple interactions ISO Acadl (Mus musculus) 6480464 Tetrachlorodibenzodioxin promotes the reaction [AHR protein binds to ACADL promoter] CTD PMID:19654925 Acadl Rat 2,3,7,8-tetrachlorodibenzodioxine decreases expression EXP 6480464 Tetrachlorodibenzodioxin results in decreased expression of ACADL mRNA CTD PMID:11752688 Acadl Rat 3,3',4,4'-tetrachlorobiphenyl multiple interactions ISO Acadl (Mus musculus) 6480464 3 more ... CTD PMID:19467301 Acadl Rat 4,4'-sulfonyldiphenol increases expression ISO Acadl (Mus musculus) 6480464 bisphenol S results in increased expression of ACADL mRNA CTD PMID:39298647 Acadl Rat 5-fluorouracil increases expression ISO ACADL (Homo sapiens) 6480464 Fluorouracil results in increased expression of ACADL protein CTD PMID:15585135 and PMID:16803524 Acadl Rat 5-methoxy-2-\{[(4-methoxy-3,5-dimethylpyridin-2-yl)methyl]sulfinyl\}-1H-benzimidazole affects expression EXP 6480464 Omeprazole affects the expression of ACADL mRNA CTD PMID:19483382 Acadl Rat 6-propyl-2-thiouracil affects expression EXP 6480464 Propylthiouracil affects the expression of ACADL mRNA CTD PMID:19483382 Acadl Rat 6-propyl-2-thiouracil increases expression EXP 6480464 Propylthiouracil results in increased expression of ACADL mRNA CTD PMID:30047161 Acadl Rat acetamide decreases expression EXP 6480464 acetamide results in decreased expression of ACADL mRNA CTD PMID:31881176 Acadl Rat aflatoxin B1 decreases methylation ISO ACADL (Homo sapiens) 6480464 Aflatoxin B1 results in decreased methylation of ACADL gene CTD PMID:27153756 Acadl Rat aldehydo-D-glucose multiple interactions ISO ACADL (Homo sapiens) 6480464 [Glucose co-treated with Palmitic Acid] results in decreased expression of ACADL mRNA CTD PMID:39265716 Acadl Rat Alisol B multiple interactions ISO Acadl (Mus musculus) 6480464 alisol B inhibits the reaction [[Dietary Fats co-treated with Carbon Tetrachloride] results in increased expression of ACADL mRNA] CTD PMID:35745142 Acadl Rat amiodarone affects expression EXP 6480464 Amiodarone affects the expression of ACADL mRNA CTD PMID:19483382 Acadl Rat amitrole increases expression EXP 6480464 Amitrole results in increased expression of ACADL mRNA CTD PMID:30047161 Acadl Rat ammonium chloride affects expression EXP 6480464 Ammonium Chloride affects the expression of ACADL mRNA CTD PMID:16483693 Acadl Rat aniline increases nitrosation EXP 6480464 aniline results in increased nitrosation of ACADL protein CTD PMID:21708182 Acadl Rat aripiprazole decreases expression EXP 6480464 Aripiprazole results in decreased expression of ACADL mRNA CTD PMID:17868501 Acadl Rat Aroclor 1254 decreases expression ISO Acadl (Mus musculus) 6480464 Chlorodiphenyl (54% Chlorine) results in decreased expression of ACADL mRNA CTD PMID:25270620 Acadl Rat arsenite(3-) decreases expression ISO Acadl (Mus musculus) 6480464 arsenite results in decreased expression of ACADL mRNA CTD PMID:33053406 Acadl Rat arsenous acid increases expression ISO Acadl (Mus musculus) 6480464 Arsenic Trioxide results in increased expression of ACADL mRNA CTD PMID:35676786 Acadl Rat benzbromarone affects expression EXP 6480464 Benzbromarone affects the expression of ACADL mRNA CTD PMID:19483382 Acadl Rat benzo[a]pyrene multiple interactions ISO Acadl (Mus musculus) 6480464 AHR protein affects the reaction [Benzo(a)pyrene affects the expression of ACADL mRNA] CTD PMID:22228805 Acadl Rat benzo[a]pyrene affects methylation ISO ACADL (Homo sapiens) 6480464 Benzo(a)pyrene affects the methylation of ACADL promoter CTD PMID:27901495 Acadl Rat benzo[a]pyrene increases expression ISO Acadl (Mus musculus) 6480464 Benzo(a)pyrene results in increased expression of ACADL mRNA CTD PMID:22228805 Acadl Rat beta-hexachlorocyclohexane decreases expression ISO Acadl (Mus musculus) 6480464 beta-hexachlorocyclohexane results in decreased expression of ACADL mRNA and beta-hexachlorocyclohexane results in decreased expression of ACADL protein CTD PMID:28397872 Acadl Rat bezafibrate multiple interactions ISO Acadl (Mus musculus) 6480464 PPARA protein affects the reaction [Bezafibrate results in increased expression of ACADL mRNA] and PPARA protein affects the reaction [Bezafibrate results in increased expression of ACADL protein] CTD PMID:12782154 Acadl Rat bezafibrate increases expression ISO Acadl (Mus musculus) 6480464 Bezafibrate results in increased expression of ACADL mRNA and Bezafibrate results in increased expression of ACADL protein CTD PMID:12782154 Acadl Rat bis(2-ethylhexyl) phthalate increases expression ISO Acadl (Mus musculus) 6480464 Diethylhexyl Phthalate results in increased expression of ACADL mRNA CTD PMID:19850644 Acadl Rat bis(2-ethylhexyl) phthalate decreases expression ISO Acadl (Mus musculus) 6480464 Diethylhexyl Phthalate results in decreased expression of ACADL mRNA CTD PMID:33754040 and PMID:35550907 Acadl Rat bis(2-ethylhexyl) phthalate increases expression EXP 6480464 Diethylhexyl Phthalate results in increased expression of ACADL mRNA CTD PMID:22672789 Acadl Rat bis(2-ethylhexyl) phthalate multiple interactions ISO Acadl (Mus musculus) 6480464 PPARA protein promotes the reaction [Diethylhexyl Phthalate results in increased expression of ACADL mRNA] CTD PMID:19850644 Acadl Rat bisphenol A increases expression EXP 6480464 bisphenol A results in increased expression of ACADL mRNA CTD PMID:25181051 Acadl Rat bisphenol A decreases expression ISO Acadl (Mus musculus) 6480464 bisphenol A results in decreased expression of ACADL mRNA CTD PMID:33221593 Acadl Rat bisphenol A decreases expression EXP 6480464 bisphenol A results in decreased expression of ACADL mRNA CTD PMID:34947998 Acadl Rat bisphenol A decreases expression ISO ACADL (Homo sapiens) 6480464 bisphenol A analog results in decreased expression of ACADL mRNA and bisphenol A results in decreased expression of ACADL mRNA CTD PMID:32763284 Acadl Rat bisphenol F increases expression ISO ACADL (Homo sapiens) 6480464 4 and 4'-bisphenol F results in increased expression of ACADL mRNA CTD PMID:32763284 Acadl Rat cadmium atom increases oxidation ISO Acadl (Mus musculus) 6480464 Cadmium results in increased oxidation of ACADL protein CTD PMID:24496640 Acadl Rat carbon nanotube increases expression ISO Acadl (Mus musculus) 6480464 Nanotubes more ... CTD PMID:25620056 Acadl Rat chlorpyrifos decreases expression ISO Acadl (Mus musculus) 6480464 Chlorpyrifos results in decreased expression of ACADL mRNA CTD PMID:37019170 Acadl Rat choline multiple interactions ISO Acadl (Mus musculus) 6480464 [Choline deficiency co-treated with Methionine deficiency] results in increased expression of ACADL mRNA CTD PMID:25178843 Acadl Rat clofibrate multiple interactions ISO Acadl (Mus musculus) 6480464 [Clofibrate co-treated with Acetaminophen] affects the expression of ACADL mRNA and PPARA affects the reaction [[Clofibrate co-treated with Acetaminophen] affects the expression of ACADL mRNA] CTD PMID:17585979 Acadl Rat clofibrate increases expression ISO Acadl (Mus musculus) 6480464 Clofibrate results in increased expression of ACADL mRNA CTD PMID:17585979 more ... Acadl Rat clofibrate increases expression EXP 6480464 Clofibrate results in increased expression of ACADL mRNA and Clofibrate results in increased expression of ACADL protein CTD PMID:12851107 more ... Acadl Rat clofibrate affects expression EXP 6480464 Clofibrate affects the expression of ACADL mRNA CTD PMID:19483382 Acadl Rat copper atom multiple interactions EXP 6480464 [Fructose co-treated with Copper deficiency] results in decreased expression of ACADL mRNA CTD PMID:25813056 Acadl Rat copper(0) multiple interactions EXP 6480464 [Fructose co-treated with Copper deficiency] results in decreased expression of ACADL mRNA CTD PMID:25813056 Acadl Rat cyclosporin A decreases expression EXP 6480464 Cyclosporine results in decreased expression of ACADL mRNA CTD PMID:19224547 Acadl Rat cyclosporin A decreases expression ISO Acadl (Mus musculus) 6480464 Cyclosporine results in decreased expression of ACADL mRNA CTD PMID:23830897 Acadl Rat cyclosporin A decreases expression ISO ACADL (Homo sapiens) 6480464 Cyclosporine results in decreased expression of ACADL mRNA CTD PMID:20106945 more ... Acadl Rat D-glucose multiple interactions ISO ACADL (Homo sapiens) 6480464 [Glucose co-treated with Palmitic Acid] results in decreased expression of ACADL mRNA CTD PMID:39265716 Acadl Rat dexamethasone decreases expression ISO Acadl (Mus musculus) 6480464 Dexamethasone results in decreased expression of ACADL protein CTD PMID:33567340 Acadl Rat Di-n-hexyl phthalate decreases expression ISO ACADL (Homo sapiens) 6480464 di-n-hexyl phthalate results in decreased expression of ACADL mRNA CTD PMID:33043605 Acadl Rat diarsenic trioxide increases expression ISO Acadl (Mus musculus) 6480464 Arsenic Trioxide results in increased expression of ACADL mRNA CTD PMID:35676786 Acadl Rat dibutyl phthalate increases expression EXP 6480464 Dibutyl Phthalate results in increased expression of ACADL mRNA CTD PMID:21266533 Acadl Rat dichloroacetic acid increases expression ISO Acadl (Mus musculus) 6480464 Dichloroacetic Acid results in increased expression of ACADL mRNA CTD PMID:23575800 and PMID:28962523 Acadl Rat diethylstilbestrol increases expression EXP 6480464 Diethylstilbestrol results in increased expression of ACADL mRNA CTD PMID:37077353 Acadl Rat diuron increases expression EXP 6480464 Diuron results in increased expression of ACADL mRNA CTD PMID:21551480 Acadl Rat dorsomorphin multiple interactions ISO ACADL (Homo sapiens) 6480464 [NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of ACADL mRNA CTD PMID:27188386 Acadl Rat doxorubicin multiple interactions ISO Acadl (Mus musculus) 6480464 [Doxorubicin co-treated with MT2A protein] results in decreased expression of ACADL protein more ... CTD PMID:16144979 more ... Acadl Rat doxorubicin decreases expression EXP 6480464 Doxorubicin results in decreased expression of ACADL mRNA CTD PMID:38395252 Acadl Rat doxorubicin multiple interactions EXP 6480464 SIRT6 protein inhibits the reaction [Doxorubicin results in decreased expression of ACADL mRNA] CTD PMID:38395252 Acadl Rat doxorubicin increases expression ISO Acadl (Mus musculus) 6480464 Doxorubicin results in increased expression of ACADL mRNA and Doxorubicin results in increased expression of ACADL protein CTD PMID:21251210 and PMID:31768571 Acadl Rat doxorubicin decreases expression ISO Acadl (Mus musculus) 6480464 Doxorubicin results in decreased expression of ACADL mRNA and Doxorubicin results in decreased expression of ACADL protein CTD PMID:16144979 more ... Acadl Rat ethanol multiple interactions ISO Acadl (Mus musculus) 6480464 [Ethanol co-treated with Zinc] results in increased expression of ACADL mRNA CTD PMID:19637192 Acadl Rat ethanol increases expression ISO Acadl (Mus musculus) 6480464 Ethanol results in increased expression of ACADL mRNA CTD PMID:30319688 Acadl Rat ethanol affects splicing ISO Acadl (Mus musculus) 6480464 Ethanol affects the splicing of ACADL mRNA CTD PMID:30319688 Acadl Rat fenamidone increases expression ISO Acadl (Mus musculus) 6480464 fenamidone results in increased expression of ACADL mRNA CTD PMID:27029645 Acadl Rat fenofibrate increases expression ISO Acadl (Mus musculus) 6480464 Fenofibrate results in increased expression of ACADL mRNA CTD PMID:17690133 Acadl Rat flutamide decreases expression ISO Acadl (Mus musculus) 6480464 Flutamide results in decreased expression of ACADL mRNA CTD PMID:17702527 Acadl Rat flutamide increases expression EXP 6480464 Flutamide results in increased expression of ACADL protein CTD PMID:17311803 Acadl Rat folic acid multiple interactions ISO Acadl (Mus musculus) 6480464 [1 and 2-Dimethylhydrazine co-treated with Folic Acid] results in decreased expression of ACADL mRNA CTD PMID:22206623 Acadl Rat folic acid decreases expression ISO Acadl (Mus musculus) 6480464 Folic Acid results in decreased expression of ACADL mRNA CTD PMID:25629700 Acadl Rat fructose multiple interactions EXP 6480464 [Fructose co-treated with Copper deficiency] results in decreased expression of ACADL mRNA CTD PMID:25813056 Acadl Rat furan affects binding EXP 6480464 furan binds to ACADL protein CTD PMID:22240984 Acadl Rat glucose multiple interactions ISO ACADL (Homo sapiens) 6480464 [Glucose co-treated with Palmitic Acid] results in decreased expression of ACADL mRNA CTD PMID:39265716 Acadl Rat glyphosate decreases expression ISO Acadl (Mus musculus) 6480464 Glyphosate results in decreased expression of ACADL protein CTD PMID:37208198 Acadl Rat GW 4064 decreases expression ISO ACADL (Homo sapiens) 6480464 GW 4064 results in decreased expression of ACADL mRNA CTD PMID:30611723 Acadl Rat GW 4064 multiple interactions ISO ACADL (Homo sapiens) 6480464 [GW 4064 co-treated with Oleic Acid] results in decreased expression of ACADL mRNA CTD PMID:30611723 Acadl Rat GW 7647 multiple interactions ISO ACADL (Homo sapiens) 6480464 [GW 7647 co-treated with Oleic Acid] results in decreased expression of ACADL mRNA CTD PMID:30611723 Acadl Rat hexadecanoic acid multiple interactions ISO ACADL (Homo sapiens) 6480464 [Glucose co-treated with Palmitic Acid] results in decreased expression of ACADL mRNA CTD PMID:39265716 Acadl Rat indometacin decreases expression EXP 6480464 Indomethacin results in decreased expression of ACADL mRNA CTD PMID:36868495 Acadl Rat inulin multiple interactions ISO Acadl (Mus musculus) 6480464 [perfluorooctane sulfonic acid co-treated with Inulin] results in increased expression of ACADL mRNA CTD PMID:36331819 Acadl Rat isoprenaline multiple interactions EXP 6480464 [Isoproterenol co-treated with POSTN protein] results in decreased expression of ACADL mRNA more ... CTD PMID:25045214 and PMID:30303030 Acadl Rat isoprenaline decreases expression EXP 6480464 Isoproterenol results in decreased expression of ACADL mRNA CTD PMID:25045214 Acadl Rat ivermectin decreases expression ISO ACADL (Homo sapiens) 6480464 Ivermectin results in decreased expression of ACADL protein CTD PMID:32959892 Acadl Rat ketoconazole increases expression EXP 6480464 Ketoconazole results in increased expression of ACADL mRNA CTD PMID:37077353 Acadl Rat L-ethionine affects expression EXP 6480464 Ethionine affects the expression of ACADL mRNA CTD PMID:19483382 Acadl Rat L-methionine multiple interactions ISO Acadl (Mus musculus) 6480464 [Choline deficiency co-treated with Methionine deficiency] results in increased expression of ACADL mRNA CTD PMID:25178843 Acadl Rat lead(0) decreases expression ISO ACADL (Homo sapiens) 6480464 Lead results in decreased expression of ACADL mRNA CTD PMID:19921347 Acadl Rat lipoic acid multiple interactions EXP 6480464 Thioctic Acid inhibits the reaction [Dietary Fats results in decreased expression of ACADL mRNA] CTD PMID:22464149 Acadl Rat meldonium increases expression ISO Acadl (Mus musculus) 6480464 3-(2 more ... CTD PMID:32389661 Acadl Rat methapyrilene decreases expression EXP 6480464 Methapyrilene results in decreased expression of ACADL mRNA CTD PMID:16393664 Acadl Rat methimazole increases expression EXP 6480464 Methimazole results in increased expression of ACADL mRNA CTD PMID:30047161 Acadl Rat microcystin-LR decreases expression ISO Acadl (Mus musculus) 6480464 cyanoginosin LR results in decreased expression of ACADL protein CTD PMID:26984711 Acadl Rat Monobutylphthalate increases expression ISO Acadl (Mus musculus) 6480464 monobutyl phthalate results in increased expression of ACADL mRNA CTD PMID:36736749 Acadl Rat monosodium L-glutamate multiple interactions ISO Acadl (Mus musculus) 6480464 [Sodium Glutamate co-treated with Trans Fatty Acids] results in increased expression of ACADL mRNA CTD PMID:19001666 Acadl Rat N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine decreases expression ISO ACADL (Homo sapiens) 6480464 N more ... CTD PMID:19637192 Acadl Rat N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine multiple interactions ISO ACADL (Homo sapiens) 6480464 Zinc inhibits the reaction [N more ... CTD PMID:19637192 Acadl Rat N-ethyl-N-nitrosourea increases expression EXP 6480464 Ethylnitrosourea results in increased expression of ACADL mRNA CTD PMID:15954086 Acadl Rat N-nitrosodiethylamine decreases expression EXP 6480464 Diethylnitrosamine results in decreased expression of ACADL mRNA CTD PMID:11323195 Acadl Rat N-nitrosomorpholine decreases expression EXP 6480464 N-nitrosomorpholine results in decreased expression of ACADL protein CTD PMID:19716841 Acadl Rat nickel atom decreases expression ISO ACADL (Homo sapiens) 6480464 Nickel results in decreased expression of ACADL mRNA CTD PMID:24768652 and PMID:25583101 Acadl Rat nitrates multiple interactions ISO Acadl (Mus musculus) 6480464 [Particulate Matter results in increased abundance of Nitrates] which results in increased expression of ACADL mRNA CTD PMID:35964746 Acadl Rat nitrofen increases expression EXP 6480464 nitrofen results in increased expression of ACADL mRNA CTD PMID:33484710 Acadl Rat oleic acid multiple interactions ISO ACADL (Homo sapiens) 6480464 [GW 4064 co-treated with Oleic Acid] results in decreased expression of ACADL mRNA and [GW 7647 co-treated with Oleic Acid] results in decreased expression of ACADL mRNA CTD PMID:30611723 Acadl Rat omeprazole affects expression EXP 6480464 Omeprazole affects the expression of ACADL mRNA CTD PMID:19483382 Acadl Rat paclitaxel decreases expression ISO ACADL (Homo sapiens) 6480464 Paclitaxel results in decreased expression of ACADL protein CTD PMID:15907983 Acadl Rat paracetamol multiple interactions ISO Acadl (Mus musculus) 6480464 [Clofibrate co-treated with Acetaminophen] affects the expression of ACADL mRNA and PPARA affects the reaction [[Clofibrate co-treated with Acetaminophen] affects the expression of ACADL mRNA] CTD PMID:17585979 Acadl Rat paracetamol decreases expression ISO ACADL (Homo sapiens) 6480464 Acetaminophen results in decreased expression of ACADL mRNA CTD PMID:29067470 Acadl Rat paracetamol increases expression ISO Acadl (Mus musculus) 6480464 Acetaminophen results in increased expression of ACADL protein CTD PMID:21329376 Acadl Rat paracetamol affects expression EXP 6480464 Acetaminophen affects the expression of ACADL protein CTD PMID:16687475 Acadl Rat paraquat affects expression EXP 6480464 Paraquat affects the expression of ACADL mRNA CTD PMID:18198484 Acadl Rat perfluorohexanesulfonic acid increases expression ISO Acadl (Mus musculus) 6480464 perfluorohexanesulfonic acid results in increased expression of ACADL mRNA CTD PMID:28558994 Acadl Rat perfluorononanoic acid increases expression ISO Acadl (Mus musculus) 6480464 perfluoro-n-nonanoic acid results in increased expression of ACADL mRNA CTD PMID:28558994 Acadl Rat perfluorooctane-1-sulfonic acid increases expression EXP 6480464 perfluorooctane sulfonic acid results in increased expression of ACADL mRNA CTD PMID:18692542 Acadl Rat perfluorooctane-1-sulfonic acid decreases expression ISO ACADL (Homo sapiens) 6480464 perfluorooctane sulfonic acid results in decreased expression of ACADL mRNA CTD PMID:38199259 Acadl Rat perfluorooctane-1-sulfonic acid multiple interactions ISO Acadl (Mus musculus) 6480464 [perfluorooctane sulfonic acid co-treated with Cellulose] results in increased expression of ACADL mRNA more ... CTD PMID:36331819 Acadl Rat perfluorooctane-1-sulfonic acid increases expression ISO Acadl (Mus musculus) 6480464 perfluorooctane sulfonic acid results in increased expression of ACADL mRNA CTD PMID:19429403 more ... Acadl Rat perfluorooctanoic acid increases expression EXP 6480464 perfluorooctanoic acid results in increased expression of ACADL mRNA CTD PMID:19162173 Acadl Rat perfluorooctanoic acid multiple interactions ISO Acadl (Mus musculus) 6480464 [perfluorooctanoic acid co-treated with Dietary Fats and Unsaturated] results in increased expression of ACADL mRNA CTD PMID:23626681 Acadl Rat perfluorooctanoic acid increases expression ISO Acadl (Mus musculus) 6480464 perfluorooctanoic acid results in increased expression of ACADL mRNA CTD PMID:17681415 more ... Acadl Rat perfluorooctanoic acid affects expression ISO Acadl (Mus musculus) 6480464 perfluorooctanoic acid affects the expression of ACADL mRNA CTD PMID:18281256 and PMID:19429403 Acadl Rat phenobarbital affects expression ISO ACADL (Homo sapiens) 6480464 Phenobarbital affects the expression of ACADL mRNA CTD PMID:19159669 Acadl Rat phenylmercury acetate increases expression ISO ACADL (Homo sapiens) 6480464 Phenylmercuric Acetate results in increased expression of ACADL mRNA CTD PMID:26272509 Acadl Rat phenylmercury acetate multiple interactions ISO ACADL (Homo sapiens) 6480464 [NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of ACADL mRNA CTD PMID:27188386 Acadl Rat phlorizin decreases expression ISO Acadl (Mus musculus) 6480464 Phlorhizin results in decreased expression of ACADL mRNA CTD PMID:22538082 Acadl Rat pirinixic acid multiple interactions ISO Acadl (Mus musculus) 6480464 [pirinixic acid binds to and results in increased activity of PPARA protein] which results in increased expression of ACADL mRNA more ... CTD PMID:17950772 more ... Acadl Rat pirinixic acid increases expression EXP 6480464 pirinixic acid results in increased expression of ACADL mRNA CTD PMID:19162173 more ... Acadl Rat pirinixic acid increases expression ISO Acadl (Mus musculus) 6480464 pirinixic acid results in increased expression of ACADL mRNA CTD PMID:15375163 more ... Acadl Rat pirinixic acid affects expression EXP 6480464 pirinixic acid affects the expression of ACADL mRNA CTD PMID:19483382 Acadl Rat progesterone increases expression EXP 6480464 Progesterone results in increased expression of ACADL mRNA CTD PMID:20726854 Acadl Rat resveratrol increases expression ISO Acadl (Mus musculus) 6480464 resveratrol results in increased expression of ACADL protein CTD PMID:25505154 Acadl Rat resveratrol multiple interactions EXP 6480464 Resveratrol inhibits the reaction [Dietary Fats results in decreased expression of ACADL mRNA] CTD PMID:36989710 Acadl Rat rotenone increases expression EXP 6480464 Rotenone results in increased expression of ACADL protein CTD PMID:35544339 Acadl Rat SB 431542 multiple interactions ISO ACADL (Homo sapiens) 6480464 [NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of ACADL mRNA CTD PMID:27188386 Acadl Rat sirolimus multiple interactions EXP 6480464 Sirolimus inhibits the reaction [Isoproterenol results in decreased expression of ACADL mRNA] and TNF protein inhibits the reaction [Sirolimus inhibits the reaction [Isoproterenol results in decreased expression of ACADL mRNA]] CTD PMID:25045214 Acadl Rat sodium dichromate increases expression EXP 6480464 sodium bichromate results in increased expression of ACADL mRNA CTD PMID:12325037 Acadl Rat sodium fluoride decreases expression ISO Acadl (Mus musculus) 6480464 Sodium Fluoride results in decreased expression of ACADL protein CTD PMID:28918527 Acadl Rat sodium nitrate multiple interactions ISO Acadl (Mus musculus) 6480464 sodium nitrate inhibits the reaction [Doxorubicin results in increased expression of ACADL protein] CTD PMID:21251210 Acadl Rat sulforaphane increases expression ISO Acadl (Mus musculus) 6480464 sulforaphane results in increased expression of ACADL mRNA CTD PMID:30529165 Acadl Rat sunitinib decreases expression ISO ACADL (Homo sapiens) 6480464 Sunitinib results in decreased expression of ACADL mRNA CTD PMID:31533062 Acadl Rat tacrolimus hydrate decreases expression ISO Acadl (Mus musculus) 6480464 Tacrolimus results in decreased expression of ACADL mRNA CTD PMID:25270620 Acadl Rat Tesaglitazar increases expression EXP 6480464 tesaglitazar results in increased expression of ACADL mRNA CTD PMID:21515302 Acadl Rat testosterone multiple interactions EXP 6480464 [Estradiol co-treated with Testosterone] results in increased expression of ACADL mRNA CTD PMID:11375906 Acadl Rat tetrachloroethene increases expression ISO Acadl (Mus musculus) 6480464 Tetrachloroethylene results in increased expression of ACADL mRNA CTD PMID:28973375 Acadl Rat tetrachloromethane multiple interactions EXP 6480464 schizandrin B inhibits the reaction [Carbon Tetrachloride results in decreased expression of ACADL mRNA] CTD PMID:31150632 Acadl Rat tetrachloromethane multiple interactions ISO Acadl (Mus musculus) 6480464 [Dietary Fats co-treated with Carbon Tetrachloride] results in increased expression of ACADL mRNA and alisol B inhibits the reaction [[Dietary Fats co-treated with Carbon Tetrachloride] results in increased expression of ACADL mRNA] CTD PMID:35745142 Acadl Rat tetrachloromethane decreases expression EXP 6480464 Carbon Tetrachloride results in decreased expression of ACADL mRNA CTD PMID:31150632 Acadl Rat tetracycline multiple interactions ISO Acadl (Mus musculus) 6480464 bicyclol inhibits the reaction [Tetracycline results in decreased expression of ACADL mRNA] CTD PMID:19427351 Acadl Rat tetracycline decreases expression ISO Acadl (Mus musculus) 6480464 Tetracycline results in decreased expression of ACADL mRNA CTD PMID:19427351 Acadl Rat thioacetamide affects expression EXP 6480464 Thioacetamide affects the expression of ACADL mRNA CTD PMID:19483382 Acadl Rat thioacetamide decreases expression EXP 6480464 Thioacetamide results in decreased expression of ACADL mRNA CTD PMID:34492290 Acadl Rat titanium dioxide decreases methylation ISO Acadl (Mus musculus) 6480464 titanium dioxide results in decreased methylation of ACADL gene CTD PMID:35295148 Acadl Rat tributylstannane increases expression ISO Acadl (Mus musculus) 6480464 tributyltin results in increased expression of ACADL mRNA CTD PMID:23428407 Acadl Rat trichloroacetic acid increases expression ISO Acadl (Mus musculus) 6480464 Trichloroacetic Acid results in increased expression of ACADL mRNA CTD PMID:23575800 Acadl Rat trichloroethene increases expression ISO Acadl (Mus musculus) 6480464 Trichloroethylene results in increased expression of ACADL mRNA CTD PMID:23575800 and PMID:28973375 Acadl Rat triclosan decreases expression ISO ACADL (Homo sapiens) 6480464 Triclosan results in decreased expression of ACADL mRNA CTD PMID:30510588 Acadl Rat troglitazone increases expression EXP 6480464 troglitazone results in increased expression of ACADL protein CTD PMID:21315101 Acadl Rat valproic acid decreases expression ISO ACADL (Homo sapiens) 6480464 Valproic Acid results in decreased expression of ACADL mRNA and Valproic Acid results in decreased expression of ACADL protein CTD PMID:29154799 and PMID:29501571 Acadl Rat zinc atom multiple interactions ISO ACADL (Homo sapiens) 6480464 Zinc inhibits the reaction [N more ... CTD PMID:19637192 Acadl Rat zinc atom multiple interactions ISO Acadl (Mus musculus) 6480464 [Ethanol co-treated with Zinc] results in increased expression of ACADL mRNA CTD PMID:19637192 Acadl Rat zinc(0) multiple interactions ISO ACADL (Homo sapiens) 6480464 Zinc inhibits the reaction [N more ... CTD PMID:19637192 Acadl Rat zinc(0) multiple interactions ISO Acadl (Mus musculus) 6480464 [Ethanol co-treated with Zinc] results in increased expression of ACADL mRNA CTD PMID:19637192 Acadl Rat zoledronic acid decreases expression ISO Acadl (Mus musculus) 6480464 zoledronic acid results in decreased expression of ACADL mRNA CTD PMID:28871336
Imported Annotations - SMPDB
Imported Annotations - KEGG (archival)
(+)-schisandrin B (EXP) (1->4)-beta-D-glucan (ISO) (R)-lipoic acid (EXP) 1,2-dimethylhydrazine (ISO) 17alpha-ethynylestradiol (ISO) 17beta-estradiol (EXP,ISO) 17beta-hydroxy-5alpha-androstan-3-one (ISO) 2,3,7,8-tetrachlorodibenzodioxine (EXP,ISO) 3,3',4,4'-tetrachlorobiphenyl (ISO) 4,4'-sulfonyldiphenol (ISO) 5-fluorouracil (ISO) 5-methoxy-2-\{[(4-methoxy-3,5-dimethylpyridin-2-yl)methyl]sulfinyl\}-1H-benzimidazole (EXP) 6-propyl-2-thiouracil (EXP) acetamide (EXP) aflatoxin B1 (ISO) aldehydo-D-glucose (ISO) Alisol B (ISO) amiodarone (EXP) amitrole (EXP) ammonium chloride (EXP) aniline (EXP) aripiprazole (EXP) Aroclor 1254 (ISO) arsenite(3-) (ISO) arsenous acid (ISO) benzbromarone (EXP) benzo[a]pyrene (ISO) beta-hexachlorocyclohexane (ISO) bezafibrate (ISO) bis(2-ethylhexyl) phthalate (EXP,ISO) bisphenol A (EXP,ISO) bisphenol F (ISO) cadmium atom (ISO) carbon nanotube (ISO) chlorpyrifos (ISO) choline (ISO) clofibrate (EXP,ISO) copper atom (EXP) copper(0) (EXP) cyclosporin A (EXP,ISO) D-glucose (ISO) dexamethasone (ISO) Di-n-hexyl phthalate (ISO) diarsenic trioxide (ISO) dibutyl phthalate (EXP) dichloroacetic acid (ISO) diethylstilbestrol (EXP) diuron (EXP) dorsomorphin (ISO) doxorubicin (EXP,ISO) ethanol (ISO) fenamidone (ISO) fenofibrate (ISO) flutamide (EXP,ISO) folic acid (ISO) fructose (EXP) furan (EXP) glucose (ISO) glyphosate (ISO) GW 4064 (ISO) GW 7647 (ISO) hexadecanoic acid (ISO) indometacin (EXP) inulin (ISO) isoprenaline (EXP) ivermectin (ISO) ketoconazole (EXP) L-ethionine (EXP) L-methionine (ISO) lead(0) (ISO) lipoic acid (EXP) meldonium (ISO) methapyrilene (EXP) methimazole (EXP) microcystin-LR (ISO) Monobutylphthalate (ISO) monosodium L-glutamate (ISO) N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine (ISO) N-ethyl-N-nitrosourea (EXP) N-nitrosodiethylamine (EXP) N-nitrosomorpholine (EXP) nickel atom (ISO) nitrates (ISO) nitrofen (EXP) oleic acid (ISO) omeprazole (EXP) paclitaxel (ISO) paracetamol (EXP,ISO) paraquat (EXP) perfluorohexanesulfonic acid (ISO) perfluorononanoic acid (ISO) perfluorooctane-1-sulfonic acid (EXP,ISO) perfluorooctanoic acid (EXP,ISO) phenobarbital (ISO) phenylmercury acetate (ISO) phlorizin (ISO) pirinixic acid (EXP,ISO) progesterone (EXP) resveratrol (EXP,ISO) rotenone (EXP) SB 431542 (ISO) sirolimus (EXP) sodium dichromate (EXP) sodium fluoride (ISO) sodium nitrate (ISO) sulforaphane (ISO) sunitinib (ISO) tacrolimus hydrate (ISO) Tesaglitazar (EXP) testosterone (EXP) tetrachloroethene (ISO) tetrachloromethane (EXP,ISO) tetracycline (ISO) thioacetamide (EXP) titanium dioxide (ISO) tributylstannane (ISO) trichloroacetic acid (ISO) trichloroethene (ISO) triclosan (ISO) troglitazone (EXP) valproic acid (ISO) zinc atom (ISO) zinc(0) (ISO) zoledronic acid (ISO)
1.
Phylogenetic-based propagation of functional annotations within the Gene Ontology consortium.
Gaudet P, etal., Brief Bioinform. 2011 Sep;12(5):449-62. doi: 10.1093/bib/bbr042. Epub 2011 Aug 27.
2.
Acyl-CoA dehydrogenases. A mechanistic overview.
Ghisla S and Thorpe C, Eur J Biochem. 2004 Feb;271(3):494-508.
3.
Rat ISS GO annotations from GOA human gene data--August 2006
GOA data from the GO Consortium
4.
Abnormal nonshivering thermogenesis in mice with inherited defects of fatty acid oxidation.
Guerra C, etal., J Clin Invest. 1998 Nov 1;102(9):1724-31. doi: 10.1172/JCI4532.
5.
Biosynthesis of four rat liver mitochondrial acyl-CoA dehydrogenases: in vitro synthesis, import into mitochondria, and processing of their precursors in a cell-free system and in cultured cells.
Ikeda Y, etal., Arch Biochem Biophys. 1987 Feb 1;252(2):662-74.
6.
Purification and characterization of short-chain, medium-chain, and long-chain acyl-CoA dehydrogenases from rat liver mitochondria. Isolation of the holo- and apoenzymes and conversion of the apoenzyme to the holoenzyme.
Ikeda Y, etal., J Biol Chem. 1985 Jan 25;260(2):1311-25.
7.
KEGG: Kyoto Encyclopedia of Genes and Genomes
KEGG
8.
High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence.
Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
9.
Molecular cloning and nucleotide sequence of cDNAs encoding the precursors of rat long chain acyl-coenzyme A, short chain acyl-coenzyme A, and isovaleryl-coenzyme A dehydrogenases. Sequence homology of four enzymes of the acyl-CoA dehydrogenase family.
Matsubara Y, etal., J Biol Chem 1989 Sep 25;264(27):16321-31.
10.
Rat ISS GO annotations from MGI mouse gene data--August 2006
MGD data from the GO Consortium
11.
Electronic Transfer of LocusLink and RefSeq Data
NCBI rat LocusLink and RefSeq merged data July 26, 2002
12.
KEGG Annotation Import Pipeline
Pipeline to import KEGG annotations from KEGG into RGD
13.
SMPDB Annotation Import Pipeline
Pipeline to import SMPDB annotations from SMPDB into RGD
14.
RefSeq and LocusLink: NCBI gene-centered resources
Pruitt KD and Maglott DR, Nucleic Acids Res. 2001 Jan 1;29(1):137-40.
15.
GOA pipeline
RGD automated data pipeline
16.
ClinVar Automated Import and Annotation Pipeline
RGD automated import pipeline for ClinVar variants, variant-to-disease annotations and gene-to-disease annotations
17.
Data Import for Chemical-Gene Interactions
RGD automated import pipeline for gene-chemical interactions
18.
Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences.
Strausberg RL, etal., Proc Natl Acad Sci U S A. 2002 Dec 24;99(26):16899-903. Epub 2002 Dec 11.
19.
Tentative Sequence Identification Numbers
Tentative Sequence Data IDs. TIGR Gene Index, Rat Data
20.
Cloning of a cDNA for short/branched chain acyl-Coenzyme A dehydrogenase from rat and characterization of its tissue expression and substrate specificity.
Willard J, etal., Arch Biochem Biophys 1996 Jul 1;331(1):127-33.
Acadl Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 9 75,783,689 - 75,822,077 (-) NCBI GRCr8 mRatBN7.2 9 68,333,981 - 68,372,149 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 9 68,333,980 - 68,372,220 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 9 76,823,956 - 76,861,404 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 9 81,952,887 - 81,990,335 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 9 80,351,815 - 80,389,588 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 9 73,833,368 - 73,871,857 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 9 73,833,388 - 73,871,888 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 9 73,434,371 - 73,472,895 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 9 65,613,130 - 65,651,775 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 9 65,760,111 - 65,798,754 (-) NCBI Celera 9 65,813,263 - 65,851,320 (-) NCBI Celera RH 3.4 Map 9 612.99 RGD Cytogenetic Map 9 q32 NCBI
ACADL Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 2 210,187,923 - 210,225,447 (-) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 2 210,187,126 - 210,225,447 (-) Ensembl GRCh38 hg38 GRCh38 GRCh37 2 211,052,647 - 211,090,171 (-) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 2 210,760,959 - 210,798,392 (-) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 2 210,878,223 - 210,915,653 NCBI Celera 2 204,820,713 - 204,858,229 (-) NCBI Celera Cytogenetic Map 2 q34 ENTREZGENE HuRef 2 202,897,948 - 202,935,464 (-) NCBI HuRef CHM1_1 2 211,058,802 - 211,096,307 (-) NCBI CHM1_1 T2T-CHM13v2.0 2 210,668,601 - 210,706,298 (-) NCBI T2T-CHM13v2.0
Acadl Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 1 66,869,998 - 66,902,468 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 1 66,869,998 - 66,902,436 (-) Ensembl GRCm39 Ensembl GRCm38 1 66,830,839 - 66,863,309 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 1 66,830,839 - 66,863,277 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 1 66,877,427 - 66,909,841 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 1 66,764,061 - 66,796,475 (-) NCBI MGSCv36 mm8 Celera 1 67,346,353 - 67,377,247 (-) NCBI Celera Cytogenetic Map 1 C3 NCBI cM Map 1 33.64 NCBI
Acadl Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955457 5,266,033 - 5,300,056 (+) Ensembl ChiLan1.0 ChiLan1.0 NW_004955457 5,266,032 - 5,300,632 (+) NCBI ChiLan1.0 ChiLan1.0
ACADL Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 13 112,810,225 - 112,849,103 (-) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 2B 112,824,820 - 112,864,084 (-) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 2B 97,445,421 - 97,483,514 (-) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 2B 215,847,775 - 215,885,524 (-) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 2B 215,847,775 - 215,885,524 (-) Ensembl panpan1.1 panPan2
ACADL Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 37 18,028,244 - 18,073,975 (-) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 37 18,017,087 - 18,073,862 (-) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 37 18,906,886 - 18,954,457 (-) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 37 17,964,225 - 18,011,748 (-) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 37 17,968,220 - 18,011,731 (-) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 37 17,917,084 - 17,964,271 (-) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 37 17,879,408 - 17,926,609 (-) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 37 17,894,240 - 17,941,487 (-) NCBI UU_Cfam_GSD_1.0
Acadl
ACADL Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 15 112,933,506 - 112,969,577 (-) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 15 112,935,631 - 112,969,381 (-) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 15 124,759,345 - 124,793,118 (-) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
ACADL Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 10 95,886,502 - 95,925,928 (-) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 10 95,887,465 - 95,925,578 (-) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666040 103,432,787 - 103,482,132 (+) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Acadl
.
Predicted Target Of
Count of predictions: 26 Count of miRNA genes: 24 Interacting mature miRNAs: 26 Transcripts: ENSRNOT00000017686 Prediction methods: Miranda, Rnahybrid, Targetscan Result types: miRGate_prediction
7411571 Bw138 Body weight QTL 138 14.3 0.001 body mass (VT:0001259) body weight gain (CMO:0000420) 9 32535505 77535505 Rat 11353957 Bmd92 Bone mineral density QTL 92 0.01 tibia mineral mass (VT:1000283) volumetric bone mineral density (CMO:0001553) 9 46114199 91114199 Rat 61385 Edpm9 Estrogen-dependent pituitary mass QTL 9 3.43 0.05 pituitary gland mass (VT:0010496) pituitary gland wet weight (CMO:0000853) 9 63869687 108869687 Rat 70218 Cm28 Cardiac mass QTL 28 8.3 0.0001 heart mass (VT:0007028) heart wet weight (CMO:0000069) 9 25268044 79271759 Rat 724544 Uae9 Urinary albumin excretion QTL 9 4.5 urine albumin amount (VT:0002871) urine albumin level (CMO:0000130) 9 25268044 114175309 Rat 1578760 Cm53 Cardiac mass QTL 53 3.3 0.0001 heart mass (VT:0007028) heart wet weight (CMO:0000069) 9 56771635 101771635 Rat 1581580 Uae34 Urinary albumin excretion QTL 34 urine albumin amount (VT:0002871) urine albumin excretion rate (CMO:0000757) 9 62072275 96470995 Rat 12879506 Pur33 Proteinuria QTL 33 urine total protein amount (VT:0000032) urine total protein excretion rate (CMO:0000756) 9 44649921 89649921 Rat 731164 Uae25 Urinary albumin excretion QTL 25 3.5 0.0001 urine albumin amount (VT:0002871) urine albumin excretion rate (CMO:0000757) 9 25661188 100929786 Rat 1598849 Memor17 Memory QTL 17 2.2 exploratory behavior trait (VT:0010471) difference between time of physical contact/close proximity of test subject and social stimulus during sample phase and test phase (CMO:0002678) 9 49968546 71098346 Rat 10058949 Gmadr5 Adrenal mass QTL 5 2 0.014 adrenal gland mass (VT:0010420) both adrenal glands wet weight to body weight ratio (CMO:0002411) 9 42791513 87976209 Rat 1578757 Pur6 Proteinuria QTL 6 3.3 0.005 urine total protein amount (VT:0000032) urine total protein excretion rate (CMO:0000756) 9 62072275 96470995 Rat 631656 Bp108 Blood pressure QTL 108 5.97 0.0001 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 9 48598251 93598251 Rat 2303170 Bp332 Blood pressure QTL 332 3.73 0.027 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 9 55847841 77026453 Rat 8662828 Vetf6 Vascular elastic tissue fragility QTL 6 3.9 artery integrity trait (VT:0010639) patent ductus arteriosus score (CMO:0002566) 9 36962359 92058970 Rat 61352 Bp34 Blood pressure QTL 34 5 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 9 42495343 79271511 Rat 724515 Uae16 Urinary albumin excretion QTL 16 8 urine albumin amount (VT:0002871) urine albumin excretion rate (CMO:0000757) 9 58163035 100929646 Rat 731171 Glom6 Glomerulus QTL 6 2.8 0.0003 kidney glomerulus morphology trait (VT:0005325) count of superficial glomeruli not directly contacting the kidney surface (CMO:0001002) 9 64573531 109573531 Rat 1598834 Memor11 Memory QTL 11 2.5 exploratory behavior trait (VT:0010471) average horizontal distance between subject and target during voluntary locomotion in an experimental apparatus (CMO:0002674) 9 36962359 77814038 Rat 70186 Niddm26 Non-insulin dependent diabetes mellitus QTL 26 3.87 blood glucose amount (VT:0000188) blood glucose level area under curve (AUC) (CMO:0000350) 9 22071169 86369743 Rat 7207814 Bmd91 Bone mineral density QTL 91 3.5 femur size trait (VT:1000369) femoral neck cross-sectional area (CMO:0001697) 9 23754144 83851531 Rat 6903941 Pur31 Proteinuria QTL 31 0.036 urine total protein amount (VT:0000032) urine protein excretion rate (CMO:0000759) 9 40194188 85194188 Rat 2303180 Bp333 Blood pressure QTL 333 0.001 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 9 56627713 78595166 Rat 2290450 Scl57 Serum cholesterol level QTL 57 4.15 blood cholesterol amount (VT:0000180) plasma total cholesterol level (CMO:0000585) 9 36962359 95410867 Rat 11353949 Bp393 Blood pressure QTL 393 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 9 40194188 85194188 Rat 11353951 Bp394 Blood pressure QTL 394 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 9 44649921 89649921 Rat 10054125 Srcrt7 Stress Responsive Cort QTL 7 3.33 0.0011 blood corticosterone amount (VT:0005345) plasma corticosterone level (CMO:0001173) 9 1 87073594 Rat 1300134 Bp185 Blood pressure QTL 185 3.73 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 9 61381434 104821652 Rat 7411656 Foco26 Food consumption QTL 26 9.8 0.001 eating behavior trait (VT:0001431) feed conversion ratio (CMO:0001312) 9 32535505 77535505 Rat 1641894 Alcrsp12 Alcohol response QTL 12 response to alcohol trait (VT:0010489) brain neurotensin receptor 1 density (CMO:0002068) 9 27468639 72468639 Rat
AW530440
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 9 68,371,430 - 68,371,643 (+) MAPPER mRatBN7.2 Rnor_6.0 9 73,871,139 - 73,871,351 NCBI Rnor6.0 Rnor_5.0 9 73,434,877 - 73,435,089 UniSTS Rnor5.0 RGSC_v3.4 9 65,651,057 - 65,651,269 UniSTS RGSC3.4 Celera 9 65,850,602 - 65,850,814 UniSTS RH 3.4 Map 9 597.4 UniSTS Cytogenetic Map 9 q32 UniSTS
RH142293
Rat Assembly Chr Position (strand) Source JBrowse Rnor_5.0 9 73,465,420 - 73,467,333 NCBI Rnor5.0 RGSC_v3.4 9 65,618,692 - 65,620,274 UniSTS RGSC3.4 Celera 9 65,818,825 - 65,820,407 UniSTS RH 3.4 Map 9 612.99 UniSTS Cytogenetic Map 9 q32 UniSTS
ACADL
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 9 68,362,611 - 68,362,737 (+) MAPPER mRatBN7.2 Rnor_6.0 9 73,862,321 - 73,862,446 NCBI Rnor6.0 Rnor_5.0 9 73,443,782 - 73,443,907 UniSTS Rnor5.0 RGSC_v3.4 9 65,642,239 - 65,642,364 UniSTS RGSC3.4 Celera 9 65,841,784 - 65,841,909 UniSTS Cytogenetic Map 9 q32 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
11
49
113
91
90
59
25
59
6
218
97
93
45
60
31
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000017686 ⟹ ENSRNOP00000017686
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 9 68,333,983 - 68,372,220 (-) Ensembl Rnor_6.0 Ensembl 9 73,833,388 - 73,871,888 (-) Ensembl
Ensembl Acc Id:
ENSRNOT00000118459 ⟹ ENSRNOP00000097339
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 9 68,333,980 - 68,367,608 (-) Ensembl
RefSeq Acc Id:
NM_012819 ⟹ NP_036951
RefSeq Status:
PROVISIONAL
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 9 75,783,689 - 75,821,854 (-) NCBI mRatBN7.2 9 68,333,981 - 68,372,149 (-) NCBI Rnor_6.0 9 73,833,368 - 73,871,857 (-) NCBI Rnor_5.0 9 73,434,371 - 73,472,895 (+) NCBI RGSC_v3.4 9 65,613,130 - 65,651,775 (-) RGD Celera 9 65,813,263 - 65,851,320 (-) RGD
Sequence:
CCGGCCATGGCTGCGCGCCTGCTCCTCCGCTCCCTTCGTGTCCTGAGCGCCCGCTCGGCGACACTCCCGCCGCCCTCCGCCCGATGTTCTCATTCTGGAGCAGAAGCACGTCTAGAAACTCCTTCTGC
hide sequence
RefSeq Acc Id:
XM_063266668 ⟹ XP_063122738
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 9 75,790,793 - 75,822,077 (-) NCBI
RefSeq Acc Id:
NP_036951 ⟸ NM_012819
- Peptide Label:
precursor
- UniProtKB:
P15650 (UniProtKB/Swiss-Prot), A6KFD6 (UniProtKB/TrEMBL), A0A8I6GMH0 (UniProtKB/TrEMBL)
- Sequence:
MAARLLLRSLRVLSARSATLPPPSARCSHSGAEARLETPSAKKLTDIGIRRIFSSEHDIFRESVRKFFQEEVIPYHEEWEKAGEVSRELWEKAGKQGLLGINIAEKHGGIGGDLLSTAVTWEEQAYSN
hide sequence
Ensembl Acc Id:
ENSRNOP00000017686 ⟸ ENSRNOT00000017686
Ensembl Acc Id:
ENSRNOP00000097339 ⟸ ENSRNOT00000118459
RefSeq Acc Id:
XP_063122738 ⟸ XM_063266668
- Peptide Label:
isoform X1
RGD ID: 13696724 Promoter ID: EPDNEW_R7249 Type: initiation region Name: Acadl_1 Description: acyl-CoA dehydrogenase, long chain SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Rat Assembly Chr Position (strand) Source Rnor_6.0 9 73,871,908 - 73,871,968 EPDNEW
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2011-07-28
Acadl
acyl-CoA dehydrogenase, long chain
Acadl
acyl-Coenzyme A dehydrogenase, long-chain
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2008-02-18
Acadl
acyl-Coenzyme A dehydrogenase, long-chain
Acadl
acetyl-Coenzyme A dehydrogenase, long-chain
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2003-04-09
Acadl
acetyl-Coenzyme A dehydrogenase, long-chain
Acyl Coenzyme A dehydrogenase, long chain
Name updated
629478 APPROVED
2002-06-10
Acadl
Acyl Coenzyme A dehydrogenase, long chain
Symbol and Name status set to approved
70586 APPROVED
Note Type
Note
Reference
gene_expression
expressed in liver
631718
gene_function
catalyzes the alpha,beta-dehydrogenation of acyl-CoA esters
631739
gene_homology
has high similarity to acyl-CoA dehydrogenase family members short chain acyl-CoA (SCAD), medium chain acyl-CoA dehydrogenase (MCAD), and isovaleryl-CoA dehydrogenase (IVD)
631718
gene_process
plays a role in fatty acid metabolism
631739
gene_product
member of the acyl-CoA dehydrogenase family
631718
gene_protein
430 amino acid sequence with 30 amino acid leader sequence and 400 amino acid residues in the mature protein
631718
