Symbol:
Aebp1
Name:
AE binding protein 1
RGD ID:
1306922
Description:
Predicted to enable several functions, including DNA-binding transcription repressor activity, RNA polymerase II-specific; carboxypeptidase activity; and collagen binding activity. Predicted to be involved in negative regulation of transcription by RNA polymerase II and regulation of collagen fibril organization. Predicted to be located in extracellular region. Human ortholog(s) of this gene implicated in Ehlers-Danlos syndrome classic-like 2. Orthologous to human AEBP1 (AE binding protein 1); INTERACTS WITH 1,2-dimethylhydrazine; 17alpha-ethynylestradiol; 17beta-estradiol.
Type:
protein-coding
RefSeq Status:
PROVISIONAL
Previously known as:
adipocyte enhancer-binding protein 1; AE-binding protein 1; aortic carboxypeptidase-like protein; LOC305494
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Species
Gene symbol and name
Data Source
Assertion derived from
less info ...
Orthologs 1
Homo sapiens (human):
AEBP1 (AE binding protein 1) HGNC
EggNOG, Ensembl, HomoloGene, Inparanoid, NCBI, OMA, OrthoDB, OrthoMCL, Panther, PhylomeDB, Treefam
Mus musculus (house mouse):
Aebp1 (AE binding protein 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chinchilla lanigera (long-tailed chinchilla):
Aebp1 (AE binding protein 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Pan paniscus (bonobo/pygmy chimpanzee):
AEBP1 (AE binding protein 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Canis lupus familiaris (dog):
AEBP1 (AE binding protein 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Ictidomys tridecemlineatus (thirteen-lined ground squirrel):
Aebp1 (AE binding protein 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Sus scrofa (pig):
AEBP1 (AE binding protein 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chlorocebus sabaeus (green monkey):
AEBP1 (AE binding protein 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Heterocephalus glaber (naked mole-rat):
Aebp1 (AE binding protein 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Alliance orthologs 3
Homo sapiens (human):
AEBP1 (AE binding protein 1)
Alliance
DIOPT (Ensembl Compara|HGNC|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Mus musculus (house mouse):
Aebp1 (AE binding protein 1)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Danio rerio (zebrafish):
aebp1 (AE binding protein 1)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Danio rerio (zebrafish):
si:ch1073-459j12.1
Alliance
DIOPT (Hieranoid|InParanoid|OrthoFinder|PANTHER|PhylomeDB)
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 14 84,951,577 - 84,962,840 (+) NCBI GRCr8 mRatBN7.2 14 80,738,800 - 80,748,878 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 14 80,738,892 - 80,748,877 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 14 85,140,975 - 85,150,961 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 14 86,381,063 - 86,391,049 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 14 82,830,385 - 82,840,371 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 14 86,101,253 - 86,111,323 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 14 86,101,277 - 86,111,306 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 14 86,792,909 - 86,802,767 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 14 86,525,748 - 86,535,664 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 14 86,544,861 - 86,554,594 (+) NCBI Celera 14 79,623,720 - 79,633,706 (+) NCBI Celera Cytogenetic Map 14 q21 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Aebp1 Rat 1,2-dimethylhydrazine multiple interactions EXP 6480464 [APC protein affects the susceptibility to 1 and 2-Dimethylhydrazine] which results in increased expression of AEBP1 mRNA CTD PMID:27840820 Aebp1 Rat 17alpha-ethynylestradiol decreases expression EXP 6480464 Ethinyl Estradiol results in decreased expression of AEBP1 mRNA CTD PMID:15576828 and PMID:17557909 Aebp1 Rat 17beta-estradiol multiple interactions ISO AEBP1 (Homo sapiens) 6480464 [Estradiol co-treated with TGFB1 protein] results in increased expression of AEBP1 mRNA CTD PMID:30165855 Aebp1 Rat 17beta-estradiol decreases expression EXP 6480464 Estradiol results in decreased expression of AEBP1 mRNA CTD PMID:32145629 Aebp1 Rat 2,3,7,8-tetrachlorodibenzodioxine affects expression ISO Aebp1 (Mus musculus) 6480464 Tetrachlorodibenzodioxin affects the expression of AEBP1 mRNA CTD PMID:21570461 Aebp1 Rat 2,3,7,8-tetrachlorodibenzodioxine affects expression EXP 6480464 Tetrachlorodibenzodioxin affects the expression of AEBP1 mRNA CTD PMID:34747641 Aebp1 Rat 2,3,7,8-tetrachlorodibenzodioxine decreases expression ISO Aebp1 (Mus musculus) 6480464 Tetrachlorodibenzodioxin results in decreased expression of AEBP1 mRNA CTD PMID:33956508 Aebp1 Rat 2,3,7,8-tetrachlorodibenzodioxine decreases expression EXP 6480464 Tetrachlorodibenzodioxin results in decreased expression of AEBP1 mRNA CTD PMID:32109520 Aebp1 Rat 2,4-dibromophenyl 2,4,5-tribromophenyl ether affects expression ISO Aebp1 (Mus musculus) 6480464 2 more ... CTD PMID:38648751 Aebp1 Rat 3,4-methylenedioxymethamphetamine decreases expression ISO Aebp1 (Mus musculus) 6480464 N-Methyl-3 and 4-methylenedioxyamphetamine results in decreased expression of AEBP1 mRNA CTD PMID:20188158 Aebp1 Rat 4,4'-sulfonyldiphenol increases expression ISO Aebp1 (Mus musculus) 6480464 bisphenol S results in increased expression of AEBP1 mRNA CTD PMID:30951980 Aebp1 Rat 4-hydroxyphenyl retinamide increases expression ISO Aebp1 (Mus musculus) 6480464 Fenretinide results in increased expression of AEBP1 mRNA CTD PMID:28973697 Aebp1 Rat 5-aza-2'-deoxycytidine multiple interactions EXP 6480464 [Decitabine affects the methylation of AEBP1 protein] which affects the expression of AEBP1 mRNA CTD PMID:18381416 Aebp1 Rat 5-aza-2'-deoxycytidine affects expression ISO AEBP1 (Homo sapiens) 6480464 Decitabine affects the expression of AEBP1 mRNA CTD PMID:17145863 Aebp1 Rat 6-propyl-2-thiouracil increases expression EXP 6480464 Propylthiouracil results in increased expression of AEBP1 mRNA CTD PMID:30047161 Aebp1 Rat allethrin multiple interactions EXP 6480464 [cypermethrin co-treated with decamethrin co-treated with fenvalerate co-treated with cyhalothrin co-treated with Allethrins] results in decreased expression of AEBP1 protein CTD PMID:34896426 Aebp1 Rat amitrole increases expression EXP 6480464 Amitrole results in increased expression of AEBP1 mRNA CTD PMID:30047161 Aebp1 Rat benzo[a]pyrene increases methylation ISO AEBP1 (Homo sapiens) 6480464 Benzo(a)pyrene results in increased methylation of AEBP1 3' UTR and Benzo(a)pyrene results in increased methylation of AEBP1 exon CTD PMID:27901495 Aebp1 Rat benzo[a]pyrene increases expression ISO AEBP1 (Homo sapiens) 6480464 Benzo(a)pyrene results in increased expression of AEBP1 mRNA CTD PMID:35870112 Aebp1 Rat beta-carotene multiple interactions ISO Aebp1 (Mus musculus) 6480464 [BCO1 protein affects the susceptibility to beta Carotene] which affects the expression of AEBP1 mRNA CTD PMID:24657404 Aebp1 Rat bis(2-ethylhexyl) phthalate decreases expression ISO AEBP1 (Homo sapiens) 6480464 Diethylhexyl Phthalate results in decreased expression of AEBP1 protein CTD PMID:31163220 Aebp1 Rat bisphenol A increases expression ISO Aebp1 (Mus musculus) 6480464 bisphenol A results in increased expression of AEBP1 mRNA CTD PMID:26063408 and PMID:30951980 Aebp1 Rat bisphenol A increases methylation EXP 6480464 bisphenol A results in increased methylation of AEBP1 gene CTD PMID:28505145 Aebp1 Rat bisphenol A multiple interactions EXP 6480464 [bisphenol A co-treated with Genistein] results in increased methylation of AEBP1 gene CTD PMID:28505145 Aebp1 Rat bisphenol A affects methylation ISO Aebp1 (Mus musculus) 6480464 bisphenol A affects the methylation of AEBP1 promoter CTD PMID:27334623 Aebp1 Rat bisphenol A decreases expression EXP 6480464 bisphenol A results in decreased expression of AEBP1 mRNA CTD PMID:30816183 more ... Aebp1 Rat bisphenol A affects expression EXP 6480464 bisphenol A affects the expression of AEBP1 mRNA CTD PMID:25181051 Aebp1 Rat bisphenol F increases expression ISO Aebp1 (Mus musculus) 6480464 bisphenol F results in increased expression of AEBP1 mRNA CTD PMID:30951980 Aebp1 Rat C60 fullerene increases expression EXP 6480464 fullerene C60 results in increased expression of AEBP1 mRNA CTD PMID:19167457 Aebp1 Rat cadmium atom multiple interactions ISO AEBP1 (Homo sapiens) 6480464 [Cadmium Chloride results in increased abundance of Cadmium] which results in decreased expression of AEBP1 mRNA CTD PMID:29741670 Aebp1 Rat cadmium dichloride increases methylation EXP 6480464 Cadmium Chloride results in increased methylation of AEBP1 promoter CTD PMID:22457795 Aebp1 Rat cadmium dichloride multiple interactions ISO AEBP1 (Homo sapiens) 6480464 [Cadmium Chloride results in increased abundance of Cadmium] which results in decreased expression of AEBP1 mRNA CTD PMID:29741670 Aebp1 Rat carnosic acid decreases expression ISO Aebp1 (Mus musculus) 6480464 salvin results in decreased expression of AEBP1 protein CTD PMID:35926579 Aebp1 Rat chlordecone increases expression ISO Aebp1 (Mus musculus) 6480464 Chlordecone results in increased expression of AEBP1 mRNA CTD PMID:33711761 Aebp1 Rat chloroprene increases expression EXP 6480464 Chloroprene results in increased expression of AEBP1 mRNA CTD PMID:23125180 Aebp1 Rat clotrimazole increases expression EXP 6480464 Clotrimazole results in increased expression of AEBP1 mRNA CTD PMID:30047161 Aebp1 Rat Cuprizon increases expression EXP 6480464 Cuprizone results in increased expression of AEBP1 mRNA CTD PMID:26577399 Aebp1 Rat cyhalothrin multiple interactions EXP 6480464 [cypermethrin co-treated with decamethrin co-treated with fenvalerate co-treated with cyhalothrin co-treated with Allethrins] results in decreased expression of AEBP1 protein CTD PMID:34896426 Aebp1 Rat cypermethrin multiple interactions EXP 6480464 [cypermethrin co-treated with decamethrin co-treated with fenvalerate co-treated with cyhalothrin co-treated with Allethrins] results in decreased expression of AEBP1 protein CTD PMID:34896426 Aebp1 Rat Dibutyl phosphate affects expression ISO AEBP1 (Homo sapiens) 6480464 di-n-butylphosphoric acid affects the expression of AEBP1 mRNA CTD PMID:37042841 Aebp1 Rat dibutyl phthalate decreases expression EXP 6480464 Dibutyl Phthalate results in decreased expression of AEBP1 mRNA CTD PMID:21266533 Aebp1 Rat diethylstilbestrol increases expression EXP 6480464 Diethylstilbestrol results in increased expression of AEBP1 mRNA CTD PMID:17005392 Aebp1 Rat disodium selenite multiple interactions ISO Aebp1 (Mus musculus) 6480464 [ptaquiloside co-treated with Sodium Selenite] results in decreased expression of AEBP1 mRNA CTD PMID:23274088 Aebp1 Rat diuron decreases expression EXP 6480464 Diuron results in decreased expression of AEBP1 mRNA CTD PMID:25152437 Aebp1 Rat doxorubicin affects expression ISO AEBP1 (Homo sapiens) 6480464 Doxorubicin affects the expression of AEBP1 mRNA CTD PMID:29803840 Aebp1 Rat fenvalerate multiple interactions EXP 6480464 [cypermethrin co-treated with decamethrin co-treated with fenvalerate co-treated with cyhalothrin co-treated with Allethrins] results in decreased expression of AEBP1 protein CTD PMID:34896426 Aebp1 Rat folic acid increases expression ISO Aebp1 (Mus musculus) 6480464 Folic Acid results in increased expression of AEBP1 mRNA CTD PMID:25629700 Aebp1 Rat furan increases expression EXP 6480464 furan results in increased expression of AEBP1 mRNA CTD PMID:27387713 Aebp1 Rat genistein multiple interactions EXP 6480464 [bisphenol A co-treated with Genistein] results in increased methylation of AEBP1 gene CTD PMID:28505145 Aebp1 Rat indinavir multiple interactions ISO Aebp1 (Mus musculus) 6480464 [Zidovudine co-treated with Lamivudine co-treated with Indinavir] results in increased expression of AEBP1 mRNA CTD PMID:16931933 Aebp1 Rat indole-3-methanol affects expression EXP 6480464 indole-3-carbinol affects the expression of AEBP1 mRNA CTD PMID:21396975 Aebp1 Rat lamivudine multiple interactions ISO Aebp1 (Mus musculus) 6480464 [Zidovudine co-treated with Lamivudine co-treated with Indinavir] results in increased expression of AEBP1 mRNA more ... CTD PMID:16931933 Aebp1 Rat lead diacetate increases expression EXP 6480464 lead acetate results in increased expression of AEBP1 mRNA CTD PMID:22641619 Aebp1 Rat methimazole increases expression EXP 6480464 Methimazole results in increased expression of AEBP1 mRNA CTD PMID:30047161 Aebp1 Rat N-methyl-4-phenylpyridinium increases expression ISO AEBP1 (Homo sapiens) 6480464 1-Methyl-4-phenylpyridinium results in increased expression of AEBP1 mRNA CTD PMID:24810058 Aebp1 Rat N-nitrosodiethylamine increases expression ISO Aebp1 (Mus musculus) 6480464 Diethylnitrosamine results in increased expression of AEBP1 mRNA CTD PMID:24535843 Aebp1 Rat oxaliplatin increases expression EXP 6480464 oxaliplatin results in increased expression of AEBP1 mRNA CTD PMID:25729387 Aebp1 Rat oxaliplatin multiple interactions EXP 6480464 [oxaliplatin co-treated with Topotecan] results in increased expression of AEBP1 mRNA CTD PMID:25729387 Aebp1 Rat ozone multiple interactions ISO Aebp1 (Mus musculus) 6480464 [Air Pollutants results in increased abundance of [Ozone co-treated with Soot]] which results in decreased expression of AEBP1 mRNA CTD PMID:34911549 Aebp1 Rat Ptaquiloside multiple interactions ISO Aebp1 (Mus musculus) 6480464 [ptaquiloside co-treated with Sodium Selenite] results in decreased expression of AEBP1 mRNA CTD PMID:23274088 Aebp1 Rat Ptaquiloside decreases expression ISO Aebp1 (Mus musculus) 6480464 ptaquiloside results in decreased expression of AEBP1 mRNA CTD PMID:23274088 Aebp1 Rat pyrethrins decreases expression EXP 6480464 Pyrethrins results in decreased expression of AEBP1 protein CTD PMID:34896426 Aebp1 Rat raloxifene increases expression EXP 6480464 Raloxifene Hydrochloride results in increased expression of AEBP1 mRNA CTD PMID:15576828 Aebp1 Rat Salinomycin decreases expression ISO AEBP1 (Homo sapiens) 6480464 salinomycin results in decreased expression of AEBP1 mRNA CTD PMID:19682730 Aebp1 Rat saquinavir multiple interactions ISO Aebp1 (Mus musculus) 6480464 [Zidovudine co-treated with Lamivudine co-treated with Saquinavir] results in increased expression of AEBP1 mRNA CTD PMID:16931933 Aebp1 Rat silver atom increases expression ISO Aebp1 (Mus musculus) 6480464 Silver results in increased expression of AEBP1 mRNA CTD PMID:27131904 Aebp1 Rat silver(0) increases expression ISO Aebp1 (Mus musculus) 6480464 Silver results in increased expression of AEBP1 mRNA CTD PMID:27131904 Aebp1 Rat Soman increases expression EXP 6480464 Soman results in increased expression of AEBP1 mRNA CTD PMID:19281266 Aebp1 Rat sulfadimethoxine increases expression EXP 6480464 Sulfadimethoxine results in increased expression of AEBP1 mRNA CTD PMID:30047161 Aebp1 Rat tetrachloromethane increases expression ISO Aebp1 (Mus musculus) 6480464 Carbon Tetrachloride results in increased expression of AEBP1 mRNA CTD PMID:17484886 Aebp1 Rat thioacetamide increases expression EXP 6480464 Thioacetamide results in increased expression of AEBP1 mRNA CTD PMID:34492290 Aebp1 Rat titanium dioxide decreases expression ISO Aebp1 (Mus musculus) 6480464 titanium dioxide results in decreased expression of AEBP1 mRNA CTD PMID:23557971 Aebp1 Rat titanium dioxide decreases methylation ISO Aebp1 (Mus musculus) 6480464 titanium dioxide results in decreased methylation of AEBP1 gene and titanium dioxide results in decreased methylation of AEBP1 promoter CTD PMID:35295148 Aebp1 Rat topotecan multiple interactions EXP 6480464 [oxaliplatin co-treated with Topotecan] results in increased expression of AEBP1 mRNA CTD PMID:25729387 Aebp1 Rat topotecan increases expression EXP 6480464 Topotecan results in increased expression of AEBP1 mRNA CTD PMID:25729387 Aebp1 Rat triphenyl phosphate affects expression ISO AEBP1 (Homo sapiens) 6480464 triphenyl phosphate affects the expression of AEBP1 mRNA CTD PMID:37042841 Aebp1 Rat valproic acid affects expression ISO AEBP1 (Homo sapiens) 6480464 Valproic Acid affects the expression of AEBP1 mRNA CTD PMID:25979313 Aebp1 Rat valproic acid increases expression EXP 6480464 Valproic Acid results in increased expression of AEBP1 mRNA CTD PMID:29427782 Aebp1 Rat valproic acid decreases expression ISO AEBP1 (Homo sapiens) 6480464 Valproic Acid results in decreased expression of AEBP1 mRNA CTD PMID:29154799 Aebp1 Rat vancomycin decreases expression ISO Aebp1 (Mus musculus) 6480464 Vancomycin results in decreased expression of AEBP1 mRNA CTD PMID:18930951 Aebp1 Rat vinclozolin affects expression EXP 6480464 vinclozolin affects the expression of AEBP1 mRNA CTD PMID:19015723 Aebp1 Rat vitamin E increases expression ISO AEBP1 (Homo sapiens) 6480464 Vitamin E results in increased expression of AEBP1 mRNA CTD PMID:19244175 Aebp1 Rat zidovudine multiple interactions ISO Aebp1 (Mus musculus) 6480464 [Zidovudine co-treated with Lamivudine co-treated with Indinavir] results in increased expression of AEBP1 mRNA more ... CTD PMID:16931933
1,2-dimethylhydrazine (EXP) 17alpha-ethynylestradiol (EXP) 17beta-estradiol (EXP,ISO) 2,3,7,8-tetrachlorodibenzodioxine (EXP,ISO) 2,4-dibromophenyl 2,4,5-tribromophenyl ether (ISO) 3,4-methylenedioxymethamphetamine (ISO) 4,4'-sulfonyldiphenol (ISO) 4-hydroxyphenyl retinamide (ISO) 5-aza-2'-deoxycytidine (EXP,ISO) 6-propyl-2-thiouracil (EXP) allethrin (EXP) amitrole (EXP) benzo[a]pyrene (ISO) beta-carotene (ISO) bis(2-ethylhexyl) phthalate (ISO) bisphenol A (EXP,ISO) bisphenol F (ISO) C60 fullerene (EXP) cadmium atom (ISO) cadmium dichloride (EXP,ISO) carnosic acid (ISO) chlordecone (ISO) chloroprene (EXP) clotrimazole (EXP) Cuprizon (EXP) cyhalothrin (EXP) cypermethrin (EXP) Dibutyl phosphate (ISO) dibutyl phthalate (EXP) diethylstilbestrol (EXP) disodium selenite (ISO) diuron (EXP) doxorubicin (ISO) fenvalerate (EXP) folic acid (ISO) furan (EXP) genistein (EXP) indinavir (ISO) indole-3-methanol (EXP) lamivudine (ISO) lead diacetate (EXP) methimazole (EXP) N-methyl-4-phenylpyridinium (ISO) N-nitrosodiethylamine (ISO) oxaliplatin (EXP) ozone (ISO) Ptaquiloside (ISO) pyrethrins (EXP) raloxifene (EXP) Salinomycin (ISO) saquinavir (ISO) silver atom (ISO) silver(0) (ISO) Soman (EXP) sulfadimethoxine (EXP) tetrachloromethane (ISO) thioacetamide (EXP) titanium dioxide (ISO) topotecan (EXP) triphenyl phosphate (ISO) valproic acid (EXP,ISO) vancomycin (ISO) vinclozolin (EXP) vitamin E (ISO) zidovudine (ISO)
Aebp1 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 14 84,951,577 - 84,962,840 (+) NCBI GRCr8 mRatBN7.2 14 80,738,800 - 80,748,878 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 14 80,738,892 - 80,748,877 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 14 85,140,975 - 85,150,961 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 14 86,381,063 - 86,391,049 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 14 82,830,385 - 82,840,371 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 14 86,101,253 - 86,111,323 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 14 86,101,277 - 86,111,306 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 14 86,792,909 - 86,802,767 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 14 86,525,748 - 86,535,664 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 14 86,544,861 - 86,554,594 (+) NCBI Celera 14 79,623,720 - 79,633,706 (+) NCBI Celera Cytogenetic Map 14 q21 NCBI
AEBP1 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 7 44,104,345 - 44,114,560 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 7 44,104,345 - 44,114,562 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 7 44,143,944 - 44,154,159 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 7 44,110,485 - 44,120,684 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 7 43,917,199 - 43,927,398 NCBI Celera 7 44,241,911 - 44,252,113 (+) NCBI Celera Cytogenetic Map 7 p13 NCBI HuRef 7 44,029,222 - 44,039,430 (+) NCBI HuRef CHM1_1 7 44,147,805 - 44,158,013 (+) NCBI CHM1_1 T2T-CHM13v2.0 7 44,259,944 - 44,273,091 (+) NCBI T2T-CHM13v2.0 CRA_TCAGchr7v2 7 44,183,452 - 44,193,659 (+) NCBI
Aebp1 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 11 5,806,085 - 5,822,248 (+) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 11 5,811,947 - 5,822,088 (+) Ensembl GRCm39 Ensembl GRCm38 11 5,861,866 - 5,872,248 (+) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 11 5,861,947 - 5,872,088 (+) Ensembl GRCm38 mm10 GRCm38 MGSCv37 11 5,761,869 - 5,772,228 (+) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 11 5,761,950 - 5,772,053 (+) NCBI MGSCv36 mm8 Celera 11 6,353,502 - 6,363,861 (+) NCBI Celera Cytogenetic Map 11 A1 NCBI cM Map 11 3.88 NCBI
Aebp1 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955456 7,860,414 - 7,868,337 (-) Ensembl ChiLan1.0 ChiLan1.0 NW_004955456 7,860,191 - 7,868,526 (-) NCBI ChiLan1.0 ChiLan1.0
AEBP1 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 6 49,015,597 - 49,026,069 (+) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 7 97,340,494 - 97,350,827 (+) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 7 44,818,620 - 44,828,914 (+) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 7 44,886,238 - 44,896,194 (+) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 7 44,886,238 - 44,896,194 (+) Ensembl panpan1.1 panPan2
AEBP1 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Dog10K_Boxer_Tasha 16 2,045,084 - 2,054,558 (+) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 16 14,807,414 - 14,816,892 (-) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 16 14,807,398 - 14,817,822 (-) Ensembl ROS_Cfam_1.0 Ensembl UNSW_CanFamBas_1.0 16 14,438,625 - 14,448,091 (-) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 16 14,419,106 - 14,428,582 (-) NCBI UU_Cfam_GSD_1.0
Aebp1 Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024405118 99,853,346 - 99,863,052 (+) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936478 19,065,441 - 19,074,541 (+) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936478 19,065,092 - 19,074,783 (+) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
AEBP1 Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 18 51,046,899 - 51,056,698 (-) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 18 51,046,895 - 51,056,789 (-) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 18 55,940,587 - 55,950,114 (-) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
AEBP1 Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 21 14,553,441 - 14,563,599 (-) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 21 14,553,744 - 14,563,399 (-) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666062 7,951,209 - 7,961,621 (+) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Aebp1
.
Predicted Target Of
Count of predictions: 124 Count of miRNA genes: 97 Interacting mature miRNAs: 104 Transcripts: ENSRNOT00000018846 Prediction methods: Microtar, Miranda, Rnahybrid, Targetscan Result types: miRGate_prediction
2313089 Bss81 Bone structure and strength QTL 81 3.4 0.0001 body length (VT:0001256) body length, nose to rump (CMO:0000079) 14 37669719 82669719 Rat 9590294 Uminl4 Urine mineral level QTL 4 5.66 0.001 urine mineral amount (VT:0015086) urine electrolyte level (CMO:0000593) 14 55624247 100624247 Rat 1582236 Gluco22 Glucose level QTL 22 3.3 0.0164 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 14 73415323 92554092 Rat 631213 Bw60 Body weight QTL60 4.51 retroperitoneal fat pad mass (VT:0010430) retroperitoneal fat pad weight to body weight ratio (CMO:0000635) 14 79950921 95876975 Rat 2300197 Scl59 Serum cholesterol level QTL 59 blood cholesterol amount (VT:0000180) serum total cholesterol level (CMO:0000363) 14 55147478 100147478 Rat 70153 Bp59 Blood pressure QTL 59 3.2 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 14 68757796 83368335 Rat 70187 Pancm5 Pancreatic morphology QTL 5 16.7 pancreas mass (VT:0010144) pancreas weight to body weight ratio (CMO:0000630) 14 30320092 80829842 Rat 631523 Pia13 Pristane induced arthritis QTL 13 3.3 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 14 40793460 98037301 Rat 1582259 Gluco23 Glucose level QTL 23 3.1 0.0008 blood glucose amount (VT:0000188) blood glucose level area under curve (AUC) (CMO:0000350) 14 70053989 104886043 Rat 1582197 Gluco27 Glucose level QTL 27 3.4 0.0006 blood glucose amount (VT:0000188) blood glucose level area under curve (AUC) (CMO:0000350) 14 73415323 92554092 Rat 2313100 Bss82 Bone structure and strength QTL 82 3 0.0001 tibia size trait (VT:0100001) tibia midshaft cross-sectional area (CMO:0001717) 14 37669719 82669719 Rat 634328 Hc5 Hypercalciuria QTL 5 2.3 urine calcium amount (VT:0002985) urine calcium excretion rate (CMO:0000763) 14 58184885 103184885 Rat 1582250 Gluco26 Glucose level QTL 26 3.3 0.0009 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 14 73415323 95876975 Rat 2317879 Alcrsp27 Alcohol response QTL 27 3.3 0.63 response to alcohol trait (VT:0010489) duration of loss of righting reflex (CMO:0002289) 14 56631369 101631369 Rat 1641900 Alcrsp11 Alcohol response QTL 11 alcohol metabolism trait (VT:0015089) blood ethanol level (CMO:0000535) 14 70053989 104886043 Rat 631839 Niddm37 Non-insulin dependent diabetes mellitus QTL 37 3.37 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 14 11030622 95876975 Rat 1582255 Gluco29 Glucose level QTL 29 3.1 0.0025 blood glucose amount (VT:0000188) absolute change in blood glucose level area under curve (CMO:0002034) 14 73415323 92554092 Rat 9589034 Epfw11 Epididymal fat weight QTL 11 6 0.001 epididymal fat pad mass (VT:0010421) epididymal fat pad weight to body weight ratio (CMO:0000658) 14 55624247 100624247 Rat 1582209 Gluco20 Glucose level QTL 20 3.8 0.0005 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 14 73415323 92554092 Rat 2313048 Bss84 Bone structure and strength QTL 84 3.1 0.0001 tibia strength trait (VT:1000284) tibia total energy absorbed before break (CMO:0001736) 14 37669719 82669719 Rat 1300136 Rf22 Renal function QTL 22 3.9 renal blood flow trait (VT:2000006) absolute change in renal vascular resistance (CMO:0001900) 14 42262529 95023211 Rat 1549834 Scl45 Serum cholesterol level QTL 45 5.8 blood cholesterol amount (VT:0000180) serum total cholesterol level (CMO:0000363) 14 50023211 95023211 Rat 738037 Hcas6 Hepatocarcinoma susceptibility QTL 6 2.93 liver integrity trait (VT:0010547) liver nonremodeling tumorous lesion volume to total liver volume ratio (CMO:0001464) 14 39057237 83368335 Rat 2313084 Bss83 Bone structure and strength QTL 83 2.9 0.0001 tibia size trait (VT:0100001) tibia midshaft endosteal cross-sectional area (CMO:0001716) 14 37669719 82669719 Rat
RH130406
Rat Assembly Chr Position (strand) Source JBrowse GRCr8 14 84,962,637 - 84,962,822 (+) Marker Load Pipeline mRatBN7.2 14 80,748,674 - 80,748,860 (+) MAPPER mRatBN7.2 Rnor_6.0 14 86,111,120 - 86,111,305 NCBI Rnor6.0 Rnor_5.0 14 86,802,564 - 86,802,749 UniSTS Rnor5.0 RGSC_v3.4 14 86,535,461 - 86,535,646 UniSTS RGSC3.4 Celera 14 79,633,503 - 79,633,688 UniSTS RH 3.4 Map 14 573.4 UniSTS Cytogenetic Map 14 q21 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
11
49
113
91
90
59
25
59
6
218
97
93
45
60
31
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000018846 ⟹ ENSRNOP00000018846
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 14 80,738,892 - 80,748,877 (+) Ensembl Rnor_6.0 Ensembl 14 86,101,277 - 86,111,306 (+) Ensembl
RefSeq Acc Id:
NM_001100970 ⟹ NP_001094440
RefSeq Status:
PROVISIONAL
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 14 84,952,854 - 84,962,840 (+) NCBI mRatBN7.2 14 80,738,892 - 80,748,878 (+) NCBI Rnor_6.0 14 86,101,332 - 86,111,323 (+) NCBI Rnor_5.0 14 86,792,909 - 86,802,767 (+) NCBI RGSC_v3.4 14 86,525,748 - 86,535,664 (+) RGD Celera 14 79,623,720 - 79,633,706 (+) RGD
Sequence:
CGGAGCTGGGCTCGCCAGAACCTCTCTCGGAATCCCCTTGAATCTCTCTCCCCCACCCCTTTCTGGATACCCTCGACGTCCACGTTGCTCCCCAGGGTTCCTCACGCCCTTTCCCGCCCCCACGCGGG
hide sequence
RefSeq Acc Id:
XM_006251316 ⟹ XP_006251378
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 14 84,952,759 - 84,962,840 (+) NCBI mRatBN7.2 14 80,738,800 - 80,748,875 (+) NCBI Rnor_6.0 14 86,101,253 - 86,111,320 (+) NCBI Rnor_5.0 14 86,792,909 - 86,802,767 (+) NCBI
Sequence:
CGGCCAGGCCGTCGCAAGCACTCCAGAGGGCGGTCCGCGTGAGAGCTAGCCACGCGGGGTAGGAGCGCCCATTTGCCGCCGGAGCTGGGCTCGCCAGAACCTCTCTCGGAATCCCCTTGAATCTCTCT
hide sequence
RefSeq Acc Id:
XM_063273226 ⟹ XP_063129296
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 14 84,951,577 - 84,962,840 (+) NCBI
RefSeq Acc Id:
NP_001094440 ⟸ NM_001100970
- Peptide Label:
precursor
- UniProtKB:
A2RUV9 (UniProtKB/Swiss-Prot), A6IKQ1 (UniProtKB/TrEMBL)
- Sequence:
MAAVRTASLLCGLLALLALCPEGSPQTVLTDDEIQEFLEGFLSEFETQSPPREDDVEAQPLPEPTQRARKSKAGGKPRADAEAPPEKNKDKEKKGKKDKGPKAAKHLEGSTRPTKKPKEKPPKATKKP
hide sequence
RefSeq Acc Id:
XP_006251378 ⟸ XM_006251316
- Peptide Label:
isoform X2
- UniProtKB:
A0A0H2UHL3 (UniProtKB/TrEMBL), A6IKQ1 (UniProtKB/TrEMBL)
- Sequence:
MAAVRTASLLCGLLALLALCPEGSPQTVLTDDEIQEFLEGFLSEFETQSPPREDDVEAQPLPEPTQRARKSKAGGKPRADAEAPPEKNKDKEKKGKKDKGPKAAKHLEGSTRPTKKPKEKPPKATKKP
hide sequence
Ensembl Acc Id:
ENSRNOP00000018846 ⟸ ENSRNOT00000018846
RefSeq Acc Id:
XP_063129296 ⟸ XM_063273226
- Peptide Label:
isoform X1
- UniProtKB:
A2RUV9 (UniProtKB/Swiss-Prot), A6IKQ1 (UniProtKB/TrEMBL)
RGD ID: 13699464 Promoter ID: EPDNEW_R9988 Type: initiation region Name: Aebp1_1 Description: AE binding protein 1 SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Rat Assembly Chr Position (strand) Source Rnor_6.0 14 86,101,327 - 86,101,387 EPDNEW
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2008-04-30
Aebp1
AE binding protein 1
Aebp1_predicted
AE binding protein 1 (predicted)
'predicted' is removed
2292626 APPROVED
2005-01-12
Aebp1_predicted
AE binding protein 1 (predicted)
Symbol and Name status set to approved
70820 APPROVED
