Symbol:
Apom
Name:
apolipoprotein M
RGD ID:
620773
Description:
Predicted to enable antioxidant activity; lipid transporter activity; and phospholipid binding activity. Involved in response to glucose. Located in extracellular space. Human ortholog(s) of this gene implicated in coronary artery disease; type 1 diabetes mellitus; and type 2 diabetes mellitus. Orthologous to human APOM (apolipoprotein M); INTERACTS WITH (+)-schisandrin B; 2,3,7,8-tetrachlorodibenzodioxine; 2,6-dinitrotoluene.
Type:
protein-coding
RefSeq Status:
VALIDATED
Previously known as:
apo-M; protein Px
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Species
Gene symbol and name
Data Source
Assertion derived from
less info ...
Orthologs 1
Homo sapiens (human):
APOM (apolipoprotein M) HGNC
Ensembl, HomoloGene, Inparanoid, NCBI, OrthoDB, OrthoMCL, Panther, PhylomeDB, Treefam
Mus musculus (house mouse):
Apom (apolipoprotein M) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chinchilla lanigera (long-tailed chinchilla):
Apom (apolipoprotein M) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Pan paniscus (bonobo/pygmy chimpanzee):
APOM (apolipoprotein M) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Canis lupus familiaris (dog):
APOM (apolipoprotein M) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Ictidomys tridecemlineatus (thirteen-lined ground squirrel):
Apom (apolipoprotein M) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Sus scrofa (pig):
APOM (apolipoprotein M) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chlorocebus sabaeus (green monkey):
APOM (apolipoprotein M) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Heterocephalus glaber (naked mole-rat):
Apom (apolipoprotein M) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Alliance orthologs 3
Homo sapiens (human):
APOM (apolipoprotein M)
Alliance
DIOPT (Ensembl Compara|HGNC|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Mus musculus (house mouse):
Apom (apolipoprotein M)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Danio rerio (zebrafish):
apom (apolipoprotein M)
Alliance
DIOPT (Hieranoid|InParanoid|OrthoFinder|PhylomeDB)
Xenopus tropicalis (tropical clawed frog):
apom
Alliance
DIOPT (Ensembl Compara|OMA|OrthoFinder|PANTHER|PhylomeDB)
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 20 3,695,618 - 3,698,218 (+) NCBI GRCr8 mRatBN7.2 20 3,690,950 - 3,693,550 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 20 3,688,413 - 3,693,550 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 20 4,390,260 - 4,392,730 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 20 3,752,317 - 3,754,787 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 20 4,290,095 - 4,292,565 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 20 5,120,473 - 5,123,073 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 20 5,120,474 - 5,123,073 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 20 7,193,732 - 7,196,332 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 20 3,754,604 - 3,757,204 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 20 3,754,853 - 3,757,431 (+) NCBI Celera 20 4,332,092 - 4,334,693 (-) NCBI Celera Cytogenetic Map 20 p12 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Apom Rat (+)-schisandrin B multiple interactions EXP 6480464 schizandrin B inhibits the reaction [Carbon Tetrachloride results in decreased expression of APOM mRNA] CTD PMID:31150632 Apom Rat (1->4)-beta-D-glucan multiple interactions ISO RGD:1551634 6480464 [perfluorooctane sulfonic acid co-treated with Cellulose] results in decreased expression of APOM mRNA CTD PMID:36331819 Apom Rat 1,1-dichloroethene decreases expression ISO RGD:1551634 6480464 vinylidene chloride results in decreased expression of APOM mRNA CTD PMID:26682919 Apom Rat 1,2-dimethylhydrazine decreases expression ISO RGD:1551634 6480464 1,2-Dimethylhydrazine results in decreased expression of APOM mRNA CTD PMID:22206623 Apom Rat 17alpha-ethynylestradiol multiple interactions ISO RGD:1551634 6480464 [Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of APOM mRNA CTD PMID:17942748 Apom Rat 17beta-estradiol multiple interactions ISO RGD:1351807 6480464 [Progesterone co-treated with Estradiol] results in increased expression of APOM mRNA CTD PMID:17404688 Apom Rat 2,2',4,4',5,5'-hexachlorobiphenyl multiple interactions ISO RGD:1551634 6480464 [Tetrachlorodibenzodioxin co-treated with 2,4,5,2',4',5'-hexachlorobiphenyl co-treated with Diethylhexyl Phthalate co-treated with bisphenol A] results in decreased more ... CTD PMID:28433925 Apom Rat 2,3,7,8-tetrachlorodibenzodioxine increases expression ISO RGD:1351807 6480464 Tetrachlorodibenzodioxin results in increased expression of APOM mRNA CTD PMID:19684285 Apom Rat 2,3,7,8-tetrachlorodibenzodioxine affects expression ISO RGD:1551634 6480464 Tetrachlorodibenzodioxin affects the expression of APOM mRNA CTD PMID:21570461 Apom Rat 2,3,7,8-tetrachlorodibenzodioxine decreases expression EXP 6480464 Tetrachlorodibenzodioxin results in decreased expression of APOM mRNA CTD PMID:21215274|PMID:32109520 Apom Rat 2,3,7,8-tetrachlorodibenzodioxine multiple interactions ISO RGD:1551634 6480464 [Tetrachlorodibenzodioxin co-treated with 2,4,5,2',4',5'-hexachlorobiphenyl co-treated with Diethylhexyl Phthalate co-treated with bisphenol A] results in decreased more ... CTD PMID:17942748|PMID:28433925 Apom Rat 2,4-dibromophenyl 2,4,5-tribromophenyl ether affects expression ISO RGD:1551634 6480464 2,2',4,4',5-brominated diphenyl ether affects the expression of APOM mRNA CTD PMID:38648751 Apom Rat 2,6-dinitrotoluene affects expression EXP 6480464 2,6-dinitrotoluene affects the expression of APOM mRNA CTD PMID:21346803 Apom Rat 3,3',4,4',5-pentachlorobiphenyl decreases expression EXP 6480464 3,4,5,3',4'-pentachlorobiphenyl results in decreased expression of APOM mRNA CTD PMID:20959002 Apom Rat 4,4'-sulfonyldiphenol increases expression ISO RGD:1551634 6480464 bisphenol S results in increased expression of APOM mRNA CTD PMID:30951980 Apom Rat 4,4'-sulfonyldiphenol decreases methylation ISO RGD:1351807 6480464 bisphenol S results in decreased methylation of APOM gene CTD PMID:31601247 Apom Rat 4,4'-sulfonyldiphenol decreases expression ISO RGD:1551634 6480464 bisphenol S results in decreased expression of APOM mRNA CTD PMID:39298647 Apom Rat 6-propyl-2-thiouracil decreases expression EXP 6480464 Propylthiouracil results in decreased expression of APOM mRNA CTD PMID:30047161 Apom Rat acetamide decreases expression EXP 6480464 acetamide results in decreased expression of APOM mRNA CTD PMID:31881176 Apom Rat aconitine decreases expression EXP 6480464 Aconitine results in decreased expression of APOM protein CTD PMID:33236894 Apom Rat amitrole decreases expression EXP 6480464 Amitrole results in decreased expression of APOM mRNA CTD PMID:30047161 Apom Rat ammonium chloride affects expression EXP 6480464 Ammonium Chloride affects the expression of APOM mRNA CTD PMID:16483693 Apom Rat arsane multiple interactions ISO RGD:1351807 6480464 [sodium arsenate results in increased abundance of Arsenic] which results in decreased expression of APOM more ... CTD PMID:32525701 Apom Rat arsenic atom multiple interactions ISO RGD:1351807 6480464 [sodium arsenate results in increased abundance of Arsenic] which results in decreased expression of APOM more ... CTD PMID:32525701 Apom Rat arsenite(3-) increases expression ISO RGD:1551634 6480464 arsenite results in increased expression of APOM protein CTD PMID:37955338 Apom Rat benzo[a]pyrene affects methylation ISO RGD:1351807 6480464 Benzo(a)pyrene affects the methylation of APOM promoter CTD PMID:27901495 Apom Rat benzo[a]pyrene decreases expression ISO RGD:1351807 6480464 Benzo(a)pyrene results in decreased expression of APOM mRNA CTD PMID:32234424 Apom Rat beta-naphthoflavone multiple interactions EXP 6480464 [Diethylnitrosamine co-treated with beta-Naphthoflavone] results in decreased expression of APOM mRNA CTD PMID:18164116 Apom Rat bis(2-ethylhexyl) phthalate multiple interactions ISO RGD:1551634 6480464 [Tetrachlorodibenzodioxin co-treated with 2,4,5,2',4',5'-hexachlorobiphenyl co-treated with Diethylhexyl Phthalate co-treated with bisphenol A] results in decreased more ... CTD PMID:28433925 Apom Rat bisphenol A multiple interactions ISO RGD:1551634 6480464 [Tetrachlorodibenzodioxin co-treated with 2,4,5,2',4',5'-hexachlorobiphenyl co-treated with Diethylhexyl Phthalate co-treated with bisphenol A] results in decreased more ... CTD PMID:28433925 Apom Rat bisphenol A increases expression EXP 6480464 bisphenol A results in increased expression of APOM mRNA CTD PMID:34947998 Apom Rat bisphenol A increases expression ISO RGD:1351807 6480464 bisphenol A results in increased expression of APOM protein CTD PMID:33376534 Apom Rat bisphenol A multiple interactions ISO RGD:1351807 6480464 [bisphenol A co-treated with Fulvestrant] results in increased methylation of APOM gene; [ginger extract results more ... CTD PMID:31601247|PMID:33376534 Apom Rat bisphenol A increases expression ISO RGD:1551634 6480464 bisphenol A results in increased expression of APOM mRNA CTD PMID:30245210|PMID:33221593|PMID:34585602 Apom Rat bisphenol A affects expression ISO RGD:1351807 6480464 bisphenol A affects the expression of APOM mRNA CTD PMID:30903817 Apom Rat bisphenol F increases expression ISO RGD:1551634 6480464 bisphenol F results in increased expression of APOM mRNA CTD PMID:30951980|PMID:38685157 Apom Rat bromobenzene increases expression EXP 6480464 bromobenzene results in increased expression of APOM mRNA CTD PMID:12628495 Apom Rat cadmium atom multiple interactions ISO RGD:1551634 6480464 [Cadmium Chloride results in increased abundance of Cadmium] which results in increased expression of APOM more ... CTD PMID:37325564 Apom Rat cadmium dichloride multiple interactions ISO RGD:1551634 6480464 [Cadmium Chloride results in increased abundance of Cadmium] which results in increased expression of APOM more ... CTD PMID:37325564 Apom Rat caffeine decreases expression EXP 6480464 Caffeine results in decreased expression of APOM mRNA CTD PMID:25868845 Apom Rat calcium atom affects expression EXP 6480464 Calcium affects the expression of APOM mRNA CTD PMID:15913539 Apom Rat calcium(0) affects expression EXP 6480464 Calcium affects the expression of APOM mRNA CTD PMID:15913539 Apom Rat CGP 52608 multiple interactions ISO RGD:1351807 6480464 CGP 52608 promotes the reaction [RORA protein binds to APOM gene] CTD PMID:28238834 Apom Rat chenodeoxycholic acid decreases expression ISO RGD:1351807 6480464 Chenodeoxycholic Acid results in decreased expression of APOM mRNA CTD PMID:27174168 Apom Rat ciglitazone multiple interactions ISO RGD:1351807 6480464 [ciglitazone binds to PPARG protein alternative form] which results in increased expression of APOM mRNA CTD PMID:16197558 Apom Rat clofibrate multiple interactions ISO RGD:1551634 6480464 [Clofibrate co-treated with Acetaminophen] affects the expression of APOM mRNA; PPARA affects the reaction [[Clofibrate more ... CTD PMID:17585979 Apom Rat clofibrate decreases expression ISO RGD:1551634 6480464 Clofibrate results in decreased expression of APOM mRNA CTD PMID:17585979|PMID:25270620 Apom Rat copper atom decreases expression ISO RGD:1351807 6480464 Copper results in decreased expression of APOM mRNA CTD PMID:20875833 Apom Rat copper(0) decreases expression ISO RGD:1351807 6480464 Copper results in decreased expression of APOM mRNA CTD PMID:20875833 Apom Rat copper(II) chloride increases expression ISO RGD:1551634 6480464 cupric chloride results in increased expression of APOM mRNA CTD PMID:17211630 Apom Rat copper(II) sulfate decreases expression ISO RGD:1351807 6480464 Copper Sulfate results in decreased expression of APOM mRNA CTD PMID:19549813 Apom Rat corosolic acid increases expression ISO RGD:1351807 6480464 corosolic acid results in increased expression of APOM mRNA CTD PMID:37939859 Apom Rat Cuprizon increases expression EXP 6480464 Cuprizone results in increased expression of APOM mRNA CTD PMID:26577399 Apom Rat cyclosporin A decreases expression ISO RGD:1351807 6480464 Cyclosporine results in decreased expression of APOM mRNA CTD PMID:20106945|PMID:25562108 Apom Rat decabromodiphenyl ether affects expression ISO RGD:1351807 6480464 decabromobiphenyl ether affects the expression of APOM mRNA CTD PMID:24834073 Apom Rat Dibutyl phosphate affects expression ISO RGD:1351807 6480464 di-n-butylphosphoric acid affects the expression of APOM mRNA CTD PMID:37042841 Apom Rat dimethyl sulfoxide affects expression ISO RGD:1351807 6480464 Dimethyl Sulfoxide affects the expression of APOM mRNA CTD PMID:24834073 Apom Rat diquat decreases expression ISO RGD:1551634 6480464 Diquat results in decreased expression of APOM protein CTD PMID:36851058 Apom Rat dorsomorphin multiple interactions ISO RGD:1351807 6480464 [NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased more ... CTD PMID:27188386 Apom Rat flutamide decreases expression EXP 6480464 Flutamide results in decreased expression of APOM mRNA CTD PMID:24136188 Apom Rat flutamide increases expression EXP 6480464 Flutamide results in increased expression of APOM mRNA CTD PMID:24793618 Apom Rat fulvestrant multiple interactions ISO RGD:1351807 6480464 [bisphenol A co-treated with Fulvestrant] results in increased methylation of APOM gene CTD PMID:31601247 Apom Rat furan increases methylation EXP 6480464 furan results in increased methylation of APOM gene CTD PMID:22079235 Apom Rat furan decreases expression EXP 6480464 furan results in decreased expression of APOM mRNA CTD PMID:25539665|PMID:26194646 Apom Rat gentamycin increases expression EXP 6480464 Gentamicins results in increased expression of APOM mRNA CTD PMID:33387578 Apom Rat GW 4064 increases expression ISO RGD:1551634 6480464 GW 4064 results in increased expression of APOM mRNA CTD PMID:26655953 Apom Rat hydrogen peroxide affects expression ISO RGD:1351807 6480464 Hydrogen Peroxide affects the expression of APOM mRNA CTD PMID:20044591 Apom Rat hydroquinone O-beta-D-glucopyranoside increases expression ISO RGD:1351807 6480464 Arbutin results in increased expression of APOM mRNA CTD PMID:17103032 Apom Rat inulin multiple interactions ISO RGD:1551634 6480464 [perfluorooctane sulfonic acid co-treated with Inulin] results in decreased expression of APOM mRNA CTD PMID:36331819 Apom Rat L-ascorbic acid multiple interactions ISO RGD:1351807 6480464 [Quercetin co-treated with Ascorbic Acid] results in decreased expression of APOM mRNA CTD PMID:17639512 Apom Rat lipopolysaccharide decreases expression ISO RGD:1551634 6480464 Lipopolysaccharides results in decreased expression of APOM mRNA; Lipopolysaccharides results in decreased expression of APOM more ... CTD PMID:18054359 Apom Rat methapyrilene increases expression EXP 6480464 Methapyrilene results in increased expression of APOM mRNA CTD PMID:30467583 Apom Rat methimazole decreases expression EXP 6480464 Methimazole results in decreased expression of APOM mRNA CTD PMID:30047161 Apom Rat methylmercury chloride decreases expression ISO RGD:1351807 6480464 methylmercuric chloride results in decreased expression of APOM mRNA CTD PMID:28001369 Apom Rat N-nitrosodiethylamine multiple interactions EXP 6480464 [Diethylnitrosamine co-treated with beta-Naphthoflavone] results in decreased expression of APOM mRNA; [Diethylnitrosamine co-treated with Thioacetamide] more ... CTD PMID:18164116|PMID:28943392 Apom Rat N-nitrosodiethylamine increases expression ISO RGD:1551634 6480464 Diethylnitrosamine results in increased expression of APOM mRNA CTD PMID:24535843 Apom Rat N-nitrosodiethylamine decreases expression EXP 6480464 Diethylnitrosamine results in decreased expression of APOM mRNA CTD PMID:19638242 Apom Rat nefazodone decreases expression EXP 6480464 nefazodone results in decreased expression of APOM mRNA CTD PMID:24136188 Apom Rat nitrofen increases expression EXP 6480464 nitrofen results in increased expression of APOM mRNA CTD PMID:33484710 Apom Rat O-methyleugenol decreases expression ISO RGD:1351807 6480464 methyleugenol results in decreased expression of APOM mRNA CTD PMID:32234424 Apom Rat okadaic acid decreases expression ISO RGD:1351807 6480464 Okadaic Acid results in decreased expression of APOM mRNA CTD PMID:38832940 Apom Rat paracetamol multiple interactions ISO RGD:1551634 6480464 [Clofibrate co-treated with Acetaminophen] affects the expression of APOM mRNA; PPARA affects the reaction [[Clofibrate more ... CTD PMID:17585979 Apom Rat paracetamol increases expression EXP 6480464 Acetaminophen results in increased expression of APOM mRNA CTD PMID:33387578 Apom Rat perfluorooctane-1-sulfonic acid multiple interactions ISO RGD:1551634 6480464 [perfluorooctane sulfonic acid co-treated with Cellulose] results in decreased expression of APOM mRNA; [perfluorooctane sulfonic more ... CTD PMID:36331819 Apom Rat perfluorooctanoic acid decreases expression EXP 6480464 perfluorooctanoic acid results in decreased expression of APOM mRNA CTD PMID:19162173 Apom Rat phenylmercury acetate decreases expression ISO RGD:1351807 6480464 Phenylmercuric Acetate results in decreased expression of APOM mRNA CTD PMID:26272509 Apom Rat phenylmercury acetate multiple interactions ISO RGD:1351807 6480464 [NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased more ... CTD PMID:27188386 Apom Rat pirinixic acid multiple interactions ISO RGD:1551634 6480464 [pirinixic acid binds to and results in increased activity of PPARA protein] which results in more ... CTD PMID:19710929 Apom Rat pirinixic acid decreases expression ISO RGD:1551634 6480464 pirinixic acid results in decreased expression of APOM mRNA CTD PMID:15375163|PMID:20813756 Apom Rat pirinixic acid decreases expression EXP 6480464 pirinixic acid results in decreased expression of APOM mRNA CTD PMID:19162173 Apom Rat potassium dichromate increases expression ISO RGD:1551634 6480464 Potassium Dichromate results in increased expression of APOM mRNA CTD PMID:23608068 Apom Rat progesterone multiple interactions ISO RGD:1351807 6480464 [Progesterone co-treated with Estradiol] results in increased expression of APOM mRNA CTD PMID:17404688 Apom Rat quercetin multiple interactions ISO RGD:1351807 6480464 [Quercetin co-treated with Ascorbic Acid] results in decreased expression of APOM mRNA CTD PMID:17639512 Apom Rat quercetin decreases expression ISO RGD:1351807 6480464 Quercetin results in decreased expression of APOM mRNA CTD PMID:21632981 Apom Rat resveratrol decreases expression ISO RGD:1551634 6480464 resveratrol results in decreased expression of APOM protein CTD PMID:25505154 Apom Rat SB 431542 multiple interactions ISO RGD:1351807 6480464 [NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased more ... CTD PMID:27188386 Apom Rat senecionine decreases expression ISO RGD:1551634 6480464 senecionine results in decreased expression of APOM protein CTD PMID:35357534 Apom Rat silicon dioxide decreases expression ISO RGD:1351807 6480464 Silicon Dioxide analog results in decreased expression of APOM mRNA CTD PMID:25895662 Apom Rat simvastatin decreases expression ISO RGD:1351807 6480464 Simvastatin results in decreased expression of APOM mRNA CTD PMID:21729290 Apom Rat simvastatin increases expression ISO RGD:1551634 6480464 Simvastatin results in increased expression of APOM mRNA; Simvastatin results in increased expression of APOM more ... CTD PMID:22160096 Apom Rat simvastatin multiple interactions ISO RGD:1351807 6480464 T0901317 inhibits the reaction [Simvastatin results in increased expression of APOM mRNA]; T0901317 inhibits the more ... CTD PMID:22160096 Apom Rat simvastatin increases expression ISO RGD:1351807 6480464 Simvastatin results in increased expression of APOM mRNA; Simvastatin results in increased expression of APOM more ... CTD PMID:22160096 Apom Rat sodium arsenate multiple interactions ISO RGD:1351807 6480464 [sodium arsenate results in increased abundance of Arsenic] which results in decreased expression of APOM more ... CTD PMID:32525701 Apom Rat sodium arsenite decreases expression ISO RGD:1551634 6480464 sodium arsenite results in decreased expression of APOM mRNA CTD PMID:37682722 Apom Rat sulfadimethoxine decreases expression EXP 6480464 Sulfadimethoxine results in decreased expression of APOM mRNA CTD PMID:30047161 Apom Rat sunitinib increases expression ISO RGD:1351807 6480464 Sunitinib results in increased expression of APOM mRNA CTD PMID:31533062 Apom Rat Tanshinone I increases expression ISO RGD:1351807 6480464 tanshinone results in increased expression of APOM mRNA CTD PMID:15849732 Apom Rat tetrachloromethane multiple interactions EXP 6480464 schizandrin B inhibits the reaction [Carbon Tetrachloride results in decreased expression of APOM mRNA] CTD PMID:31150632 Apom Rat tetrachloromethane decreases expression ISO RGD:1551634 6480464 Carbon Tetrachloride results in decreased expression of APOM mRNA CTD PMID:31919559 Apom Rat tetrachloromethane decreases expression EXP 6480464 Carbon Tetrachloride results in decreased expression of APOM mRNA CTD PMID:31150632 Apom Rat thioacetamide multiple interactions EXP 6480464 [Diethylnitrosamine co-treated with Thioacetamide] results in decreased expression of APOM mRNA CTD PMID:28943392 Apom Rat thioacetamide decreases expression EXP 6480464 Thioacetamide results in decreased expression of APOM mRNA CTD PMID:34492290 Apom Rat trichloroethene increases expression EXP 6480464 Trichloroethylene results in increased expression of APOM mRNA CTD PMID:33387578 Apom Rat triphenyl phosphate affects expression ISO RGD:1351807 6480464 triphenyl phosphate affects the expression of APOM mRNA CTD PMID:37042841 Apom Rat triptonide increases expression ISO RGD:1551634 6480464 triptonide results in increased expression of APOM mRNA CTD PMID:33045310 Apom Rat tris(2-butoxyethyl) phosphate affects expression ISO RGD:1351807 6480464 tris(2-butoxyethyl) phosphate affects the expression of APOM mRNA CTD PMID:29024780 Apom Rat ursodeoxycholic acid multiple interactions ISO RGD:1351807 6480464 Ursodeoxycholic Acid inhibits the reaction [Simvastatin results in increased expression of APOM mRNA]; Ursodeoxycholic Acid more ... CTD PMID:22160096 Apom Rat valproic acid decreases expression ISO RGD:1351807 6480464 Valproic Acid results in decreased expression of APOM mRNA CTD PMID:24935251|PMID:26272509|PMID:28001369 Apom Rat valproic acid multiple interactions ISO RGD:1351807 6480464 [NOG protein co-treated with Valproic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased more ... CTD PMID:27188386 Apom Rat vancomycin increases expression ISO RGD:1551634 6480464 Vancomycin results in increased expression of APOM mRNA CTD PMID:18930951 Apom Rat vitamin E increases expression ISO RGD:1351807 6480464 Vitamin E results in increased expression of APOM mRNA CTD PMID:19244175
(+)-schisandrin B (EXP) (1->4)-beta-D-glucan (ISO) 1,1-dichloroethene (ISO) 1,2-dimethylhydrazine (ISO) 17alpha-ethynylestradiol (ISO) 17beta-estradiol (ISO) 2,2',4,4',5,5'-hexachlorobiphenyl (ISO) 2,3,7,8-tetrachlorodibenzodioxine (EXP,ISO) 2,4-dibromophenyl 2,4,5-tribromophenyl ether (ISO) 2,6-dinitrotoluene (EXP) 3,3',4,4',5-pentachlorobiphenyl (EXP) 4,4'-sulfonyldiphenol (ISO) 6-propyl-2-thiouracil (EXP) acetamide (EXP) aconitine (EXP) amitrole (EXP) ammonium chloride (EXP) arsane (ISO) arsenic atom (ISO) arsenite(3-) (ISO) benzo[a]pyrene (ISO) beta-naphthoflavone (EXP) bis(2-ethylhexyl) phthalate (ISO) bisphenol A (EXP,ISO) bisphenol F (ISO) bromobenzene (EXP) cadmium atom (ISO) cadmium dichloride (ISO) caffeine (EXP) calcium atom (EXP) calcium(0) (EXP) CGP 52608 (ISO) chenodeoxycholic acid (ISO) ciglitazone (ISO) clofibrate (ISO) copper atom (ISO) copper(0) (ISO) copper(II) chloride (ISO) copper(II) sulfate (ISO) corosolic acid (ISO) Cuprizon (EXP) cyclosporin A (ISO) decabromodiphenyl ether (ISO) Dibutyl phosphate (ISO) dimethyl sulfoxide (ISO) diquat (ISO) dorsomorphin (ISO) flutamide (EXP) fulvestrant (ISO) furan (EXP) gentamycin (EXP) GW 4064 (ISO) hydrogen peroxide (ISO) hydroquinone O-beta-D-glucopyranoside (ISO) inulin (ISO) L-ascorbic acid (ISO) lipopolysaccharide (ISO) methapyrilene (EXP) methimazole (EXP) methylmercury chloride (ISO) N-nitrosodiethylamine (EXP,ISO) nefazodone (EXP) nitrofen (EXP) O-methyleugenol (ISO) okadaic acid (ISO) paracetamol (EXP,ISO) perfluorooctane-1-sulfonic acid (ISO) perfluorooctanoic acid (EXP) phenylmercury acetate (ISO) pirinixic acid (EXP,ISO) potassium dichromate (ISO) progesterone (ISO) quercetin (ISO) resveratrol (ISO) SB 431542 (ISO) senecionine (ISO) silicon dioxide (ISO) simvastatin (ISO) sodium arsenate (ISO) sodium arsenite (ISO) sulfadimethoxine (EXP) sunitinib (ISO) Tanshinone I (ISO) tetrachloromethane (EXP,ISO) thioacetamide (EXP) trichloroethene (EXP) triphenyl phosphate (ISO) triptonide (ISO) tris(2-butoxyethyl) phosphate (ISO) ursodeoxycholic acid (ISO) valproic acid (ISO) vancomycin (ISO) vitamin E (ISO)
1.
Plasma apolipoprotein M is reduced in metabolic syndrome but does not predict intima media thickness.
Dullaart RP, etal., Clin Chim Acta. 2009 Aug;406(1-2):129-33. Epub 2009 Jun 17.
2.
Phylogenetic-based propagation of functional annotations within the Gene Ontology consortium.
Gaudet P, etal., Brief Bioinform. 2011 Sep;12(5):449-62. doi: 10.1093/bib/bbr042. Epub 2011 Aug 27.
3.
A prospective evaluation of apolipoprotein M gene T-778C polymorphism in relation to coronary artery disease in Han Chinese.
Jiao GQ, etal., Clin Biochem. 2007 Oct;40(15):1108-12. Epub 2007 Jul 4.
4.
Rat ISS GO annotations from MGI mouse gene data--August 2006
MGD data from the GO Consortium
5.
Electronic Transfer of LocusLink and RefSeq Data
NCBI rat LocusLink and RefSeq merged data July 26, 2002
6.
Single nucleotide polymorphisms in the proximal promoter region of apolipoprotein M gene (apoM) confer the susceptibility to development of type 2 diabetes in Han Chinese.
Niu N, etal., Diabetes Metab Res Rev. 2007 Jan;23(1):21-5.
7.
GOA pipeline
RGD automated data pipeline
8.
Data Import for Chemical-Gene Interactions
RGD automated import pipeline for gene-chemical interactions
9.
Comprehensive gene review and curation
RGD comprehensive gene curation
10.
Apolipoprotein M promoter polymorphisms alter promoter activity and confer the susceptibility to the development of type 1 diabetes.
Wu X, etal., Clin Biochem. 2009 Jan;42(1-2):17-21. Epub 2008 Oct 30.
11.
Suppression of apolipoprotein M expression and secretion in alloxan-diabetic mouse: Partial reversal by insulin.
Xu N, etal., Biochem Biophys Res Commun. 2006 Apr 21;342(4):1174-7. Epub 2006 Feb 14.
12.
Hyperglycemia down-regulates apolipoprotein M expression in vivo and in vitro.
Zhang X, etal., Biochim Biophys Acta. 2007 Jul;1771(7):879-82. Epub 2007 May 18.
13.
Expression pattern of apolipoprotein M during mouse and human embryogenesis.
Zhang XY, etal., Acta Histochem 2004;106(2):123-8.
Apom Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 20 3,695,618 - 3,698,218 (+) NCBI GRCr8 mRatBN7.2 20 3,690,950 - 3,693,550 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 20 3,688,413 - 3,693,550 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 20 4,390,260 - 4,392,730 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 20 3,752,317 - 3,754,787 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 20 4,290,095 - 4,292,565 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 20 5,120,473 - 5,123,073 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 20 5,120,474 - 5,123,073 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 20 7,193,732 - 7,196,332 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 20 3,754,604 - 3,757,204 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 20 3,754,853 - 3,757,431 (+) NCBI Celera 20 4,332,092 - 4,334,693 (-) NCBI Celera Cytogenetic Map 20 p12 NCBI
APOM Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 6 31,652,404 - 31,658,210 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 6 31,652,416 - 31,658,210 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 6 31,620,181 - 31,625,987 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 6 31,731,650 - 31,733,966 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 6 31,731,649 - 31,733,965 NCBI Celera 6 33,221,892 - 33,224,208 (+) NCBI Celera Cytogenetic Map 6 p21.33 NCBI HuRef 6 31,406,412 - 31,412,212 (+) NCBI HuRef CHM1_1 6 31,622,323 - 31,628,123 (+) NCBI CHM1_1 T2T-CHM13v2.0 6 31,505,437 - 31,511,243 (+) NCBI T2T-CHM13v2.0
Apom Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 17 35,347,973 - 35,350,777 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 17 35,347,973 - 35,351,026 (-) Ensembl GRCm39 Ensembl GRCm38 17 35,128,997 - 35,131,801 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 17 35,128,997 - 35,132,050 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 17 35,265,942 - 35,268,697 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 17 34,737,053 - 34,739,808 (-) NCBI MGSCv36 mm8 Celera 17 38,225,932 - 38,228,688 (-) NCBI Celera Cytogenetic Map 17 B1 NCBI cM Map 17 18.59 NCBI
Apom Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955437 190,609 - 197,342 (+) Ensembl ChiLan1.0 ChiLan1.0 NW_004955437 190,609 - 192,781 (+) NCBI ChiLan1.0 ChiLan1.0
APOM Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 5 46,129,400 - 46,135,238 (+) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 6 42,090,938 - 42,096,756 (+) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 6 31,313,543 - 31,319,374 (+) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 6 32,203,435 - 32,209,249 (+) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 6 32,206,514 - 32,209,249 (+) Ensembl panpan1.1 panPan2
APOM Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 12 1,137,474 - 1,142,337 (+) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 12 1,140,316 - 1,142,331 (+) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 12 1,273,598 - 1,278,509 (+) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 12 1,282,390 - 1,287,302 (+) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 12 1,285,280 - 1,287,296 (+) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 12 1,142,107 - 1,146,651 (+) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 12 1,209,008 - 1,213,915 (+) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 12 1,276,069 - 1,280,982 (+) NCBI UU_Cfam_GSD_1.0
Apom Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024404946 35,687,172 - 35,692,577 (+) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936727 1,865,921 - 1,872,214 (-) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936727 1,868,751 - 1,874,347 (-) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
APOM Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 7 23,768,984 - 23,773,324 (+) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 7 23,768,974 - 23,773,324 (+) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 7 27,478,637 - 27,481,118 (-) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
APOM Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Vero_WHO_p1.0 NW_023666044 31,563,816 - 31,569,058 (+) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Apom
.
Predicted Target Of
Count of predictions: 48 Count of miRNA genes: 47 Interacting mature miRNAs: 48 Transcripts: ENSRNOT00000001126 Prediction methods: Miranda, Rnahybrid Result types: miRGate_prediction
61472 Aia1 Adjuvant induced arthritis QTL 1 18 0.001 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 20 2646395 4597031 Rat 2306850 Pia40 Pristane induced arthritis QTL 40 0.0001 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 20 1527959 5304575 Rat 1641915 Colcr9 Colorectal carcinoma resistance QTL 9 2.97 0.0024 intestine integrity trait (VT:0010554) benign colorectal tumor number (CMO:0001795) 20 1530655 46530655 Rat 2317057 Aia27 Adjuvant induced arthritis QTL 27 2.83 joint integrity trait (VT:0010548) right rear ankle joint diameter (CMO:0002150) 20 2892597 26381954 Rat 7387283 Uae44 Urinary albumin excretion QTL 44 0.1712 urine albumin amount (VT:0002871) urine albumin excretion rate (CMO:0000757) 20 1 26123605 Rat 7411668 Foco32 Food consumption QTL 32 8 0.001 eating behavior trait (VT:0001431) feed conversion ratio (CMO:0001312) 20 1 36600972 Rat 2305926 Iddm37 Insulin dependent diabetes mellitus QTL 37 6 blood glucose amount (VT:0000188) plasma glucose level (CMO:0000042) 20 1527842 46527842 Rat 1354642 Despr15 Despair related QTL 15 0.0027 locomotor behavior trait (VT:0001392) amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958) 20 1 24159021 Rat 1600382 Edcs3 Endometrial carcinoma susceptibility QTL3 3.5 0.003 uterus morphology trait (VT:0001120) percentage of study population developing endometrioid carcinoma during a period of time (CMO:0001759) 20 1 25159026 Rat 61448 Ciaa1 CIA Autoantibody QTL 1 30 0.001 blood autoantibody amount (VT:0003725) calculated serum anti-rat type 2 collagen autoantibody titer (CMO:0001281) 20 2646395 4597031 Rat 1331772 Cdexp2 CD45RC expression in CD8 T cells QTL 2 5.7 CD8-positive T cell quantity (VT:0008077) blood CD45RC(high) CD8 T cell count to CD45RC(low) CD8 T cell count ratio (CMO:0001990) 20 3621649 10078919 Rat 8694189 Bw153 Body weight QTL 153 3.13 0.001 body mass (VT:0001259) body weight gain (CMO:0000420) 20 1 29191651 Rat 1300152 Bp195 Blood pressure QTL 195 3.46 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 20 3621649 9243559 Rat 9590109 Sffal8 Serum free fatty acids level QTL 8 5.32 0.01 blood free fatty acid amount (VT:0001553) plasma free fatty acids level (CMO:0000546) 20 1 29191651 Rat 9590275 Scort15 Serum corticosterone level QTL 15 3.48 0.001 blood corticosterone amount (VT:0005345) plasma corticosterone level (CMO:0001173) 20 1 29191651 Rat 9589155 Insul32 Insulin level QTL 32 6.38 0.001 blood insulin amount (VT:0001560) plasma insulin level (CMO:0000342) 20 1 29191651 Rat 7411650 Foco23 Food consumption QTL 23 20.7 0.001 eating behavior trait (VT:0001431) feed conversion ratio (CMO:0001312) 20 1 29191651 Rat 2317851 Alcrsp22 Alcohol response QTL 22 3.2 0.05 response to alcohol trait (VT:0010489) duration of loss of righting reflex (CMO:0002289) 20 1 27339237 Rat 1598816 Memor12 Memory QTL 12 2.4 exploratory behavior trait (VT:0010471) average horizontal distance between subject and target during voluntary locomotion in an experimental apparatus (CMO:0002674) 20 2606836 47606836 Rat 61432 Cia1 Collagen induced arthritis QTL 1 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 20 3621656 14101050 Rat 1641893 Alcrsp7 Alcohol response QTL 7 response to alcohol trait (VT:0010489) duration of loss of righting reflex (CMO:0002289) 20 1 27339237 Rat 6893685 Bw111 Body weight QTL 111 2.7 0.004 body mass (VT:0001259) body weight (CMO:0000012) 20 1 32578807 Rat 9590252 Scort12 Serum corticosterone level QTL 12 20.46 0.001 blood corticosterone amount (VT:0005345) plasma corticosterone level (CMO:0001173) 20 1 36600972 Rat 737973 Pia21 Pristane induced arthritis QTL 21 4.8 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 20 3621656 4606812 Rat
RH142043
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 20 3,693,748 - 3,693,954 (-) MAPPER mRatBN7.2 Rnor_6.0 20 5,120,069 - 5,120,274 NCBI Rnor6.0 Rnor_5.0 20 7,193,328 - 7,193,533 UniSTS Rnor5.0 RGSC_v3.4 20 3,757,403 - 3,757,608 UniSTS RGSC3.4 Celera 20 4,331,688 - 4,331,893 UniSTS RH 3.4 Map 20 51.3 UniSTS Cytogenetic Map 20 p12 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
11
49
113
91
90
59
25
59
6
218
97
93
45
60
31
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000001126 ⟹ ENSRNOP00000001126
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 20 3,688,413 - 3,693,550 (+) Ensembl Rnor_6.0 Ensembl 20 5,120,474 - 5,123,073 (-) Ensembl
Ensembl Acc Id:
ENSRNOT00000078273
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source Rnor_6.0 Ensembl 20 5,122,232 - 5,123,057 (-) Ensembl
Ensembl Acc Id:
ENSRNOT00000096939 ⟹ ENSRNOP00000077771
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 20 3,690,950 - 3,692,938 (+) Ensembl
RefSeq Acc Id:
NM_019373 ⟹ NP_062246
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 20 3,695,618 - 3,698,218 (+) NCBI mRatBN7.2 20 3,690,950 - 3,693,550 (+) NCBI Rnor_6.0 20 5,120,473 - 5,123,073 (-) NCBI Rnor_5.0 20 7,193,732 - 7,196,332 (-) NCBI RGSC_v3.4 20 3,754,604 - 3,757,204 (+) RGD Celera 20 4,332,092 - 4,334,693 (-) RGD
Sequence:
AGAGCAGACTGAGCAGCCAGCAGAGAACAGTTAAGGTAGAGGTCCCCAGAACCGCACAGCGCCAGGTCTCCTCCCAAGATGTTCCACCAAGTCTGGGCAGCGCTGCTCTATCTCTACGGCCTTCTCTT
hide sequence
RefSeq Acc Id:
NP_062246 ⟸ NM_019373
- Peptide Label:
precursor
- UniProtKB:
Q5EBB9 (UniProtKB/Swiss-Prot), Q9QXI9 (UniProtKB/Swiss-Prot), P14630 (UniProtKB/Swiss-Prot), A6KTU9 (UniProtKB/TrEMBL)
- Sequence:
MFHQVWAALLYLYGLLFNSMNQCPEHSQLMTLGMDDKETPEPHLGLWYFIAGAAPTMEELATFDQVDNIVFNMAAGSAPRQLQLRATIRTKNGVCVPRKWTYHLTEGKGNTELRTEGRPDMKTDLFSI
hide sequence
Ensembl Acc Id:
ENSRNOP00000001126 ⟸ ENSRNOT00000001126
Ensembl Acc Id:
ENSRNOP00000077771 ⟸ ENSRNOT00000096939
RGD ID: 13701396 Promoter ID: EPDNEW_R11919 Type: initiation region Name: Apom_1 Description: apolipoprotein M SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Rat Assembly Chr Position (strand) Source Rnor_6.0 20 5,123,073 - 5,123,133 EPDNEW
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2004-09-10
Apom
apolipoprotein M
Symbol and Name status set to approved
1299863 APPROVED
2002-08-07
Apom
apolipoprotein M
Symbol and Name status set to provisional
70820 PROVISIONAL
Note Type
Note
Reference
gene_mapping
found within the rat major histocompatibility RT1 complex
1300431
