Symbol:
Atp5f1b
Name:
ATP synthase F1 subunit beta
RGD ID:
621368
Description:
Enables several functions, including adenyl ribonucleotide binding activity; calcium ion binding activity; and proton-transporting ATP synthase activity, rotational mechanism. Contributes to ATP hydrolysis activity. Involved in several processes, including cellular response to peptide; cold acclimation; and response to 3,3',5-triiodo-L-thyronine. Located in cell surface; membrane raft; and mitochondrial inner membrane. Part of proton-transporting ATP synthase complex. Used to study obesity. Biomarker of cardiomyopathy; polycystic ovary syndrome; transient cerebral ischemia; and type 2 diabetes mellitus. Orthologous to human ATP5F1B (ATP synthase F1 subunit beta); PARTICIPATES IN electron transport chain pathway; Alzheimer's disease pathway; Huntington's disease pathway; INTERACTS WITH 1,1,1-Trichloro-2-(o-chlorophenyl)-2-(p-chlorophenyl)ethane; 1,3-dinitrobenzene; 17alpha-ethynylestradiol.
Type:
protein-coding
RefSeq Status:
VALIDATED
Previously known as:
ATP synthase subunit beta, mitochondrial; ATP synthase, H+ transporting mitochondrial F1 complex, beta subunit; ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide; Atp5b; mitochondrial ATP synthase beta subunit
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Species
Gene symbol and name
Data Source
Assertion derived from
less info ...
Orthologs 1
Homo sapiens (human):
ATP5F1B (ATP synthase F1 subunit beta) HGNC
EggNOG, Ensembl, HomoloGene, Inparanoid, NCBI, OMA, OrthoDB, OrthoMCL, Panther, Treefam
Mus musculus (house mouse):
Atp5f1b (ATP synthase F1 subunit beta) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chinchilla lanigera (long-tailed chinchilla):
Atp5f1b (ATP synthase F1 subunit beta) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Pan paniscus (bonobo/pygmy chimpanzee):
ATP5F1B (ATP synthase F1 subunit beta) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Canis lupus familiaris (dog):
ATP5F1B (ATP synthase F1 subunit beta) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Ictidomys tridecemlineatus (thirteen-lined ground squirrel):
Atp5f1b (ATP synthase F1 subunit beta) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Sus scrofa (pig):
ATP5F1B (ATP synthase F1 subunit beta) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chlorocebus sabaeus (green monkey):
ATP5F1B (ATP synthase F1 subunit beta) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Heterocephalus glaber (naked mole-rat):
Atp5f1b (ATP synthase F1 subunit beta) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Alliance orthologs 3
Homo sapiens (human):
ATP5F1B (ATP synthase F1 subunit beta)
Alliance
DIOPT (Ensembl Compara|HGNC|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Mus musculus (house mouse):
Atp5f1b (ATP synthase F1 subunit beta)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Danio rerio (zebrafish):
atp5f1b
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Saccharomyces cerevisiae (baker's yeast):
ATP2
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Drosophila melanogaster (fruit fly):
ATPsynbeta
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Caenorhabditis elegans (roundworm):
atp-2
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Xenopus tropicalis (tropical clawed frog):
atp5f1b
Alliance
DIOPT (Ensembl Compara|OMA|OrthoFinder|PANTHER|PhylomeDB)
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 7 1,100,058 - 1,106,461 (+) NCBI GRCr8 mRatBN7.2 7 515,454 - 521,858 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 7 515,460 - 567,273 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 7 3,274,116 - 3,280,516 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 7 5,150,130 - 5,156,530 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 7 5,451,361 - 5,457,743 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 7 2,504,708 - 2,511,748 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 7 2,504,695 - 2,511,749 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 7 2,484,095 - 2,490,338 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 7 1,376,552 - 1,383,228 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 7 1,377,178 - 1,383,228 (+) NCBI Celera 7 394,648 - 401,125 (+) NCBI Celera Cytogenetic Map 7 q11 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Atp5f1b Rat (+)-dexrazoxane decreases expression ISO Atp5f1b (Mus musculus) 6480464 Dexrazoxane results in decreased expression of ATP5F1B mRNA CTD PMID:26873546 Atp5f1b Rat (Z)-3-butylidenephthalide decreases expression ISO ATP5F1B (Homo sapiens) 6480464 butylidenephthalide results in decreased expression of ATP5F1B protein CTD PMID:23770345 Atp5f1b Rat 1,1,1-Trichloro-2-(o-chlorophenyl)-2-(p-chlorophenyl)ethane increases expression EXP 6480464 o and p'-DDT results in increased expression of ATP5F1B mRNA CTD PMID:24096037 Atp5f1b Rat 1,1,1-Trichloro-2-(o-chlorophenyl)-2-(p-chlorophenyl)ethane increases expression ISO Atp5f1b (Mus musculus) 6480464 o and p'-DDT results in increased expression of ATP5F1B mRNA CTD PMID:24096037 Atp5f1b Rat 1,2-dimethylhydrazine increases expression ISO Atp5f1b (Mus musculus) 6480464 1 and 2-Dimethylhydrazine results in increased expression of ATP5F1B mRNA CTD PMID:22206623 Atp5f1b Rat 1,3-dinitrobenzene increases metabolic processing EXP 6480464 3-dinitrobenzene results in increased metabolism of ATP5F1B protein CTD PMID:21402099 Atp5f1b Rat 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine multiple interactions ISO Atp5f1b (Mus musculus) 6480464 Levodopa inhibits the reaction [1-Methyl-4-phenyl-1 more ... CTD PMID:23562983 Atp5f1b Rat 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine increases expression ISO Atp5f1b (Mus musculus) 6480464 1-Methyl-4-phenyl-1 more ... CTD PMID:23562983 Atp5f1b Rat 17alpha-ethynylestradiol increases expression EXP 6480464 Ethinyl Estradiol results in increased expression of ATP5F1B mRNA CTD PMID:19400957 and PMID:24096037 Atp5f1b Rat 17alpha-ethynylestradiol affects expression ISO Atp5f1b (Mus musculus) 6480464 Ethinyl Estradiol affects the expression of ATP5F1B mRNA CTD PMID:17555576 Atp5f1b Rat 17alpha-ethynylestradiol multiple interactions ISO Atp5f1b (Mus musculus) 6480464 [Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of ATP5F1B mRNA CTD PMID:17942748 Atp5f1b Rat 17alpha-ethynylestradiol increases expression ISO Atp5f1b (Mus musculus) 6480464 Ethinyl Estradiol results in increased expression of ATP5F1B mRNA CTD PMID:17942748 more ... Atp5f1b Rat 17beta-estradiol increases expression ISO ATP5F1B (Homo sapiens) 6480464 Estradiol results in increased expression of ATP5F1B mRNA CTD PMID:20211987 Atp5f1b Rat 17beta-estradiol decreases expression ISO Atp5f1b (Mus musculus) 6480464 Estradiol results in decreased expression of ATP5F1B mRNA CTD PMID:39298647 Atp5f1b Rat 2,2,2-tetramine multiple interactions EXP 6480464 Trientine inhibits the reaction [Streptozocin results in increased expression of ATP5F1B protein] CTD PMID:21136691 Atp5f1b Rat 2,3,7,8-tetrachlorodibenzodioxine increases expression ISO Atp5f1b (Mus musculus) 6480464 Tetrachlorodibenzodioxin results in increased expression of ATP5F1B protein CTD PMID:29935226 Atp5f1b Rat 2,3,7,8-tetrachlorodibenzodioxine increases expression EXP 6480464 Tetrachlorodibenzodioxin results in increased expression of ATP5F1B mRNA CTD PMID:33387578 and PMID:34747641 Atp5f1b Rat 2,3,7,8-tetrachlorodibenzodioxine decreases expression ISO Atp5f1b (Mus musculus) 6480464 Tetrachlorodibenzodioxin results in decreased expression of ATP5F1B mRNA CTD PMID:20399798 Atp5f1b Rat 2,3,7,8-tetrachlorodibenzodioxine multiple interactions ISO Atp5f1b (Mus musculus) 6480464 [Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of ATP5F1B mRNA CTD PMID:17942748 Atp5f1b Rat 2,3,7,8-tetrachlorodibenzodioxine affects expression ISO Atp5f1b (Mus musculus) 6480464 Tetrachlorodibenzodioxin affects the expression of ATP5F1B mRNA CTD PMID:21570461 Atp5f1b Rat 2,4-dibromophenyl 2,4,5-tribromophenyl ether increases expression EXP 6480464 2 more ... CTD PMID:19954255 Atp5f1b Rat 2,4-dibromophenyl 2,4,5-tribromophenyl ether increases expression ISO Atp5f1b (Mus musculus) 6480464 2 more ... CTD PMID:16451863 and PMID:18550172 Atp5f1b Rat 2,6-dimethoxyphenol multiple interactions ISO ATP5F1B (Homo sapiens) 6480464 [pyrogallol 1 and 3-dimethyl ether co-treated with Furaldehyde] results in increased expression of and affects the localization of ATP5F1B protein CTD PMID:38598786 Atp5f1b Rat 2,6-dinitrotoluene affects expression EXP 6480464 2 and 6-dinitrotoluene affects the expression of ATP5F1B mRNA CTD PMID:21346803 Atp5f1b Rat 2-methyl-2-[4-(1,2,3,4-tetrahydronaphthalen-1-yl)phenoxy]propanoic acid affects expression EXP 6480464 Nafenopin affects the expression of ATP5F1B protein CTD PMID:10903494 Atp5f1b Rat 4,4'-sulfonyldiphenol increases expression ISO Atp5f1b (Mus musculus) 6480464 bisphenol S results in increased expression of ATP5F1B mRNA CTD PMID:39298647 Atp5f1b Rat 4,4'-sulfonyldiphenol increases expression ISO ATP5F1B (Homo sapiens) 6480464 bisphenol S results in increased expression of ATP5F1B protein CTD PMID:34186270 Atp5f1b Rat 5-aza-2'-deoxycytidine multiple interactions ISO ATP5F1B (Homo sapiens) 6480464 [trichostatin A co-treated with Decitabine] results in increased expression of ATP5F1B protein CTD PMID:19294695 Atp5f1b Rat 7,12-dimethyltetraphene multiple interactions EXP 6480464 [9 more ... CTD PMID:22248470 Atp5f1b Rat 7,12-dimethyltetraphene increases expression EXP 6480464 9 more ... CTD PMID:22248470 Atp5f1b Rat acrolein affects metabolic processing ISO Atp5f1b (Mus musculus) 6480464 Acrolein affects the metabolism of ATP5F1B protein CTD PMID:17921335 Atp5f1b Rat actinomycin D multiple interactions ISO ATP5F1B (Homo sapiens) 6480464 [Dactinomycin co-treated with nutlin 3] results in increased secretion of ATP5F1B protein CTD PMID:38460933 Atp5f1b Rat aflatoxin B1 increases expression ISO Atp5f1b (Mus musculus) 6480464 Aflatoxin B1 results in increased expression of ATP5F1B mRNA CTD PMID:19770486 Atp5f1b Rat amiodarone increases expression EXP 6480464 Amiodarone results in increased expression of ATP5F1B mRNA CTD PMID:17991464 Atp5f1b Rat ammonium chloride affects expression EXP 6480464 Ammonium Chloride affects the expression of ATP5F1B mRNA CTD PMID:16483693 Atp5f1b Rat aniline increases nitrosation EXP 6480464 aniline results in increased nitrosation of ATP5F1B protein CTD PMID:21708182 Atp5f1b Rat aristolochic acid A increases expression ISO ATP5F1B (Homo sapiens) 6480464 aristolochic acid I results in increased expression of ATP5F1B protein CTD PMID:33212167 Atp5f1b Rat Aroclor 1254 increases expression EXP 6480464 Chlorodiphenyl (54% Chlorine) results in increased expression of ATP5F1B protein CTD PMID:21791222 Atp5f1b Rat arsane increases expression ISO ATP5F1B (Homo sapiens) 6480464 Arsenic results in increased expression of ATP5F1B protein CTD PMID:21514422 Atp5f1b Rat arsane increases expression EXP 6480464 Arsenic results in increased expression of ATP5F1B protein CTD PMID:34352348 Atp5f1b Rat arsenic atom increases expression ISO ATP5F1B (Homo sapiens) 6480464 Arsenic results in increased expression of ATP5F1B protein CTD PMID:21514422 Atp5f1b Rat arsenic atom increases expression EXP 6480464 Arsenic results in increased expression of ATP5F1B protein CTD PMID:34352348 Atp5f1b Rat atrazine decreases expression ISO ATP5F1B (Homo sapiens) 6480464 Atrazine results in decreased expression of ATP5F1B mRNA CTD PMID:22378314 Atp5f1b Rat beta-naphthoflavone multiple interactions EXP 6480464 [Diethylnitrosamine co-treated with beta-Naphthoflavone] results in decreased expression of ATP5F1B protein and [Piperonyl Butoxide co-treated with beta-Naphthoflavone] results in decreased expression of ATP5F1B protein CTD PMID:28903497 Atp5f1b Rat bis(2-ethylhexyl) phthalate increases expression ISO Atp5f1b (Mus musculus) 6480464 Diethylhexyl Phthalate results in increased expression of ATP5B mRNA and Diethylhexyl Phthalate results in increased expression of ATP5F1B mRNA CTD PMID:19245819 and PMID:33754040 Atp5f1b Rat bisphenol A increases expression EXP 6480464 bisphenol A results in increased expression of ATP5F1B mRNA CTD PMID:25181051 Atp5f1b Rat bisphenol A decreases expression ISO ATP5F1B (Homo sapiens) 6480464 bisphenol A results in decreased expression of ATP5F1B protein CTD PMID:34186270 Atp5f1b Rat bisphenol A increases expression ISO ATP5F1B (Homo sapiens) 6480464 bisphenol A results in increased expression of ATP5F1B protein CTD PMID:33376534 and PMID:37567409 Atp5f1b Rat bisphenol A increases methylation ISO Atp5f1b (Mus musculus) 6480464 bisphenol A results in increased methylation of ATP5F1B promoter CTD PMID:27312807 Atp5f1b Rat bisphenol A affects expression ISO ATP5F1B (Homo sapiens) 6480464 bisphenol A affects the expression of ATP5F1B mRNA CTD PMID:30903817 Atp5f1b Rat bisphenol A increases expression ISO Atp5f1b (Mus musculus) 6480464 bisphenol A results in increased expression of ATP5F1B mRNA CTD PMID:33221593 Atp5f1b Rat bisphenol A decreases expression ISO Atp5f1b (Mus musculus) 6480464 bisphenol A results in decreased expression of ATP5F1B protein CTD PMID:28279065 Atp5f1b Rat bisphenol A decreases expression EXP 6480464 bisphenol A results in decreased expression of ATP5F1B mRNA CTD PMID:30816183 and PMID:34947998 Atp5f1b Rat bisphenol AF increases expression ISO ATP5F1B (Homo sapiens) 6480464 bisphenol AF results in increased expression of ATP5F1B protein CTD PMID:34186270 Atp5f1b Rat Bisphenol B increases expression ISO ATP5F1B (Homo sapiens) 6480464 bisphenol B results in increased expression of ATP5F1B protein CTD PMID:34186270 Atp5f1b Rat bisphenol F increases expression ISO Atp5f1b (Mus musculus) 6480464 bisphenol F results in increased expression of ATP5F1B mRNA CTD PMID:38685157 Atp5f1b Rat bisphenol F increases expression ISO ATP5F1B (Homo sapiens) 6480464 bisphenol F results in increased expression of ATP5F1B protein CTD PMID:34186270 Atp5f1b Rat bleomycin A2 decreases expression EXP 6480464 Bleomycin results in decreased expression of ATP5F1B protein CTD PMID:25933445 Atp5f1b Rat cadmium atom multiple interactions ISO ATP5F1B (Homo sapiens) 6480464 [Cadmium Chloride results in increased abundance of Cadmium] which results in increased expression of ATP5F1B protein CTD PMID:33040242 Atp5f1b Rat cadmium dichloride increases expression EXP 6480464 Cadmium Chloride results in increased expression of ATP5F1B protein CTD PMID:21699967 Atp5f1b Rat cadmium dichloride multiple interactions ISO ATP5F1B (Homo sapiens) 6480464 [Cadmium Chloride results in increased abundance of Cadmium] which results in increased expression of ATP5F1B protein CTD PMID:33040242 Atp5f1b Rat captan increases expression ISO Atp5f1b (Mus musculus) 6480464 Captan results in increased expression of ATP5F1B mRNA CTD PMID:31558096 Atp5f1b Rat carbon nanotube affects expression ISO Atp5f1b (Mus musculus) 6480464 Nanotubes and Carbon affects the expression of ATP5F1B protein CTD PMID:21135415 Atp5f1b Rat carbon nanotube increases expression ISO Atp5f1b (Mus musculus) 6480464 Nanotubes and Carbon results in increased expression of ATP5F1B mRNA CTD PMID:25620056 Atp5f1b Rat carbon nanotube multiple interactions ISO Atp5f1b (Mus musculus) 6480464 [Nanotubes more ... CTD PMID:28807745 Atp5f1b Rat carbon nanotube decreases expression ISO Atp5f1b (Mus musculus) 6480464 Nanotubes and Carbon analog results in decreased expression of ATP5F1B mRNA CTD PMID:25620056 Atp5f1b Rat chloropicrin affects expression ISO ATP5F1B (Homo sapiens) 6480464 chloropicrin affects the expression of ATP5F1B mRNA CTD PMID:26352163 Atp5f1b Rat choline multiple interactions ISO Atp5f1b (Mus musculus) 6480464 [Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in decreased methylation of ATP5F1B gene CTD PMID:20938992 Atp5f1b Rat chromium trinitrate increases expression ISO Atp5f1b (Mus musculus) 6480464 chromium nitrate results in increased expression of ATP5F1B protein CTD PMID:19771553 Atp5f1b Rat cisplatin decreases expression ISO Atp5f1b (Mus musculus) 6480464 Cisplatin results in decreased expression of ATP5F1B mRNA CTD PMID:37179038 Atp5f1b Rat clobetasol increases expression ISO Atp5f1b (Mus musculus) 6480464 Clobetasol results in increased expression of ATP5F1B mRNA CTD PMID:27462272 Atp5f1b Rat clofibrate increases expression EXP 6480464 Clofibrate results in increased expression of ATP5F1B protein CTD PMID:16470657 Atp5f1b Rat clozapine decreases expression EXP 6480464 Clozapine results in decreased expression of ATP5F1B protein CTD PMID:19441803 Atp5f1b Rat cocaine decreases expression ISO ATP5F1B (Homo sapiens) 6480464 Cocaine results in decreased expression of ATP5F1B protein CTD PMID:17075605 Atp5f1b Rat copper atom decreases expression EXP 6480464 Copper results in decreased expression of ATP5F1B mRNA CTD PMID:22465980 Atp5f1b Rat copper(0) decreases expression EXP 6480464 Copper results in decreased expression of ATP5F1B mRNA CTD PMID:22465980 Atp5f1b Rat copper(II) sulfate decreases expression ISO ATP5F1B (Homo sapiens) 6480464 Copper Sulfate results in decreased expression of ATP5F1B mRNA CTD PMID:19549813 Atp5f1b Rat cyclosporin A decreases expression ISO ATP5F1B (Homo sapiens) 6480464 Cyclosporine results in decreased expression of ATP5F1B mRNA CTD PMID:20106945 and PMID:25562108 Atp5f1b Rat dexamethasone decreases expression ISO Atp5f1b (Mus musculus) 6480464 Dexamethasone results in decreased expression of ATP5F1B protein CTD PMID:33567340 Atp5f1b Rat diclofenac multiple interactions EXP 6480464 [Diclofenac co-treated with lipopolysaccharide and E coli O55-B5] results in increased expression of ATP5F1B protein CTD PMID:25772430 Atp5f1b Rat diclofenac increases expression EXP 6480464 Diclofenac results in increased expression of ATP5F1B protein CTD PMID:25772430 Atp5f1b Rat dicyclanil increases expression ISO Atp5f1b (Mus musculus) 6480464 dicyclanil results in increased expression of ATP5F1B mRNA CTD PMID:15664270 Atp5f1b Rat diethyl maleate increases expression EXP 6480464 diethyl maleate results in increased expression of ATP5F1B protein CTD PMID:21161181 Atp5f1b Rat dioxygen decreases expression ISO Atp5f1b (Mus musculus) 6480464 Oxygen deficiency results in decreased expression of ATP5F1B protein CTD PMID:25937538 Atp5f1b Rat diuron decreases expression EXP 6480464 Diuron results in decreased expression of ATP5F1B mRNA CTD PMID:21551480 Atp5f1b Rat doxorubicin decreases expression ISO ATP5F1B (Homo sapiens) 6480464 Doxorubicin results in decreased expression of ATP5F1B mRNA CTD PMID:29803840 Atp5f1b Rat doxorubicin multiple interactions ISO Atp5f1b (Mus musculus) 6480464 sodium nitrate inhibits the reaction [Doxorubicin results in increased expression of ATP5F1B protein] CTD PMID:21251210 Atp5f1b Rat doxorubicin increases expression ISO Atp5f1b (Mus musculus) 6480464 Doxorubicin results in increased expression of ATP5F1B protein CTD PMID:21251210 Atp5f1b Rat doxorubicin decreases expression ISO Atp5f1b (Mus musculus) 6480464 Doxorubicin results in decreased expression of ATP5F1B mRNA and Doxorubicin results in decreased expression of ATP5F1B protein CTD PMID:26873546 and PMID:34246718 Atp5f1b Rat enzyme inhibitor multiple interactions ISO ATP5F1B (Homo sapiens) 6480464 [Enzyme Inhibitors results in decreased activity of OGA protein] which results in increased O-linked glycosylation of ATP5F1B protein CTD PMID:23301498 Atp5f1b Rat ethanol increases expression ISO ATP5F1B (Homo sapiens) 6480464 Ethanol results in increased expression of ATP5F1B protein CTD PMID:20621659 Atp5f1b Rat ethanol multiple interactions ISO Atp5f1b (Mus musculus) 6480464 Ethanol affects the expression of and affects the splicing of ATP5F1B mRNA CTD PMID:30319688 Atp5f1b Rat fenpyroximate decreases expression ISO ATP5F1B (Homo sapiens) 6480464 fenpyroximate results in decreased expression of ATP5F1B mRNA CTD PMID:33512557 Atp5f1b Rat flavonoids decreases expression EXP 6480464 Flavonoids results in decreased expression of ATP5F1B mRNA CTD PMID:18035473 Atp5f1b Rat folic acid multiple interactions ISO Atp5f1b (Mus musculus) 6480464 [Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in decreased methylation of ATP5F1B gene CTD PMID:20938992 Atp5f1b Rat folic acid decreases expression ISO Atp5f1b (Mus musculus) 6480464 Folic Acid results in decreased expression of ATP5F1B CTD PMID:24275386 Atp5f1b Rat folpet increases expression ISO Atp5f1b (Mus musculus) 6480464 folpet results in increased expression of ATP5F1B mRNA CTD PMID:31558096 Atp5f1b Rat fulvestrant increases expression ISO ATP5F1B (Homo sapiens) 6480464 fulvestrant results in increased expression of ATP5F1B mRNA CTD PMID:20211987 Atp5f1b Rat furan affects binding EXP 6480464 furan binds to ATP5F1B protein CTD PMID:22240984 Atp5f1b Rat furfural multiple interactions ISO ATP5F1B (Homo sapiens) 6480464 [pyrogallol 1 more ... CTD PMID:38598786 Atp5f1b Rat glyphosate decreases expression EXP 6480464 Glyphosate results in decreased expression of ATP5F1B mRNA CTD PMID:26302742 Atp5f1b Rat glyphosate increases expression ISO Atp5f1b (Mus musculus) 6480464 Glyphosate results in increased expression of ATP5F1B mRNA CTD PMID:36608876 Atp5f1b Rat gold atom multiple interactions ISO Atp5f1b (Mus musculus) 6480464 Gold analog results in increased expression of and results in decreased phosphorylation of ATP5F1B protein CTD PMID:24780912 Atp5f1b Rat gold(0) multiple interactions ISO Atp5f1b (Mus musculus) 6480464 Gold analog results in increased expression of and results in decreased phosphorylation of ATP5F1B protein CTD PMID:24780912 Atp5f1b Rat hyaluronic acid decreases expression EXP 6480464 Hyaluronic Acid analog results in decreased expression of ATP5F1B protein CTD PMID:23178681 Atp5f1b Rat hydrogen peroxide affects expression ISO ATP5F1B (Homo sapiens) 6480464 Hydrogen Peroxide affects the expression of ATP5F1B mRNA CTD PMID:20044591 Atp5f1b Rat hydrogen peroxide decreases expression EXP 6480464 Hydrogen Peroxide results in decreased expression of ATP5F1B protein CTD PMID:23178681 Atp5f1b Rat imisopasem manganese increases expression EXP 6480464 imisopasem manganese results in increased expression of ATP5F1B protein CTD PMID:28483572 Atp5f1b Rat isoflavones multiple interactions EXP 6480464 [9 more ... CTD PMID:22248470 Atp5f1b Rat isoniazide affects expression ISO Atp5f1b (Mus musculus) 6480464 Isoniazid affects the expression of ATP5F1B mRNA CTD PMID:24848797 Atp5f1b Rat ivermectin decreases expression ISO ATP5F1B (Homo sapiens) 6480464 Ivermectin results in decreased expression of ATP5F1B protein CTD PMID:32959892 Atp5f1b Rat josamycin affects response to substance ISO ATP5F1B (Homo sapiens) 6480464 ATP5F1B protein affects the susceptibility to Josamycin CTD PMID:31915244 Atp5f1b Rat L-ascorbic acid increases expression ISO Atp5f1b (Mus musculus) 6480464 Ascorbic Acid results in increased expression of ATP5F1B protein CTD PMID:22139585 Atp5f1b Rat L-methionine multiple interactions ISO Atp5f1b (Mus musculus) 6480464 [Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in decreased methylation of ATP5F1B gene CTD PMID:20938992 Atp5f1b Rat lead(0) decreases expression ISO ATP5F1B (Homo sapiens) 6480464 Lead results in decreased expression of ATP5F1B mRNA CTD PMID:19921347 Atp5f1b Rat lipopolysaccharide decreases expression ISO ATP5F1B (Homo sapiens) 6480464 Lipopolysaccharides results in decreased expression of ATP5F1B mRNA CTD PMID:31059760 Atp5f1b Rat lipopolysaccharide multiple interactions ISO ATP5F1B (Homo sapiens) 6480464 [Acetaminophen co-treated with Lipopolysaccharides] results in decreased expression of ATP5F1B mRNA CTD PMID:31059760 Atp5f1b Rat lithium atom increases expression EXP 6480464 Lithium results in increased expression of ATP5F1B protein CTD PMID:18296634 Atp5f1b Rat lithium hydride increases expression EXP 6480464 Lithium results in increased expression of ATP5F1B protein CTD PMID:18296634 Atp5f1b Rat methamphetamine decreases expression EXP 6480464 Methamphetamine results in decreased expression of ATP5F1B protein CTD PMID:19826936 Atp5f1b Rat methapyrilene multiple interactions EXP 6480464 [Diethylnitrosamine co-treated with Methapyrilene] results in decreased expression of ATP5F1B protein CTD PMID:28903497 Atp5f1b Rat methapyrilene increases expression EXP 6480464 Methapyrilene results in increased expression of ATP5F1B protein CTD PMID:30467583 Atp5f1b Rat methapyrilene decreases expression EXP 6480464 Methapyrilene results in decreased expression of ATP5F1B mRNA CTD PMID:28903497 Atp5f1b Rat methoxychlor increases methylation EXP 6480464 Methoxychlor results in increased methylation of ATP5F1B gene CTD PMID:23303685 Atp5f1b Rat methoxychlor decreases expression EXP 6480464 Methoxychlor results in decreased expression of ATP5F1B mRNA CTD PMID:23303685 Atp5f1b Rat mitoxantrone decreases expression ISO Atp5f1b (Mus musculus) 6480464 Mitoxantrone results in decreased expression of ATP5F1B protein CTD PMID:34246718 Atp5f1b Rat N,N-diethyl-m-toluamide multiple interactions EXP 6480464 [Pyridostigmine Bromide co-treated with DEET co-treated with Permethrin] results in increased expression of ATP5F1B mRNA CTD PMID:28659758 Atp5f1b Rat N-benzyloxycarbonyl-L-leucyl-L-leucyl-L-leucinal multiple interactions ISO ATP5F1B (Homo sapiens) 6480464 benzyloxycarbonylleucyl-leucyl-leucine aldehyde inhibits the reaction [troglitazone results in decreased expression of ATP5F1B mRNA] CTD PMID:20860658 Atp5f1b Rat N-nitrosodiethylamine multiple interactions EXP 6480464 [Diethylnitrosamine co-treated with beta-Naphthoflavone] results in decreased expression of ATP5F1B protein more ... CTD PMID:28903497 Atp5f1b Rat N-nitrosomorpholine decreases expression EXP 6480464 N-nitrosomorpholine results in decreased expression of ATP5F1B protein CTD PMID:19716841 Atp5f1b Rat nafenopin affects expression EXP 6480464 Nafenopin affects the expression of ATP5F1B protein CTD PMID:10903494 Atp5f1b Rat naphthalene decreases expression ISO Atp5f1b (Mus musculus) 6480464 naphthalene results in decreased expression of ATP5F1B protein CTD PMID:19438287 Atp5f1b Rat naphthalene affects binding ISO Atp5f1b (Mus musculus) 6480464 naphthalene metabolite binds to ATP5F1B protein CTD PMID:15892573 Atp5f1b Rat nicotinic acid decreases expression ISO ATP5F1B (Homo sapiens) 6480464 Niacin results in decreased expression of ATP5F1B protein CTD PMID:18316796 Atp5f1b Rat nitric oxide increases expression ISO Atp5f1b (Mus musculus) 6480464 Nitric Oxide deficiency results in increased expression of ATP5F1B mRNA CTD PMID:15878706 Atp5f1b Rat Nonylphenol increases expression EXP 6480464 nonylphenol results in increased expression of ATP5F1B protein CTD PMID:19260726 Atp5f1b Rat Nutlin-3 multiple interactions ISO ATP5F1B (Homo sapiens) 6480464 [Dactinomycin co-treated with nutlin 3] results in increased secretion of ATP5F1B protein CTD PMID:38460933 Atp5f1b Rat ochratoxin A increases expression ISO ATP5F1B (Homo sapiens) 6480464 ochratoxin A results in increased expression of ATP5F1B mRNA CTD PMID:17316727 Atp5f1b Rat ochratoxin A increases expression ISO Atp5f1b (Mus musculus) 6480464 ochratoxin A results in increased expression of ATP5F1B protein CTD PMID:19445961 Atp5f1b Rat oxybenzone increases expression EXP 6480464 oxybenzone results in increased expression of ATP5F1B mRNA CTD PMID:30316929 Atp5f1b Rat paracetamol decreases expression ISO ATP5F1B (Homo sapiens) 6480464 Acetaminophen results in decreased expression of ATP5F1B mRNA CTD PMID:25704631 and PMID:29067470 Atp5f1b Rat paracetamol increases expression ISO Atp5f1b (Mus musculus) 6480464 Acetaminophen results in increased expression of ATP5F1B protein CTD PMID:21329376 Atp5f1b Rat paracetamol multiple interactions ISO ATP5F1B (Homo sapiens) 6480464 [Acetaminophen co-treated with Lipopolysaccharides] results in decreased expression of ATP5F1B mRNA CTD PMID:31059760 Atp5f1b Rat paraoxon increases expression ISO ATP5F1B (Homo sapiens) 6480464 Paraoxon results in increased expression of ATP5F1B protein CTD PMID:20931991 Atp5f1b Rat perfluorooctanoic acid increases expression ISO ATP5F1B (Homo sapiens) 6480464 perfluorooctanoic acid results in increased expression of ATP5F1B protein CTD PMID:22609092 Atp5f1b Rat permethrin multiple interactions EXP 6480464 [Pyridostigmine Bromide co-treated with DEET co-treated with Permethrin] results in increased expression of ATP5F1B mRNA CTD PMID:28659758 Atp5f1b Rat phenethyl isothiocyanate affects binding ISO ATP5F1B (Homo sapiens) 6480464 ATP5F1B protein binds to phenethyl isothiocyanate CTD PMID:21838287 Atp5f1b Rat PhIP increases expression EXP 6480464 2-amino-1-methyl-6-phenylimidazo(4 and 5-b)pyridine results in increased expression of ATP5F1B mRNA CTD PMID:15215175 Atp5f1b Rat pioglitazone decreases expression ISO ATP5F1B (Homo sapiens) 6480464 pioglitazone results in decreased expression of ATP5F1B mRNA CTD PMID:20860658 Atp5f1b Rat piperonyl butoxide multiple interactions EXP 6480464 [Piperonyl Butoxide co-treated with beta-Naphthoflavone] results in decreased expression of ATP5F1B protein CTD PMID:28903497 Atp5f1b Rat potassium chromate increases expression ISO Atp5f1b (Mus musculus) 6480464 potassium chromate(VI) results in increased expression of ATP5F1B protein CTD PMID:19771553 Atp5f1b Rat potassium dichromate increases expression ISO Atp5f1b (Mus musculus) 6480464 Potassium Dichromate results in increased expression of ATP5F1B protein CTD PMID:19771553 Atp5f1b Rat procymidone decreases expression ISO Atp5f1b (Mus musculus) 6480464 procymidone results in decreased expression of ATP5B mRNA CTD PMID:35913088 Atp5f1b Rat progesterone increases phosphorylation EXP 6480464 Progesterone results in increased phosphorylation of ATP5F1B protein CTD PMID:17303654 Atp5f1b Rat promethazine decreases expression EXP 6480464 Promethazine results in decreased expression of ATP5F1B mRNA CTD PMID:28903497 Atp5f1b Rat Pyridostigmine bromide multiple interactions EXP 6480464 [Pyridostigmine Bromide co-treated with DEET co-treated with Permethrin] results in increased expression of ATP5F1B mRNA CTD PMID:28659758 Atp5f1b Rat quercetin affects binding ISO ATP5F1B (Homo sapiens) 6480464 Quercetin analog binds to ATP5F1B protein CTD PMID:21798748 Atp5f1b Rat rotenone decreases expression ISO ATP5F1B (Homo sapiens) 6480464 Rotenone results in decreased expression of ATP5F1B mRNA CTD PMID:33512557 Atp5f1b Rat rotenone increases expression EXP 6480464 Rotenone results in increased expression of ATP5F1B protein CTD PMID:35544339 Atp5f1b Rat rotenone increases oxidation EXP 6480464 Rotenone results in increased oxidation of ATP5F1B protein CTD PMID:30951809 Atp5f1b Rat S-butyl-DL-homocysteine (S,R)-sulfoximine increases expression ISO Atp5f1b (Mus musculus) 6480464 Buthionine Sulfoximine results in increased expression of ATP5F1B mRNA CTD PMID:15878706 Atp5f1b Rat silicon dioxide affects secretion ISO ATP5F1B (Homo sapiens) 6480464 Silicon Dioxide analog affects the secretion of ATP5F1B protein CTD PMID:25895662 Atp5f1b Rat sodium arsenite increases expression ISO ATP5F1B (Homo sapiens) 6480464 sodium arsenite results in increased expression of ATP5F1B protein CTD PMID:21925251 Atp5f1b Rat sodium arsenite decreases expression ISO ATP5F1B (Homo sapiens) 6480464 sodium arsenite results in decreased expression of ATP5F1B mRNA CTD PMID:38568856 Atp5f1b Rat sodium arsenite increases expression ISO Atp5f1b (Mus musculus) 6480464 sodium arsenite results in increased expression of ATP5F1B protein CTD PMID:29044176 Atp5f1b Rat sodium chloride multiple interactions ISO ATP5F1B (Homo sapiens) 6480464 [Sodium Chloride co-treated with Furaldehyde] results in increased expression of and affects the localization of ATP5F1B protein CTD PMID:38598786 Atp5f1b Rat sodium fluoride decreases expression ISO Atp5f1b (Mus musculus) 6480464 Sodium Fluoride results in decreased expression of ATP5F1B protein CTD PMID:27548804 Atp5f1b Rat sodium fluoride increases expression ISO Atp5f1b (Mus musculus) 6480464 Sodium Fluoride results in increased expression of ATP5F1B protein CTD PMID:27548804 Atp5f1b Rat sodium nitrate multiple interactions ISO Atp5f1b (Mus musculus) 6480464 sodium nitrate inhibits the reaction [Doxorubicin results in increased expression of ATP5F1B protein] CTD PMID:21251210 Atp5f1b Rat streptozocin increases expression EXP 6480464 Streptozocin results in increased expression of ATP5F1B protein CTD PMID:21136691 Atp5f1b Rat streptozocin multiple interactions EXP 6480464 Trientine inhibits the reaction [Streptozocin results in increased expression of ATP5F1B protein] CTD PMID:21136691 Atp5f1b Rat sulforaphane affects binding ISO ATP5F1B (Homo sapiens) 6480464 ATP5F1B protein binds to sulforaphane CTD PMID:21838287 Atp5f1b Rat T-2 toxin affects expression EXP 6480464 T-2 Toxin affects the expression of ATP5F1B protein CTD PMID:26141394 Atp5f1b Rat tamoxifen increases expression ISO ATP5F1B (Homo sapiens) 6480464 Tamoxifen results in increased expression of ATP5F1B mRNA CTD PMID:20211987 Atp5f1b Rat tamoxifen increases expression ISO Atp5f1b (Mus musculus) 6480464 Tamoxifen results in increased expression of ATP5F1B mRNA CTD PMID:19400957 Atp5f1b Rat tamoxifen affects expression ISO Atp5f1b (Mus musculus) 6480464 Tamoxifen affects the expression of ATP5F1B mRNA CTD PMID:17555576 Atp5f1b Rat tamoxifen increases expression EXP 6480464 Tamoxifen results in increased expression of ATP5F1B mRNA CTD PMID:19400957 Atp5f1b Rat tanespimycin decreases expression ISO ATP5F1B (Homo sapiens) 6480464 tanespimycin analog results in decreased expression of ATP5F1B protein CTD PMID:31370342 Atp5f1b Rat testosterone multiple interactions ISO Atp5f1b (Mus musculus) 6480464 Testosterone inhibits the reaction [Testosterone deficiency results in decreased expression of ATP5F1B mRNA] CTD PMID:21045173 Atp5f1b Rat testosterone decreases expression ISO Atp5f1b (Mus musculus) 6480464 Testosterone deficiency results in decreased expression of ATP5F1B mRNA CTD PMID:21045173 Atp5f1b Rat thioacetamide decreases expression EXP 6480464 Thioacetamide results in decreased expression of ATP5F1B mRNA CTD PMID:28903497 and PMID:34492290 Atp5f1b Rat thioacetamide multiple interactions EXP 6480464 [Diethylnitrosamine co-treated with Thioacetamide] results in decreased expression of ATP5F1B protein CTD PMID:28903497 Atp5f1b Rat thiram decreases expression ISO ATP5F1B (Homo sapiens) 6480464 Thiram results in decreased expression of ATP5F1B mRNA CTD PMID:38568856 Atp5f1b Rat titanium dioxide decreases expression ISO Atp5f1b (Mus musculus) 6480464 titanium dioxide results in decreased expression of ATP5F1B mRNA CTD PMID:23557971 Atp5f1b Rat tolcapone affects binding EXP 6480464 tolcapone binds to ATP5F1B protein CTD PMID:19783845 Atp5f1b Rat toluene affects expression EXP 6480464 Toluene affects the expression of ATP5F1B mRNA CTD PMID:21827849 Atp5f1b Rat trichostatin A multiple interactions ISO ATP5F1B (Homo sapiens) 6480464 [trichostatin A co-treated with decitabine] results in increased expression of ATP5F1B protein CTD PMID:19294695 Atp5f1b Rat trichostatin A affects expression ISO ATP5F1B (Homo sapiens) 6480464 trichostatin A affects the expression of ATP5F1B protein CTD PMID:19294695 Atp5f1b Rat trimellitic anhydride increases expression ISO Atp5f1b (Mus musculus) 6480464 trimellitic anhydride results in increased expression of ATP5F1B mRNA CTD PMID:19042947 Atp5f1b Rat triphenyl phosphate affects expression ISO ATP5F1B (Homo sapiens) 6480464 triphenyl phosphate affects the expression of ATP5F1B mRNA CTD PMID:37042841 Atp5f1b Rat triptonide increases expression ISO Atp5f1b (Mus musculus) 6480464 triptonide results in increased expression of ATP5F1B mRNA CTD PMID:33045310 Atp5f1b Rat troglitazone multiple interactions ISO ATP5F1B (Homo sapiens) 6480464 benzyloxycarbonylleucyl-leucyl-leucine aldehyde inhibits the reaction [troglitazone results in decreased expression of ATP5F1B mRNA] and PPARGC1A protein inhibits the reaction [troglitazone results in decreased expression of ATP5F1B mRNA] CTD PMID:20860658 Atp5f1b Rat troglitazone decreases expression ISO Atp5f1b (Mus musculus) 6480464 Troglitazone results in decreased expression of ATP5F1B protein CTD PMID:18495193 Atp5f1b Rat troglitazone decreases expression ISO ATP5F1B (Homo sapiens) 6480464 troglitazone results in decreased expression of ATP5F1B mRNA CTD PMID:20860658 Atp5f1b Rat valproic acid decreases expression ISO ATP5F1B (Homo sapiens) 6480464 Valproic Acid results in decreased expression of ATP5F1B mRNA CTD PMID:29501571 Atp5f1b Rat valproic acid affects expression ISO Atp5f1b (Mus musculus) 6480464 Valproic Acid affects the expression of ATP5F1B mRNA CTD PMID:17292431 and PMID:17963808 Atp5f1b Rat valproic acid increases methylation ISO ATP5F1B (Homo sapiens) 6480464 Valproic Acid results in increased methylation of ATP5F1B gene CTD PMID:29501571 Atp5f1b Rat vanadium atom increases expression ISO ATP5F1B (Homo sapiens) 6480464 Vanadium results in increased expression of ATP5F1B mRNA CTD PMID:19000753 Atp5f1b Rat vanadium(0) increases expression ISO ATP5F1B (Homo sapiens) 6480464 Vanadium results in increased expression of ATP5F1B mRNA CTD PMID:19000753 Atp5f1b Rat vitamin E increases expression ISO ATP5F1B (Homo sapiens) 6480464 Vitamin E results in increased expression of ATP5F1B mRNA CTD PMID:19244175
Molecular Function
Only show annotations with direct experimental evidence (0 objects hidden)
Atp5f1b Rat ADP binding IDA 2292225 TNP-ADP RGD Atp5f1b Rat angiostatin binding enables ISO ATP5F1B (Homo sapiens) 1624291 UniProtKB:P00747-PRO_0000028057 and PMID:21106936 RGD PMID:21106936 Atp5f1b Rat angiostatin binding enables IEA UniProtKB:P06576 and ensembl:ENSP000002620301600115 GO_REF:0000107 Ensembl GO_REF:0000107 Atp5f1b Rat ATP binding IDA 629531 RGD Atp5f1b Rat ATP binding enables IEA InterPro:IPR000194 and InterPro:IPR020003 1600115 GO_REF:0000002 InterPro GO_REF:0000002 Atp5f1b Rat ATP binding enables IEA UniProtKB-KW:KW-0067 1600115 GO_REF:0000043 UniProt GO_REF:0000043 Atp5f1b Rat ATP binding IPI TNP-ATP 2292225 RGD Atp5f1b Rat ATP binding IDA 2292226 RGD Atp5f1b Rat ATP hydrolysis activity contributes_to IDA 2292224 RGD Atp5f1b Rat ATP hydrolysis activity IDA 629531 RGD Atp5f1b Rat ATP hydrolysis activity enables IEA InterPro:IPR003593 1600115 GO_REF:0000002 InterPro GO_REF:0000002 Atp5f1b Rat calcium ion binding IDA 2292227 RGD Atp5f1b Rat lipoprotein particle receptor activity IDA 629531 RGD Atp5f1b Rat MHC class I protein binding enables IEA UniProtKB:P06576 and ensembl:ENSP000002620301600115 GO_REF:0000107 Ensembl GO_REF:0000107 Atp5f1b Rat MHC class I protein binding enables ISO ATP5F1B (Homo sapiens) 1624291 PMID:17643490 RGD PMID:17643490 Atp5f1b Rat nucleotide binding enables IEA UniProtKB-KW:KW-0547 1600115 GO_REF:0000043 UniProt GO_REF:0000043 Atp5f1b Rat protein binding enables ISO Atp5f1b (Mus musculus) 1624291 UniProtKB:Q3UMW8 and PMID:19941651 RGD PMID:19941651 Atp5f1b Rat protein binding enables ISO ATP5F1B (Homo sapiens) 1624291 UniProtKB:O75947 more ... RGD PMID:10077593 more ... Atp5f1b Rat proton-transporting ATP synthase activity, rotational mechanism contributes_to ISO ATP5F1B (Homo sapiens) 1624291 PMID:12110673 RGD PMID:12110673 Atp5f1b Rat proton-transporting ATP synthase activity, rotational mechanism contributes_to IEA UniProtKB:P06576 and ensembl:ENSP000002620301600115 GO_REF:0000107 Ensembl GO_REF:0000107 Atp5f1b Rat proton-transporting ATP synthase activity, rotational mechanism enables IEA UniProtKB:P56480 and ensembl:ENSMUSP00000026459 1600115 GO_REF:0000107 Ensembl GO_REF:0000107 Atp5f1b Rat proton-transporting ATP synthase activity, rotational mechanism enables IDA 596936199 PMID:9736690 UniProt Atp5f1b Rat proton-transporting ATP synthase activity, rotational mechanism contributes_to IBA PANTHER:PTN008558586 more ... 1600115 GO_REF:0000033 GO_Central GO_REF:0000033 Atp5f1b Rat proton-transporting ATP synthase activity, rotational mechanism enables ISS UniProtKB:P06576 1600115 GO_REF:0000024 UniProt GO_REF:0000024 Atp5f1b Rat proton-transporting ATP synthase activity, rotational mechanism enables ISO Atp5f1b (Mus musculus) 1624291 PMID:21281446 RGD PMID:21281446 Atp5f1b Rat proton-transporting ATP synthase activity, rotational mechanism enables IEA InterPro:IPR005722 1600115 GO_REF:0000002 InterPro GO_REF:0000002 Atp5f1b Rat proton-transporting ATP synthase activity, rotational mechanism enables ISO ATP5F1B (Homo sapiens) 1624291 PMID:21106936 more ... RGD PMID:21106936 more ... Atp5f1b Rat proton-transporting ATPase activity, rotational mechanism enables ISO ATP5F1B (Homo sapiens) 1624291 PMID:17510399 RGD PMID:17510399 Atp5f1b Rat proton-transporting ATPase activity, rotational mechanism enables IEA UniProtKB:P06576 and ensembl:ENSP000002620301600115 GO_REF:0000107 Ensembl GO_REF:0000107
Imported Annotations - SMPDB
Imported Annotations - KEGG (archival)
(+)-dexrazoxane (ISO) (Z)-3-butylidenephthalide (ISO) 1,1,1-Trichloro-2-(o-chlorophenyl)-2-(p-chlorophenyl)ethane (EXP,ISO) 1,2-dimethylhydrazine (ISO) 1,3-dinitrobenzene (EXP) 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (ISO) 17alpha-ethynylestradiol (EXP,ISO) 17beta-estradiol (ISO) 2,2,2-tetramine (EXP) 2,3,7,8-tetrachlorodibenzodioxine (EXP,ISO) 2,4-dibromophenyl 2,4,5-tribromophenyl ether (EXP,ISO) 2,6-dimethoxyphenol (ISO) 2,6-dinitrotoluene (EXP) 2-methyl-2-[4-(1,2,3,4-tetrahydronaphthalen-1-yl)phenoxy]propanoic acid (EXP) 4,4'-sulfonyldiphenol (ISO) 5-aza-2'-deoxycytidine (ISO) 7,12-dimethyltetraphene (EXP) acrolein (ISO) actinomycin D (ISO) aflatoxin B1 (ISO) amiodarone (EXP) ammonium chloride (EXP) aniline (EXP) aristolochic acid A (ISO) Aroclor 1254 (EXP) arsane (EXP,ISO) arsenic atom (EXP,ISO) atrazine (ISO) beta-naphthoflavone (EXP) bis(2-ethylhexyl) phthalate (ISO) bisphenol A (EXP,ISO) bisphenol AF (ISO) Bisphenol B (ISO) bisphenol F (ISO) bleomycin A2 (EXP) cadmium atom (ISO) cadmium dichloride (EXP,ISO) captan (ISO) carbon nanotube (ISO) chloropicrin (ISO) choline (ISO) chromium trinitrate (ISO) cisplatin (ISO) clobetasol (ISO) clofibrate (EXP) clozapine (EXP) cocaine (ISO) copper atom (EXP) copper(0) (EXP) copper(II) sulfate (ISO) cyclosporin A (ISO) dexamethasone (ISO) diclofenac (EXP) dicyclanil (ISO) diethyl maleate (EXP) dioxygen (ISO) diuron (EXP) doxorubicin (ISO) enzyme inhibitor (ISO) ethanol (ISO) fenpyroximate (ISO) flavonoids (EXP) folic acid (ISO) folpet (ISO) fulvestrant (ISO) furan (EXP) furfural (ISO) glyphosate (EXP,ISO) gold atom (ISO) gold(0) (ISO) hyaluronic acid (EXP) hydrogen peroxide (EXP,ISO) imisopasem manganese (EXP) isoflavones (EXP) isoniazide (ISO) ivermectin (ISO) josamycin (ISO) L-ascorbic acid (ISO) L-methionine (ISO) lead(0) (ISO) lipopolysaccharide (ISO) lithium atom (EXP) lithium hydride (EXP) methamphetamine (EXP) methapyrilene (EXP) methoxychlor (EXP) mitoxantrone (ISO) N,N-diethyl-m-toluamide (EXP) N-benzyloxycarbonyl-L-leucyl-L-leucyl-L-leucinal (ISO) N-nitrosodiethylamine (EXP) N-nitrosomorpholine (EXP) nafenopin (EXP) naphthalene (ISO) nicotinic acid (ISO) nitric oxide (ISO) Nonylphenol (EXP) Nutlin-3 (ISO) ochratoxin A (ISO) oxybenzone (EXP) paracetamol (ISO) paraoxon (ISO) perfluorooctanoic acid (ISO) permethrin (EXP) phenethyl isothiocyanate (ISO) PhIP (EXP) pioglitazone (ISO) piperonyl butoxide (EXP) potassium chromate (ISO) potassium dichromate (ISO) procymidone (ISO) progesterone (EXP) promethazine (EXP) Pyridostigmine bromide (EXP) quercetin (ISO) rotenone (EXP,ISO) S-butyl-DL-homocysteine (S,R)-sulfoximine (ISO) silicon dioxide (ISO) sodium arsenite (ISO) sodium chloride (ISO) sodium fluoride (ISO) sodium nitrate (ISO) streptozocin (EXP) sulforaphane (ISO) T-2 toxin (EXP) tamoxifen (EXP,ISO) tanespimycin (ISO) testosterone (ISO) thioacetamide (EXP) thiram (ISO) titanium dioxide (ISO) tolcapone (EXP) toluene (EXP) trichostatin A (ISO) trimellitic anhydride (ISO) triphenyl phosphate (ISO) triptonide (ISO) troglitazone (ISO) valproic acid (ISO) vanadium atom (ISO) vanadium(0) (ISO) vitamin E (ISO)
Biological Process
angiogenesis (IEA,ISO) ATP biosynthetic process (IEA,ISO,ISS) ATP metabolic process (IEA) cellular response to interleukin-7 (IEA,ISO) cellular response to peptide (IEP) cold acclimation (IEP) lipid metabolic process (IEA,ISO) liver development (IEP) monoatomic ion transport (IEA) negative regulation of cell adhesion involved in substrate-bound cell migration (IEA,ISO) positive regulation of blood vessel endothelial cell migration (IEA,ISO) proton motive force-driven ATP synthesis (IEA,ISO,ISS) proton motive force-driven mitochondrial ATP synthesis (IBA,IEA,ISO) proton transmembrane transport (IEA,ISO) receptor-mediated endocytosis (IDA) regulation of intracellular pH (IEA,ISO) response to 3,3',5-triiodo-L-thyronine (IEP) response to curcumin (IEP) response to manganese ion (IEP)
Cellular Component
cell surface (IDA,IEA,ISO) cytoplasm (IEA) membrane (IEA,ISO) membrane raft (IDA) mitochondrial inner membrane (IDA,IEA) mitochondrial membrane (IEA,ISO) mitochondrial nucleoid (IEA,ISO) mitochondrion (IEA,ISO) plasma membrane (IEA,ISO) proton-transporting ATP synthase complex (IDA,IEA,ISO)
Molecular Function
ADP binding (IDA) angiostatin binding (IEA,ISO) ATP binding (IDA,IEA,IPI) ATP hydrolysis activity (IDA,IEA) calcium ion binding (IDA) lipoprotein particle receptor activity (IDA) MHC class I protein binding (IEA,ISO) nucleotide binding (IEA) protein binding (ISO) proton-transporting ATP synthase activity, rotational mechanism (IBA,IDA,IEA,ISO,ISS) proton-transporting ATPase activity, rotational mechanism (IEA,ISO)
1.
ATP synthase subunit c expression: physiological regulation of the P1 and P2 genes.
Andersson U, etal., Biochem J. 1997 Apr 15;323 ( Pt 2):379-85.
2.
Mitochondrial ATP synthase. Quaternary structure of the F1 moiety at 3.6 A determined by x-ray diffraction analysis.
Bianchet M, etal., J Biol Chem. 1991 Nov 5;266(31):21197-201.
3.
The 2.8-A structure of rat liver F1-ATPase: configuration of a critical intermediate in ATP synthesis/hydrolysis.
Bianchet MA, etal., Proc Natl Acad Sci U S A. 1998 Sep 15;95(19):11065-70. doi: 10.1073/pnas.95.19.11065.
4.
Quantitative neuroproteomics of an in vivo rodent model of focal cerebral ischemia/reperfusion injury reveals a temporal regulation of novel pathophysiological molecular markers.
Datta A, etal., J Proteome Res. 2011 Nov 4;10(11):5199-213. doi: 10.1021/pr200673y. Epub 2011 Oct 20.
5.
Beta subunit of rat liver mitochondrial ATP synthase: cDNA cloning, amino acid sequence, expression in Escherichia coli, and structural relationship to adenylate kinase.
Garboczi DN, etal., Biochemistry 1988 Jan 26;27(2):553-60.
6.
Mitochondrial ATP synthase. Overexpression in Escherichia coli of a rat liver beta subunit peptide and its interaction with adenine nucleotides.
Garboczi DN, etal., J Biol Chem. 1988 Oct 25;263(30):15694-8.
7.
Rat liver mitochondrial ATP synthase. Effects of mutations in the glycine-rich region of a beta subunit peptide on its interaction with adenine nucleotides.
Garboczi DN, etal., J Biol Chem. 1990 Aug 25;265(24):14632-7.
8.
Phylogenetic-based propagation of functional annotations within the Gene Ontology consortium.
Gaudet P, etal., Brief Bioinform. 2011 Sep;12(5):449-62. doi: 10.1093/bib/bbr042. Epub 2011 Aug 27.
9.
Detection of differential proteomes associated with the development of type 2 diabetes in the Zucker rat model using the iTRAQ technique.
Han D, etal., J Proteome Res. 2011 Feb 4;10(2):564-77. doi: 10.1021/pr100759a. Epub 2010 Dec 20.
10.
Mitochondrial ATP synthase F1-beta-subunit is a calcium-binding protein.
Hubbard MJ and McHugh NJ, FEBS Lett. 1996 Aug 12;391(3):323-9.
11.
KEGG: Kyoto Encyclopedia of Genes and Genomes
KEGG
12.
Mitochondrial F(0)F(1) ATP synthase. Subunit regions on the F1 motor shielded by F(0), Functional significance, and evidence for an involvement of the unique F(0) subunit F(6).
Ko YH, etal., J Biol Chem. 2000 Oct 20;275(42):32931-9.
13.
Proteomic characterisation of neuronal sphingolipid-cholesterol microdomains: role in plasminogen activation.
Ledesma MD, etal., Brain Res. 2003 Oct 10;987(1):107-16.
14.
ATP synthase ß-subunit abnormality in pancreas islets of rats with polycystic ovary syndrome and type 2 diabetes mellitus.
Li W, etal., J Huazhong Univ Sci Technolog Med Sci. 2017 Apr;37(2):210-216. doi: 10.1007/s11596-017-1717-9. Epub 2017 Apr 11.
15.
[Screening of differentially expressed genes in rats with cardiomyopathy after bone marrow mesenchymal stem cell transplantation].
Li Y, etal., Zhonghua Er Ke Za Zhi. 2006 Oct;44(10):787-91.
16.
Translational regulation of mitochondrial differentiation in neonatal rat liver. Specific increase in the translational efficiency of the nuclear-encoded mitochondrial beta-F1-ATPase mRNA.
Luis AM, etal., J Biol Chem. 1993 Jan 25;268(3):1868-75.
17.
Ectopic beta-chain of ATP synthase is an apolipoprotein A-I receptor in hepatic HDL endocytosis.
Martinez LO, etal., Nature 2003 Jan 2;421(6918):75-9.
18.
Identification of two proteins associated with mammalian ATP synthase.
Meyer B, etal., Mol Cell Proteomics. 2007 Oct;6(10):1690-9. Epub 2007 Jun 17.
19.
Pharmacological inhibition of galectin-1 by lactulose alleviates weight gain in diet-induced obese rats.
Mukherjee R and Yun JW, Life Sci. 2016 Mar 1;148:112-7. doi: 10.1016/j.lfs.2016.02.018. Epub 2016 Feb 13.
20.
Electronic Transfer of LocusLink and RefSeq Data
NCBI rat LocusLink and RefSeq merged data July 26, 2002
21.
Coupling factor 6 enhances Src-mediated responsiveness to angiotensin II in resistance arterioles and cells.
Osanai T, etal., Cardiovasc Res. 2009 Mar 1;81(4):780-7. doi: 10.1093/cvr/cvn356. Epub 2008 Dec 22.
22.
Mitochondrial ATP synthase: dramatic Mg2+-induced alterations in the structure and function of the F1-ATPase moiety.
Pedersen PL, etal., Biochemistry. 1987 Dec 29;26(26):8631-7.
23.
KEGG Annotation Import Pipeline
Pipeline to import KEGG annotations from KEGG into RGD
24.
SMPDB Annotation Import Pipeline
Pipeline to import SMPDB annotations from SMPDB into RGD
25.
Overdose Intake of Curcumin Initiates the Unbalanced State of Bodies.
Qiu P, etal., J Agric Food Chem. 2016 Apr 6;64(13):2765-71. doi: 10.1021/acs.jafc.6b00053. Epub 2016 Mar 25.
26.
Application of a discovery to targeted LC-MS proteomics approach to identify deregulated proteins associated with idiosyncratic liver toxicity in a rat model of LPS/diclofenac co-administration.
Ramm S, etal., Toxicology. 2015 May 4;331:100-11. doi: 10.1016/j.tox.2015.03.004. Epub 2015 Mar 13.
27.
GOA pipeline
RGD automated data pipeline
28.
Data Import for Chemical-Gene Interactions
RGD automated import pipeline for gene-chemical interactions
29.
Proteomic characterization of early changes induced by triiodothyronine in rat liver.
Severino V, etal., J Proteome Res. 2011 Jul 1;10(7):3212-24. Epub 2011 Jun 1.
30.
Proteomic Analysis of One-carbon Metabolism-related Marker in Liver of Rat Offspring.
You YA, etal., Mol Cell Proteomics. 2015 Nov;14(11):2901-9. doi: 10.1074/mcp.M114.046888. Epub 2015 Sep 4.
31.
Proteome analysis of rat pancreatic acinar cells: implication for cerulein-induced acute pancreatitis.
Yu JH, etal., Proteomics. 2003 Dec;3(12):2446-53. doi: 10.1002/pmic.200300545.
32.
Telmisartan improves kidney function through inhibition of the oxidative phosphorylation pathway in diabetic rats.
Zhang Q, etal., J Mol Endocrinol. 2012 Jun 26;49(1):35-46. doi: 10.1530/JME-12-0020. Print 2012 Aug.
33.
Changes in the brain mitochondrial proteome of male Sprague-Dawley rats treated with manganese chloride.
Zhang S, etal., Toxicol Appl Pharmacol. 2005 Jan 1;202(1):13-7.
Atp5f1b Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 7 1,100,058 - 1,106,461 (+) NCBI GRCr8 mRatBN7.2 7 515,454 - 521,858 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 7 515,460 - 567,273 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 7 3,274,116 - 3,280,516 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 7 5,150,130 - 5,156,530 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 7 5,451,361 - 5,457,743 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 7 2,504,708 - 2,511,748 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 7 2,504,695 - 2,511,749 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 7 2,484,095 - 2,490,338 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 7 1,376,552 - 1,383,228 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 7 1,377,178 - 1,383,228 (+) NCBI Celera 7 394,648 - 401,125 (+) NCBI Celera Cytogenetic Map 7 q11 NCBI
ATP5F1B Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 12 56,638,175 - 56,645,984 (-) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 12 56,638,175 - 56,645,984 (-) Ensembl GRCh38 hg38 GRCh38 GRCh37 12 57,031,959 - 57,039,768 (-) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 12 55,318,226 - 55,326,119 (-) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 12 55,318,227 - 55,326,119 NCBI Celera 12 56,683,671 - 56,691,564 (-) NCBI Celera Cytogenetic Map 12 q13.3 NCBI HuRef 12 54,071,237 - 54,079,130 (-) NCBI HuRef CHM1_1 12 56,999,492 - 57,007,379 (-) NCBI CHM1_1 T2T-CHM13v2.0 12 56,606,172 - 56,613,970 (-) NCBI T2T-CHM13v2.0
Atp5f1b Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 10 127,919,176 - 127,926,257 (+) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 10 127,919,142 - 127,926,260 (+) Ensembl GRCm39 Ensembl GRCm38 10 128,083,307 - 128,090,388 (+) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 10 128,083,273 - 128,090,391 (+) Ensembl GRCm38 mm10 GRCm38 MGSCv37 10 127,520,363 - 127,527,444 (+) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 10 127,486,256 - 127,493,337 (+) NCBI MGSCv36 mm8 Celera 10 130,478,043 - 130,485,124 (+) NCBI Celera Cytogenetic Map 10 D3 NCBI cM Map 10 76.39 NCBI
Atp5f1b Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955458 4,186,461 - 4,195,494 (-) Ensembl ChiLan1.0 ChiLan1.0 NW_004955458 4,188,167 - 4,195,575 (-) NCBI ChiLan1.0 ChiLan1.0
ATP5F1B Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 10 37,680,429 - 37,689,113 (+) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 12 37,677,947 - 37,685,879 (+) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 12 32,264,570 - 32,272,419 (+) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 12 32,519,749 - 32,527,753 (+) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 12 32,519,749 - 32,527,753 (+) Ensembl panpan1.1 panPan2
ATP5F1B Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 10 870,405 - 876,937 (-) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 10 870,392 - 909,161 (-) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 10 933,592 - 940,127 (-) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 10 879,724 - 886,261 (-) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 10 879,724 - 919,087 (-) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 10 856,580 - 863,114 (-) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 10 1,099,743 - 1,106,277 (-) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 10 1,223,513 - 1,230,049 (-) NCBI UU_Cfam_GSD_1.0
Atp5f1b
ATP5F1B Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 5 21,984,580 - 21,992,407 (-) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 5 21,984,750 - 21,992,393 (-) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 5 23,659,081 - 23,666,726 (-) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
ATP5F1B Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 11 52,587,608 - 52,600,057 (-) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 11 52,587,143 - 52,600,756 (-) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666037 193,380,244 - 193,389,154 (+) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Atp5f1b
.
Predicted Target Of
Count of predictions: 37 Count of miRNA genes: 35 Interacting mature miRNAs: 37 Transcripts: ENSRNOT00000003965 Prediction methods: Miranda, Rnahybrid, Targetscan Result types: miRGate_prediction
61410 Bw19 Body weight QTL 19 6.2 0.001 body mass (VT:0001259) body weight (CMO:0000012) 7 1 44782185 Rat 2317047 Wbc4 White blood cell count QTL 4 0.01 leukocyte quantity (VT:0000217) white blood cell count (CMO:0000027) 7 1 35342956 Rat 2298550 Neuinf6 Neuroinflammation QTL 6 3.3 nervous system integrity trait (VT:0010566) spinal cord RT1-B protein level (CMO:0002132) 7 1 27829089 Rat 631503 Bp102 Blood pressure QTL 102 1.9 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 7 1 44822433 Rat 724560 Plsm3 Polydactyly-luxate syndrome (PLS) morphotypes QTL 3 0.0003 tibia length (VT:0004357) tibia length (CMO:0000450) 7 1 34000259 Rat 9590142 Scort5 Serum corticosterone level QTL 5 24.4 0.001 blood corticosterone amount (VT:0005345) plasma corticosterone level (CMO:0001173) 7 1 31962314 Rat 7411566 Bw136 Body weight QTL 136 10.4 0.001 body mass (VT:0001259) body weight gain (CMO:0000420) 7 1 31962314 Rat
ATP5B
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 7 516,480 - 516,617 (+) MAPPER mRatBN7.2 mRatBN7.2 2 29,136,039 - 29,136,176 (+) MAPPER mRatBN7.2 Rnor_6.0 2 25,599,724 - 25,599,860 NCBI Rnor6.0 Rnor_6.0 7 2,505,735 - 2,505,871 NCBI Rnor6.0 Rnor_5.0 7 2,485,122 - 2,485,258 UniSTS Rnor5.0 Rnor_5.0 2 44,754,009 - 44,754,145 UniSTS Rnor5.0 RGSC_v3.4 2 28,334,600 - 28,334,736 UniSTS RGSC3.4 RGSC_v3.4 7 1,377,579 - 1,377,715 UniSTS RGSC3.4 Celera 7 395,675 - 395,811 UniSTS Celera 2 25,173,156 - 25,173,292 UniSTS Cytogenetic Map 2 q12 UniSTS Cytogenetic Map 7 q11 UniSTS
RH127966
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 7 520,984 - 521,753 (+) MAPPER mRatBN7.2 mRatBN7.2 2 29,137,525 - 29,137,741 (+) MAPPER mRatBN7.2 Rnor_6.0 2 25,601,210 - 25,601,425 NCBI Rnor6.0 Rnor_6.0 7 2,510,875 - 2,511,643 NCBI Rnor6.0 Rnor_5.0 7 2,489,465 - 2,490,233 UniSTS Rnor5.0 Rnor_5.0 2 44,755,495 - 44,755,710 UniSTS Rnor5.0 RGSC_v3.4 2 28,336,799 - 28,337,015 UniSTS RGSC3.4 RGSC_v3.4 7 1,382,355 - 1,383,123 UniSTS RGSC3.4 Celera 7 400,252 - 401,020 UniSTS Celera 2 25,174,642 - 25,174,857 UniSTS Cytogenetic Map 2 q12 UniSTS Cytogenetic Map 7 q11 UniSTS
AW549786
Rat Assembly Chr Position (strand) Source JBrowse GRCr8 7 1,105,619 - 1,106,258 (+) Marker Load Pipeline mRatBN7.2 7 521,016 - 521,655 (+) MAPPER mRatBN7.2 Rnor_6.0 7 2,510,907 - 2,511,545 NCBI Rnor6.0 Rnor_5.0 7 2,489,497 - 2,490,135 UniSTS Rnor5.0 RGSC_v3.4 7 1,382,387 - 1,383,025 UniSTS RGSC3.4 Celera 7 400,284 - 400,922 UniSTS Cytogenetic Map 7 q11 UniSTS
MARC_26134-26135:1030377217:1
Rat Assembly Chr Position (strand) Source JBrowse GRCr8 7 1,101,951 - 1,102,527 (+) Marker Load Pipeline mRatBN7.2 7 517,347 - 517,923 (+) MAPPER mRatBN7.2 Rnor_6.0 7 2,506,602 - 2,507,177 NCBI Rnor6.0 Rnor_5.0 7 2,485,989 - 2,486,564 UniSTS Rnor5.0 RGSC_v3.4 7 1,378,446 - 1,379,021 UniSTS RGSC3.4 Celera 7 396,542 - 397,117 UniSTS Cytogenetic Map 7 q11 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
11
49
113
91
90
59
25
59
6
218
97
93
45
60
31
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000003965 ⟹ ENSRNOP00000003965
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 7 515,460 - 567,273 (+) Ensembl Rnor_6.0 Ensembl 7 2,504,695 - 2,511,749 (+) Ensembl
RefSeq Acc Id:
NM_134364 ⟹ NP_599191
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 7 1,100,058 - 1,106,461 (+) NCBI mRatBN7.2 7 515,454 - 521,858 (+) NCBI Rnor_6.0 7 2,504,708 - 2,511,748 (+) NCBI Rnor_5.0 7 2,484,095 - 2,490,338 (+) NCBI RGSC_v3.4 7 1,376,552 - 1,383,228 (+) RGD Celera 7 394,648 - 401,125 (+) RGD
Sequence:
CAGTCTCCACCCGGACTCCGCCATGTTGAGTCTTGTGGGGCGTGTGGCCTCGGCCTCGGCCTCCGGGGCCTTACGGGGACTCAACCCTTTGGCGGCGCTGCCACAGGCGCATCTTCTACTACGAACCG
hide sequence
RefSeq Acc Id:
NP_599191 ⟸ NM_134364
- Peptide Label:
precursor
- UniProtKB:
Q499W0 (UniProtKB/Swiss-Prot), P10719 (UniProtKB/Swiss-Prot), A6KSA3 (UniProtKB/TrEMBL), G3V6D3 (UniProtKB/TrEMBL)
- Sequence:
MLSLVGRVASASASGALRGLNPLAALPQAHLLLRTAPAGVHPARDYAAQSSAAPKAGTATGQIVAVIGAVVDVQFDEGLPPILNALEVQGRESRLVLEVAQHLGESTVRTIAMDGTEGLVRGQKVLDS
hide sequence
Ensembl Acc Id:
ENSRNOP00000003965 ⟸ ENSRNOT00000003965
RGD ID: 13694922 Promoter ID: EPDNEW_R5447 Type: multiple initiation site Name: Atp5f1b_1 Description: ATP synthase F1 subunit beta SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Rat Assembly Chr Position (strand) Source Rnor_6.0 7 2,504,709 - 2,504,769 EPDNEW
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2017-11-30
Atp5f1b
ATP synthase F1 subunit beta
Atp5b
ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2008-09-25
Atp5b
ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide
Atp5b
ATP synthase, H+ transporting mitochondrial F1 complex, beta subunit
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2008-02-22
Atp5b
ATP synthase, H+ transporting mitochondrial F1 complex, beta subunit
Atp5b
ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2005-01-20
Atp5b
ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide
Symbol and Name status set to approved
1299863 APPROVED
2002-08-07
Atp5b
ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide
Symbol and Name status set to provisional
70820 PROVISIONAL
