Symbol:
Msr1
Name:
macrophage scavenger receptor 1
RGD ID:
1564316
Description:
Predicted to enable amyloid-beta binding activity; cargo receptor activity; and low-density lipoprotein particle binding activity. Predicted to be involved in several processes, including endocytosis; positive regulation of cholesterol storage; and positive regulation of macrophage derived foam cell differentiation. Predicted to act upstream of or within establishment of localization in cell and lipoprotein transport. Predicted to be located in plasma membrane. Human ortholog(s) of this gene implicated in Barrett's esophagus; arteriosclerosis; and prostate cancer. Orthologous to human MSR1 (macrophage scavenger receptor 1); PARTICIPATES IN phagocytosis pathway; INTERACTS WITH 1,2-dimethylhydrazine; 17beta-estradiol; 2,3,7,8-tetrachlorodibenzodioxine.
Type:
protein-coding
RefSeq Status:
VALIDATED
Previously known as:
LOC498638; macrophage scavenger receptor types I and II; RGD1564316; similar to scavenger receptor type A SR-A
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 16 59,421,250 - 59,507,070 (+) NCBI GRCr8 mRatBN7.2 16 52,717,775 - 52,803,602 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 16 52,717,732 - 52,799,676 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 16 58,047,955 - 58,113,146 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 16 61,453,017 - 61,518,269 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 16 56,681,953 - 56,747,156 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 16 56,817,714 - 56,900,025 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 16 56,813,791 - 56,900,052 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 16 56,516,982 - 56,597,180 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 16 56,278,223 - 56,345,472 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 Celera 16 50,621,592 - 50,686,791 (+) NCBI Celera Cytogenetic Map 16 q12.1 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Msr1 Rat (R)-lipoic acid multiple interactions ISO MSR1 (Homo sapiens) 6480464 Thioctic Acid inhibits the reaction [arsenic trioxide inhibits the reaction [Tetradecanoylphorbol Acetate results in increased expression of MSR1 mRNA]] CTD PMID:21315065 Msr1 Rat 1,2-dimethylhydrazine multiple interactions EXP 6480464 [APC protein affects the susceptibility to 1 and 2-Dimethylhydrazine] which results in increased expression of MSR1 mRNA CTD PMID:27840820 Msr1 Rat 1,2-dimethylhydrazine increases expression ISO Msr1 (Mus musculus) 6480464 1 and 2-Dimethylhydrazine results in increased expression of MSR1 mRNA CTD PMID:22206623 Msr1 Rat 17alpha-ethynylestradiol multiple interactions ISO Msr1 (Mus musculus) 6480464 [Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of MSR1 mRNA CTD PMID:17942748 Msr1 Rat 17beta-estradiol increases expression ISO Msr1 (Mus musculus) 6480464 Estradiol results in increased expression of MSR1 mRNA CTD PMID:19484750 Msr1 Rat 17beta-estradiol decreases expression ISO Msr1 (Mus musculus) 6480464 Estradiol results in decreased expression of MSR1 mRNA CTD PMID:39298647 Msr1 Rat 17beta-estradiol affects expression EXP 6480464 Estradiol affects the expression of MSR1 mRNA CTD PMID:32145629 Msr1 Rat 2,2',4,4',5,5'-hexachlorobiphenyl multiple interactions ISO Msr1 (Mus musculus) 6480464 [2 more ... CTD PMID:25510870 Msr1 Rat 2,2',4,4'-Tetrabromodiphenyl ether increases expression ISO MSR1 (Homo sapiens) 6480464 2 more ... CTD PMID:23146750 Msr1 Rat 2,2',5,5'-tetrachlorobiphenyl multiple interactions ISO Msr1 (Mus musculus) 6480464 [2 more ... CTD PMID:25510870 Msr1 Rat 2,3,7,8-tetrachlorodibenzodioxine multiple interactions ISO Msr1 (Mus musculus) 6480464 [Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of MSR1 mRNA and Tetrachlorodibenzodioxin promotes the reaction [AHR protein binds to MSR1 promoter] CTD PMID:17942748 and PMID:19654925 Msr1 Rat 2,3,7,8-tetrachlorodibenzodioxine affects expression EXP 6480464 Tetrachlorodibenzodioxin affects the expression of MSR1 mRNA CTD PMID:34747641 Msr1 Rat 2,3,7,8-tetrachlorodibenzodioxine increases expression ISO MSR1 (Homo sapiens) 6480464 Tetrachlorodibenzodioxin results in increased expression of MSR1 mRNA CTD PMID:21296121 Msr1 Rat 2,4-dibromophenyl 2,4,5-tribromophenyl ether affects expression ISO Msr1 (Mus musculus) 6480464 2 more ... CTD PMID:38648751 Msr1 Rat 3,3',4,4',5-pentachlorobiphenyl decreases expression ISO MSR1 (Homo sapiens) 6480464 3 more ... CTD PMID:23146750 Msr1 Rat 4,4'-sulfonyldiphenol increases expression ISO Msr1 (Mus musculus) 6480464 bisphenol S results in increased expression of MSR1 mRNA CTD PMID:30951980 Msr1 Rat 4-hydroxyphenyl retinamide decreases expression ISO Msr1 (Mus musculus) 6480464 Fenretinide results in decreased expression of MSR1 mRNA CTD PMID:28973697 Msr1 Rat 4-hydroxyphenyl retinamide increases expression ISO Msr1 (Mus musculus) 6480464 Fenretinide results in increased expression of MSR1 mRNA CTD PMID:28973697 Msr1 Rat 5-aza-2'-deoxycytidine multiple interactions ISO MSR1 (Homo sapiens) 6480464 Decitabine inhibits the reaction [Smoke results in decreased expression of MSR1 mRNA] CTD PMID:21095227 Msr1 Rat 5-aza-2'-deoxycytidine increases expression ISO Msr1 (Mus musculus) 6480464 Decitabine results in increased expression of MSR1 mRNA CTD PMID:29718165 Msr1 Rat acetamide increases expression EXP 6480464 acetamide results in increased expression of MSR1 mRNA CTD PMID:31881176 Msr1 Rat acrylamide increases expression ISO Msr1 (Mus musculus) 6480464 Acrylamide results in increased expression of MSR1 mRNA CTD PMID:30807115 Msr1 Rat aldehydo-D-glucose multiple interactions ISO Msr1 (Mus musculus) 6480464 [lard co-treated with Cholesterol and Dietary co-treated with Dietary Sucrose co-treated with Fructose co-treated with Glucose co-treated with Glyphosate] results in increased expression of MSR1 mRNA CTD PMID:37567420 Msr1 Rat antirheumatic drug decreases expression ISO MSR1 (Homo sapiens) 6480464 Antirheumatic Agents results in decreased expression of MSR1 mRNA CTD PMID:24449571 Msr1 Rat apocynin multiple interactions ISO MSR1 (Homo sapiens) 6480464 acetovanillone inhibits the reaction [Tetradecanoylphorbol Acetate results in increased expression of MSR1 mRNA] CTD PMID:9614211 Msr1 Rat aristolochic acid A decreases expression ISO MSR1 (Homo sapiens) 6480464 aristolochic acid I results in decreased expression of MSR1 mRNA CTD PMID:33212167 Msr1 Rat arsenous acid multiple interactions ISO MSR1 (Homo sapiens) 6480464 Arsenic Trioxide inhibits the reaction [Tetradecanoylphorbol Acetate results in increased expression of MSR1 mRNA] and Thioctic Acid inhibits the reaction [Arsenic Trioxide inhibits the reaction [Tetradecanoylphorbol Acetate results in increased expression of MSR1 mRNA]] CTD PMID:21315065 Msr1 Rat arsenous acid decreases expression ISO MSR1 (Homo sapiens) 6480464 Arsenic Trioxide results in decreased expression of MSR1 mRNA CTD PMID:20458559 Msr1 Rat atorvastatin calcium multiple interactions ISO MSR1 (Homo sapiens) 6480464 [Rosiglitazone co-treated with Atorvastatin] results in increased expression of MSR1 mRNA CTD PMID:15183127 Msr1 Rat benzo[a]pyrene multiple interactions ISO Msr1 (Mus musculus) 6480464 [Benzo(a)pyrene co-treated with benz(a)anthracene co-treated with benzo(b)fluoranthene co-treated with chrysene] results in increased expression of MSR1 mRNA CTD PMID:27858113 Msr1 Rat benzo[a]pyrene decreases expression ISO MSR1 (Homo sapiens) 6480464 Benzo(a)pyrene results in decreased expression of MSR1 mRNA CTD PMID:32234424 Msr1 Rat benzo[a]pyrene decreases methylation ISO MSR1 (Homo sapiens) 6480464 Benzo(a)pyrene results in decreased methylation of MSR1 5' UTR CTD PMID:27901495 Msr1 Rat benzo[b]fluoranthene increases expression ISO Msr1 (Mus musculus) 6480464 benzo(b)fluoranthene results in increased expression of MSR1 mRNA CTD PMID:26377693 Msr1 Rat benzo[b]fluoranthene multiple interactions ISO Msr1 (Mus musculus) 6480464 [Benzo(a)pyrene co-treated with benz(a)anthracene co-treated with benzo(b)fluoranthene co-treated with chrysene] results in increased expression of MSR1 mRNA CTD PMID:27858113 Msr1 Rat bisdemethoxycurcumin multiple interactions ISO MSR1 (Homo sapiens) 6480464 bisdemethoxycurcumin inhibits the reaction [Tetradecanoylphorbol Acetate results in increased expression of MSR1 mRNA] CTD PMID:23386263 Msr1 Rat bisphenol A decreases expression EXP 6480464 bisphenol A results in decreased expression of MSR1 mRNA CTD PMID:25181051 Msr1 Rat bisphenol A increases methylation ISO MSR1 (Homo sapiens) 6480464 bisphenol A results in increased methylation of MSR1 gene CTD PMID:31601247 Msr1 Rat bisphenol A affects expression EXP 6480464 bisphenol A affects the expression of MSR1 mRNA CTD PMID:32145629 Msr1 Rat bisphenol F increases expression ISO Msr1 (Mus musculus) 6480464 bisphenol F results in increased expression of MSR1 mRNA CTD PMID:30951980 Msr1 Rat Calcimycin multiple interactions ISO MSR1 (Homo sapiens) 6480464 Calcimycin promotes the reaction [[Hydrogen Peroxide co-treated with Vanadates] results in increased expression of MSR1 mRNA alternative form] CTD PMID:10837497 Msr1 Rat calcitriol decreases expression ISO MSR1 (Homo sapiens) 6480464 Calcitriol results in decreased expression of MSR1 mRNA CTD PMID:26485663 Msr1 Rat carbon nanotube affects response to substance ISO Msr1 (Mus musculus) 6480464 MSR1 protein affects the susceptibility to Nanotubes and Carbon CTD PMID:22664788 Msr1 Rat carbon nanotube increases expression ISO Msr1 (Mus musculus) 6480464 Nanotubes more ... CTD PMID:25554681 Msr1 Rat carmustine decreases expression ISO MSR1 (Homo sapiens) 6480464 Carmustine results in decreased expression of MSR1 mRNA CTD PMID:15980968 Msr1 Rat cholesterol multiple interactions ISO MSR1 (Homo sapiens) 6480464 [resveratrol results in decreased expression of MSR1 protein] which results in decreased uptake of Cholesterol CTD PMID:20372816 Msr1 Rat choline multiple interactions ISO Msr1 (Mus musculus) 6480464 [Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in increased expression of MSR1 mRNA CTD PMID:20938992 Msr1 Rat chrysene multiple interactions ISO Msr1 (Mus musculus) 6480464 [Benzo(a)pyrene co-treated with benz(a)anthracene co-treated with benzo(b)fluoranthene co-treated with chrysene] results in increased expression of MSR1 mRNA CTD PMID:27858113 Msr1 Rat curcumin multiple interactions ISO MSR1 (Homo sapiens) 6480464 Curcumin inhibits the reaction [malondialdehyde-low density lipoprotein more ... CTD PMID:23386263 Msr1 Rat cycloheximide multiple interactions ISO MSR1 (Homo sapiens) 6480464 Cycloheximide inhibits the reaction [Tetradecanoylphorbol Acetate results in increased expression of MSR1 mRNA] CTD PMID:9614211 Msr1 Rat D-glucose multiple interactions ISO Msr1 (Mus musculus) 6480464 [lard co-treated with Cholesterol and Dietary co-treated with Dietary Sucrose co-treated with Fructose co-treated with Glucose co-treated with Glyphosate] results in increased expression of MSR1 mRNA CTD PMID:37567420 Msr1 Rat demethoxycurcumin multiple interactions ISO MSR1 (Homo sapiens) 6480464 demethoxycurcumin inhibits the reaction [Tetradecanoylphorbol Acetate results in increased expression of MSR1 mRNA] CTD PMID:23386263 Msr1 Rat desferrioxamine B multiple interactions ISO MSR1 (Homo sapiens) 6480464 Deferoxamine inhibits the reaction [Tetradecanoylphorbol Acetate results in increased expression of MSR1 mRNA] CTD PMID:9614211 Msr1 Rat diarsenic trioxide decreases expression ISO MSR1 (Homo sapiens) 6480464 Arsenic Trioxide results in decreased expression of MSR1 mRNA CTD PMID:20458559 Msr1 Rat diarsenic trioxide multiple interactions ISO MSR1 (Homo sapiens) 6480464 Arsenic Trioxide inhibits the reaction [Tetradecanoylphorbol Acetate results in increased expression of MSR1 mRNA] and Thioctic Acid inhibits the reaction [Arsenic Trioxide inhibits the reaction [Tetradecanoylphorbol Acetate results in increased expression of MSR1 mRNA]] CTD PMID:21315065 Msr1 Rat dibenz[a,h]anthracene increases expression ISO Msr1 (Mus musculus) 6480464 1 more ... CTD PMID:26377693 Msr1 Rat dioxygen increases expression ISO MSR1 (Homo sapiens) 6480464 Oxygen deficiency results in increased expression of MSR1 mRNA CTD PMID:26516004 Msr1 Rat dioxygen multiple interactions EXP 6480464 [Oxygen deficiency co-treated with Blood Glucose deficiency co-treated with Particulate Matter] results in increased expression of MSR1 mRNA CTD PMID:33729688 Msr1 Rat dioxygen multiple interactions ISO Msr1 (Mus musculus) 6480464 [NFE2L2 protein affects the susceptibility to Oxygen] which affects the expression of MSR1 mRNA CTD PMID:30529165 Msr1 Rat disodium selenite decreases expression ISO Msr1 (Mus musculus) 6480464 Sodium Selenite results in decreased expression of MSR1 mRNA CTD PMID:23274088 Msr1 Rat epoxiconazole increases expression ISO Msr1 (Mus musculus) 6480464 epoxiconazole results in increased expression of MSR1 mRNA CTD PMID:35436446 Msr1 Rat ethanol multiple interactions ISO Msr1 (Mus musculus) 6480464 [Carbon Tetrachloride co-treated with Ethanol] results in increased expression of MSR1 mRNA CTD PMID:30517762 Msr1 Rat ethyl methanesulfonate decreases expression ISO MSR1 (Homo sapiens) 6480464 Ethyl Methanesulfonate results in decreased expression of MSR1 mRNA CTD PMID:23649840 Msr1 Rat folic acid multiple interactions ISO Msr1 (Mus musculus) 6480464 [Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in increased expression of MSR1 mRNA CTD PMID:20938992 Msr1 Rat formaldehyde decreases expression ISO MSR1 (Homo sapiens) 6480464 Formaldehyde results in decreased expression of MSR1 mRNA CTD PMID:23649840 Msr1 Rat fructose multiple interactions ISO Msr1 (Mus musculus) 6480464 [lard co-treated with Cholesterol and Dietary co-treated with Dietary Sucrose co-treated with Fructose co-treated with Glucose co-treated with Glyphosate] results in increased expression of MSR1 mRNA CTD PMID:37567420 Msr1 Rat furosemide increases expression EXP 6480464 Furosemide results in increased expression of MSR1 mRNA CTD PMID:16526316 Msr1 Rat glucose multiple interactions ISO Msr1 (Mus musculus) 6480464 [lard co-treated with Cholesterol and Dietary co-treated with Dietary Sucrose co-treated with Fructose co-treated with Glucose co-treated with Glyphosate] results in increased expression of MSR1 mRNA CTD PMID:37567420 Msr1 Rat glyphosate multiple interactions ISO Msr1 (Mus musculus) 6480464 [lard co-treated with Cholesterol and Dietary co-treated with Dietary Sucrose co-treated with Fructose co-treated with Glucose co-treated with Glyphosate] results in increased expression of MSR1 mRNA CTD PMID:37567420 Msr1 Rat glyphosate decreases methylation EXP 6480464 Glyphosate results in decreased methylation of MSR1 gene CTD PMID:31011160 Msr1 Rat hydrogen peroxide multiple interactions ISO MSR1 (Homo sapiens) 6480464 [Hydrogen Peroxide co-treated with Vanadates] results in increased expression of MSR1 mRNA alternative form and Calcimycin promotes the reaction [[Hydrogen Peroxide co-treated with Vanadates] results in increased expression of MSR1 mRNA alternative form] CTD PMID:10837497 Msr1 Rat hydroxyl decreases degradation ISO MSR1 (Homo sapiens) 6480464 Hydroxyl Radical results in decreased degradation of MSR1 mRNA CTD PMID:9614211 Msr1 Rat irinotecan increases expression EXP 6480464 Irinotecan results in increased expression of MSR1 mRNA CTD PMID:20097248 Msr1 Rat isoprenaline increases expression ISO Msr1 (Mus musculus) 6480464 Isoproterenol results in increased expression of MSR1 mRNA CTD PMID:20003209 Msr1 Rat L-methionine multiple interactions ISO Msr1 (Mus musculus) 6480464 [Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in increased expression of MSR1 mRNA CTD PMID:20938992 Msr1 Rat lidocaine increases expression EXP 6480464 Lidocaine results in increased expression of MSR1 mRNA CTD PMID:35283115 Msr1 Rat lipoic acid multiple interactions ISO MSR1 (Homo sapiens) 6480464 Thioctic Acid inhibits the reaction [arsenic trioxide inhibits the reaction [Tetradecanoylphorbol Acetate results in increased expression of MSR1 mRNA]] CTD PMID:21315065 Msr1 Rat lipopolysaccharide multiple interactions ISO MSR1 (Homo sapiens) 6480464 Plant Extracts affects the reaction [Lipopolysaccharides affects the expression of MSR1 mRNA] CTD PMID:28070326 Msr1 Rat lipopolysaccharide increases expression ISO Msr1 (Mus musculus) 6480464 Lipopolysaccharides results in increased expression of MSR1 mRNA and Lipopolysaccharides results in increased expression of MSR1 protein CTD PMID:10223745 and PMID:22169119 Msr1 Rat lipopolysaccharide multiple interactions ISO Msr1 (Mus musculus) 6480464 [Eicosapentaenoic Acid co-treated with procyanidin B3] promotes the reaction [Lipopolysaccharides results in increased expression of MSR1 mRNA] more ... CTD PMID:22169119 and PMID:29718165 Msr1 Rat lipopolysaccharide affects expression ISO MSR1 (Homo sapiens) 6480464 Lipopolysaccharides affects the expression of MSR1 mRNA CTD PMID:28070326 Msr1 Rat LLY-507 multiple interactions ISO Msr1 (Mus musculus) 6480464 [LLY-507 affects the susceptibility to [Lipopolysaccharides co-treated with IFNG protein]] which results in decreased expression of MSR1 mRNA CTD PMID:29718165 Msr1 Rat mercury atom multiple interactions ISO Msr1 (Mus musculus) 6480464 [Mercuric Chloride results in increased abundance of Mercury] which results in increased expression of MSR1 mRNA CTD PMID:28453771 Msr1 Rat mercury dichloride multiple interactions ISO Msr1 (Mus musculus) 6480464 [Mercuric Chloride results in increased abundance of Mercury] which results in increased expression of MSR1 mRNA CTD PMID:28453771 Msr1 Rat mercury(0) multiple interactions ISO Msr1 (Mus musculus) 6480464 [Mercuric Chloride results in increased abundance of Mercury] which results in increased expression of MSR1 mRNA CTD PMID:28453771 Msr1 Rat methyl methanesulfonate decreases expression ISO MSR1 (Homo sapiens) 6480464 Methyl Methanesulfonate results in decreased expression of MSR1 mRNA CTD PMID:23649840 Msr1 Rat miquelianin decreases expression ISO Msr1 (Mus musculus) 6480464 quercetin 3-O-glucuronide results in decreased expression of MSR1 mRNA CTD PMID:18199750 Msr1 Rat Monobutylphthalate increases expression EXP 6480464 monobutyl phthalate results in increased expression of MSR1 mRNA CTD PMID:29162477 Msr1 Rat ozone multiple interactions ISO Msr1 (Mus musculus) 6480464 [Air Pollutants results in increased abundance of [Ozone co-treated with Soot]] which results in increased expression of MSR1 mRNA CTD PMID:34911549 Msr1 Rat ozone increases expression ISO Msr1 (Mus musculus) 6480464 Ozone results in increased expression of MSR1 mRNA CTD PMID:33026818 Msr1 Rat paracetamol affects expression ISO Msr1 (Mus musculus) 6480464 Acetaminophen affects the expression of MSR1 mRNA CTD PMID:17562736 Msr1 Rat paracetamol increases expression ISO MSR1 (Homo sapiens) 6480464 Acetaminophen results in increased expression of MSR1 mRNA CTD PMID:29067470 Msr1 Rat paraquat increases expression EXP 6480464 Paraquat results in increased expression of MSR1 mRNA CTD PMID:32680482 Msr1 Rat PCB138 multiple interactions ISO Msr1 (Mus musculus) 6480464 [2 more ... CTD PMID:25510870 Msr1 Rat phorbol 13-acetate 12-myristate multiple interactions ISO MSR1 (Homo sapiens) 6480464 1 more ... CTD PMID:16484594 more ... Msr1 Rat phorbol 13-acetate 12-myristate increases expression ISO MSR1 (Homo sapiens) 6480464 Tetradecanoylphorbol Acetate results in increased expression of MSR1 mRNA and Tetradecanoylphorbol Acetate results in increased expression of MSR1 mRNA alternative form CTD PMID:16484594 more ... Msr1 Rat phorbol 13-acetate 12-myristate multiple interactions ISO Msr1 (Mus musculus) 6480464 tamibarotene inhibits the reaction [Tetradecanoylphorbol Acetate results in increased expression of MSR1 mRNA] CTD PMID:16484594 Msr1 Rat phorbol 13-acetate 12-myristate increases expression ISO Msr1 (Mus musculus) 6480464 Tetradecanoylphorbol Acetate results in increased expression of MSR1 mRNA CTD PMID:16484594 Msr1 Rat procyanidin B3 multiple interactions ISO Msr1 (Mus musculus) 6480464 [Eicosapentaenoic Acid co-treated with procyanidin B3] promotes the reaction [Lipopolysaccharides results in increased expression of MSR1 mRNA] CTD PMID:22169119 Msr1 Rat quartz increases expression EXP 6480464 Quartz results in increased expression of MSR1 mRNA CTD PMID:19836432 Msr1 Rat resveratrol multiple interactions ISO MSR1 (Homo sapiens) 6480464 [resveratrol results in decreased expression of MSR1 protein] which results in decreased uptake of Cholesterol more ... CTD PMID:17938187 and PMID:20372816 Msr1 Rat resveratrol decreases expression ISO MSR1 (Homo sapiens) 6480464 resveratrol results in decreased expression of MSR1 mRNA and resveratrol results in decreased expression of MSR1 protein CTD PMID:16901463 and PMID:20372816 Msr1 Rat rotenone multiple interactions ISO MSR1 (Homo sapiens) 6480464 Rotenone inhibits the reaction [Tetradecanoylphorbol Acetate results in increased expression of MSR1 mRNA] CTD PMID:9614211 Msr1 Rat silicon dioxide increases expression ISO Msr1 (Mus musculus) 6480464 Silicon Dioxide results in increased expression of MSR1 mRNA CTD PMID:29341224 Msr1 Rat sirolimus decreases expression ISO MSR1 (Homo sapiens) 6480464 Sirolimus results in decreased expression of MSR1 mRNA CTD PMID:17016853 Msr1 Rat sodium arsenite affects methylation ISO MSR1 (Homo sapiens) 6480464 sodium arsenite affects the methylation of MSR1 gene CTD PMID:28589171 Msr1 Rat sodium arsenite increases expression ISO MSR1 (Homo sapiens) 6480464 sodium arsenite results in increased expression of MSR1 mRNA CTD PMID:38568856 Msr1 Rat sodium benzoate multiple interactions ISO MSR1 (Homo sapiens) 6480464 Sodium Benzoate inhibits the reaction [Tetradecanoylphorbol Acetate results in increased expression of MSR1 mRNA alternative form] and Sodium Benzoate inhibits the reaction [Tetradecanoylphorbol Acetate results in increased expression of MSR1 mRNA] CTD PMID:9614211 Msr1 Rat tamibarotene multiple interactions ISO Msr1 (Mus musculus) 6480464 tamibarotene inhibits the reaction [Tetradecanoylphorbol Acetate results in increased expression of MSR1 mRNA] CTD PMID:16484594 Msr1 Rat tamibarotene multiple interactions ISO MSR1 (Homo sapiens) 6480464 tamibarotene inhibits the reaction [Tetradecanoylphorbol Acetate results in increased expression of MSR1 mRNA] CTD PMID:16484594 Msr1 Rat Tanshinone I decreases expression ISO Msr1 (Mus musculus) 6480464 tanshinone results in decreased expression of MSR1 mRNA CTD PMID:20854809 Msr1 Rat TEMPO multiple interactions ISO MSR1 (Homo sapiens) 6480464 TEMPO inhibits the reaction [Tetradecanoylphorbol Acetate results in increased expression of MSR1 mRNA alternative form] and TEMPO inhibits the reaction [Tetradecanoylphorbol Acetate results in increased expression of MSR1 mRNA] CTD PMID:9614211 Msr1 Rat tetrachloromethane multiple interactions ISO Msr1 (Mus musculus) 6480464 [Carbon Tetrachloride co-treated with Ethanol] results in increased expression of MSR1 mRNA CTD PMID:30517762 Msr1 Rat tetraphene multiple interactions ISO Msr1 (Mus musculus) 6480464 [Benzo(a)pyrene co-treated with benz(a)anthracene co-treated with benzo(b)fluoranthene co-treated with chrysene] results in increased expression of MSR1 mRNA CTD PMID:27858113 Msr1 Rat thioacetamide increases expression EXP 6480464 Thioacetamide results in increased expression of MSR1 mRNA CTD PMID:34492290 Msr1 Rat titanium dioxide increases expression ISO Msr1 (Mus musculus) 6480464 titanium dioxide results in increased expression of MSR1 mRNA CTD PMID:23557971 and PMID:27760801 Msr1 Rat tremolite asbestos increases expression ISO Msr1 (Mus musculus) 6480464 tremolite results in increased expression of MSR1 mRNA CTD PMID:29279043 Msr1 Rat trichloroethene decreases expression EXP 6480464 Trichloroethylene results in decreased expression of MSR1 mRNA CTD PMID:33387578 Msr1 Rat trichostatin A increases expression ISO Msr1 (Mus musculus) 6480464 trichostatin A results in increased expression of MSR1 mRNA CTD PMID:29718165 Msr1 Rat valproic acid decreases methylation ISO MSR1 (Homo sapiens) 6480464 Valproic Acid results in decreased methylation of MSR1 gene CTD PMID:29154799 Msr1 Rat zinc oxide multiple interactions ISO MSR1 (Homo sapiens) 6480464 [Zinc Oxide analog co-treated with Tetradecanoylphorbol Acetate] results in increased expression of MSR1 protein CTD PMID:24746987
Imported Annotations - KEGG (archival)
(R)-lipoic acid (ISO) 1,2-dimethylhydrazine (EXP,ISO) 17alpha-ethynylestradiol (ISO) 17beta-estradiol (EXP,ISO) 2,2',4,4',5,5'-hexachlorobiphenyl (ISO) 2,2',4,4'-Tetrabromodiphenyl ether (ISO) 2,2',5,5'-tetrachlorobiphenyl (ISO) 2,3,7,8-tetrachlorodibenzodioxine (EXP,ISO) 2,4-dibromophenyl 2,4,5-tribromophenyl ether (ISO) 3,3',4,4',5-pentachlorobiphenyl (ISO) 4,4'-sulfonyldiphenol (ISO) 4-hydroxyphenyl retinamide (ISO) 5-aza-2'-deoxycytidine (ISO) acetamide (EXP) acrylamide (ISO) aldehydo-D-glucose (ISO) antirheumatic drug (ISO) apocynin (ISO) aristolochic acid A (ISO) arsenous acid (ISO) atorvastatin calcium (ISO) benzo[a]pyrene (ISO) benzo[b]fluoranthene (ISO) bisdemethoxycurcumin (ISO) bisphenol A (EXP,ISO) bisphenol F (ISO) Calcimycin (ISO) calcitriol (ISO) carbon nanotube (ISO) carmustine (ISO) cholesterol (ISO) choline (ISO) chrysene (ISO) curcumin (ISO) cycloheximide (ISO) D-glucose (ISO) demethoxycurcumin (ISO) desferrioxamine B (ISO) diarsenic trioxide (ISO) dibenz[a,h]anthracene (ISO) dioxygen (EXP,ISO) disodium selenite (ISO) epoxiconazole (ISO) ethanol (ISO) ethyl methanesulfonate (ISO) folic acid (ISO) formaldehyde (ISO) fructose (ISO) furosemide (EXP) glucose (ISO) glyphosate (EXP,ISO) hydrogen peroxide (ISO) hydroxyl (ISO) irinotecan (EXP) isoprenaline (ISO) L-methionine (ISO) lidocaine (EXP) lipoic acid (ISO) lipopolysaccharide (ISO) LLY-507 (ISO) mercury atom (ISO) mercury dichloride (ISO) mercury(0) (ISO) methyl methanesulfonate (ISO) miquelianin (ISO) Monobutylphthalate (EXP) ozone (ISO) paracetamol (ISO) paraquat (EXP) PCB138 (ISO) phorbol 13-acetate 12-myristate (ISO) procyanidin B3 (ISO) quartz (EXP) resveratrol (ISO) rotenone (ISO) silicon dioxide (ISO) sirolimus (ISO) sodium arsenite (ISO) sodium benzoate (ISO) tamibarotene (ISO) Tanshinone I (ISO) TEMPO (ISO) tetrachloromethane (ISO) tetraphene (ISO) thioacetamide (EXP) titanium dioxide (ISO) tremolite asbestos (ISO) trichloroethene (EXP) trichostatin A (ISO) valproic acid (ISO) zinc oxide (ISO)
1.
Scavenger receptor-A-targeted leukocyte depletion inhibits peritoneal ovarian tumor progression.
Bak SP, etal., Cancer Res. 2007 May 15;67(10):4783-9.
2.
Phylogenetic-based propagation of functional annotations within the Gene Ontology consortium.
Gaudet P, etal., Brief Bioinform. 2011 Sep;12(5):449-62. doi: 10.1093/bib/bbr042. Epub 2011 Aug 27.
3.
Adeno-associated virus-mediated gene transfer of a secreted decoy human macrophage scavenger receptor reduces atherosclerotic lesion formation in LDL receptor knockout mice.
Jalkanen J, etal., Mol Ther. 2003 Dec;8(6):903-10.
4.
Potential effects of microglial activation induced by ginsenoside Rg3 in rat primary culture: enhancement of type A Macrophage Scavenger Receptor expression.
Joo SS and Lee DI, Arch Pharm Res. 2005 Oct;28(10):1164-9.
5.
Elucidating the molecular physiopathology of acute respiratory distress syndrome in severe acute respiratory syndrome patients.
Kong SL, etal., Virus Res. 2009 Nov;145(2):260-9. Epub 2009 Jul 25.
6.
Pulmonary surfactant protein A augments the phagocytosis of Streptococcus pneumoniae by alveolar macrophages through a casein kinase 2-dependent increase of cell surface localization of scavenger receptor A.
Kuronuma K, etal., J Biol Chem. 2004 May 14;279(20):21421-30. Epub 2004 Mar 1.
7.
A genome-wide association study of breast and prostate cancer in the NHLBI's Framingham Heart Study.
Murabito JM, etal., BMC Med Genet. 2007 Sep 19;8 Suppl 1:S6.
8.
Class A macrophage scavenger receptor gene expression levels in peripheral blood mononuclear cells specifically increase in patients with acute coronary syndrome.
Nakayama M, etal., Atherosclerosis. 2008 Jun;198(2):426-33. Epub 2007 Oct 22.
9.
OMIM Disease Annotation Pipeline
OMIM Disease Annotation Pipeline
10.
KEGG Annotation Import Pipeline
Pipeline to import KEGG annotations from KEGG into RGD
11.
ClinVar Automated Import and Annotation Pipeline
RGD automated import pipeline for ClinVar variants, variant-to-disease annotations and gene-to-disease annotations
12.
Data Import for Chemical-Gene Interactions
RGD automated import pipeline for gene-chemical interactions
13.
Comprehensive gene review and curation
RGD comprehensive gene curation
14.
Requirement of JNK2 for scavenger receptor A-mediated foam cell formation in atherogenesis.
Ricci R, etal., Science. 2004 Nov 26;306(5701):1558-61.
15.
A role for macrophage scavenger receptors in atherosclerosis and susceptibility to infection.
Suzuki H, etal., Nature. 1997 Mar 20;386(6622):292-6.
16.
Targeted deletion of class A macrophage scavenger receptor increases the risk of cardiac rupture after experimental myocardial infarction.
Tsujita K, etal., Circulation. 2007 Apr 10;115(14):1904-11. Epub 2007 Mar 26.
Msr1 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 16 59,421,250 - 59,507,070 (+) NCBI GRCr8 mRatBN7.2 16 52,717,775 - 52,803,602 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 16 52,717,732 - 52,799,676 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 16 58,047,955 - 58,113,146 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 16 61,453,017 - 61,518,269 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 16 56,681,953 - 56,747,156 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 16 56,817,714 - 56,900,025 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 16 56,813,791 - 56,900,052 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 16 56,516,982 - 56,597,180 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 16 56,278,223 - 56,345,472 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 Celera 16 50,621,592 - 50,686,791 (+) NCBI Celera Cytogenetic Map 16 q12.1 NCBI
MSR1 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 8 16,107,881 - 16,192,651 (-) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 8 16,107,878 - 16,567,490 (-) Ensembl GRCh38 hg38 GRCh38 GRCh37 8 15,965,390 - 16,050,160 (-) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 8 16,009,758 - 16,094,671 (-) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 8 16,009,760 - 16,094,595 NCBI Celera 8 14,929,936 - 15,014,828 (-) NCBI Celera Cytogenetic Map 8 p22 NCBI HuRef 8 14,509,923 - 14,594,638 (-) NCBI HuRef CHM1_1 8 16,167,312 - 16,251,899 (-) NCBI CHM1_1 T2T-CHM13v2.0 8 16,374,329 - 16,459,913 (-) NCBI T2T-CHM13v2.0
Msr1 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 8 39,996,284 - 40,095,790 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 8 40,034,726 - 40,095,714 (-) Ensembl GRCm39 Ensembl GRCm38 8 39,543,232 - 39,642,750 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 8 39,581,685 - 39,642,673 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 8 40,667,054 - 40,728,032 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 8 41,102,269 - 41,141,495 (-) NCBI MGSCv36 mm8 Celera 8 42,254,529 - 42,315,500 (-) NCBI Celera Cytogenetic Map 8 A4 NCBI cM Map 8 23.89 NCBI
Msr1 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955463 1,197,022 - 1,264,765 (+) Ensembl ChiLan1.0 ChiLan1.0 NW_004955463 1,197,086 - 1,263,943 (+) NCBI ChiLan1.0 ChiLan1.0
MSR1 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 7 34,577,677 - 34,663,873 (-) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 8 10,315,632 - 10,401,269 (-) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 8 15,335,795 - 15,421,472 (-) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 8 12,091,543 - 12,175,927 (-) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 8 12,088,873 - 12,175,927 (-) Ensembl panpan1.1 panPan2
MSR1 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 16 39,434,948 - 39,513,727 (-) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 16 39,436,753 - 39,527,438 (-) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 16 39,918,454 - 39,996,751 (-) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 16 41,487,019 - 41,565,417 (-) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 16 41,487,570 - 41,565,264 (-) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 16 39,583,887 - 39,662,157 (-) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 16 40,129,035 - 40,207,399 (-) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 16 40,253,347 - 40,331,889 (-) NCBI UU_Cfam_GSD_1.0
Msr1 Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024404943 39,750,600 - 39,814,340 (+) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936573 5,328,526 - 5,388,901 (-) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936573 5,345,282 - 5,391,946 (-) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
MSR1 Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 17 3,859,692 - 3,939,726 (-) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 17 3,859,903 - 3,939,612 (-) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 17 4,110,409 - 4,191,629 (-) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
MSR1 Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 8 14,221,389 - 14,305,059 (-) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 8 14,220,529 - 14,304,946 (-) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666052 28,000,740 - 28,084,945 (+) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Msr1
.
Predicted Target Of
Count of predictions: 22 Count of miRNA genes: 22 Interacting mature miRNAs: 22 Transcripts: ENSRNOT00000017339 Prediction methods: Miranda, Rnahybrid Result types: miRGate_prediction
2300163 Bmd64 Bone mineral density QTL 64 5.3 0.0001 lumbar vertebra mineral mass (VT:0010511) volumetric bone mineral density (CMO:0001553) 16 37752156 82752156 Rat 1600378 Arunc4 Aerobic running capacity QTL 4 0.03 exercise endurance trait (VT:0002332) maximum distance run on treadmill (CMO:0001406) 16 380245 80345693 Rat 70215 Niddm29 Non-insulin dependent diabetes mellitus QTL 29 3.54 blood glucose amount (VT:0000188) blood glucose level area under curve (AUC) (CMO:0000350) 16 19004435 75226532 Rat 1578768 Stresp22 Stress response QTL 22 2.8 thymus mass (VT:0004954) thymus wet weight (CMO:0000855) 16 35288870 80288870 Rat 737826 Alc11 Alcohol consumption QTL 11 3.2 consumption behavior trait (VT:0002069) ethanol drink intake rate (CMO:0001407) 16 4227609 60252231 Rat 2302057 Pia29 Pristane induced arthritis QTL 29 3.6 0.001 blood autoantibody amount (VT:0003725) serum immunoglobulin M-type rheumatoid factor level relative to an arbitrary reference serum (CMO:0002111) 16 21735975 66735975 Rat 7205510 Activ5 Activity QTL 5 3.78 0.00028 locomotor behavior trait (VT:0001392) number of entries into a discrete space in an experimental apparatus (CMO:0000960) 16 42396345 84729064 Rat 8694453 Bw172 Body weight QTL 172 8.33 0.001 retroperitoneal fat pad mass (VT:0010430) retroperitoneal fat pad weight to body weight ratio (CMO:0000635) 16 24325513 69325513 Rat 7411648 Foco22 Food consumption QTL 22 15 0.001 eating behavior trait (VT:0001431) feed conversion ratio (CMO:0001312) 16 52726464 84729064 Rat 1298529 Arunc1 Aerobic running capacity QTL 1 4 exercise endurance trait (VT:0002332) maximum distance run on treadmill (CMO:0001406) 16 31951520 60148445 Rat 2312663 Slep9 Serum leptin concentration QTL 9 0.001 blood leptin amount (VT:0005667) serum leptin level (CMO:0000780) 16 832236 59492508 Rat 2312660 Bw95 Body weight QTL 95 0.05 inguinal fat pad mass (VT:0010424) inguinal fat pad weight to body weight ratio (CMO:0001253) 16 832236 59492508 Rat 6903294 Stl30 Serum triglyceride level QTL 30 2.6 0.0013 blood triglyceride amount (VT:0002644) plasma triglyceride level (CMO:0000548) 16 25152793 70152793 Rat 2293690 Bss45 Bone structure and strength QTL 45 5.13 0.0001 lumbar vertebra morphology trait (VT:0010494) lumbar vertebra cortical cross-sectional area (CMO:0001690) 16 37752156 82752156 Rat 8694364 Abfw7 Abdominal fat weight QTL 7 12.22 0.001 visceral adipose mass (VT:0010063) abdominal fat pad weight to body weight ratio (CMO:0000095) 16 52726464 84729064 Rat 2312666 Insul16 Insulin level QTL 16 0.01 blood insulin amount (VT:0001560) serum insulin level (CMO:0000358) 16 832236 59492508 Rat 8694429 Bw164 Body weight QTL 164 5 0.001 body lean mass (VT:0010483) lean tissue morphological measurement (CMO:0002184) 16 52726464 84729064 Rat 70205 Gcr3 Gastric cancer resistance QTL 3 2.3 stomach morphology trait (VT:0000470) stomach tumor diameter (CMO:0001889) 16 17696791 82635055 Rat 2312669 Stl23 Serum triglyceride level QTL 23 0.01 blood triglyceride amount (VT:0002644) serum triglyceride level (CMO:0000360) 16 832236 59492508 Rat
L04275
Rat Assembly Chr Position (strand) Source JBrowse GRCr8 16 59,465,074 - 59,465,216 (+) Marker Load Pipeline mRatBN7.2 16 52,761,611 - 52,761,754 (-) MAPPER mRatBN7.2 Rnor_6.0 16 56,855,484 - 56,855,626 NCBI Rnor6.0 Rnor_5.0 16 56,554,428 - 56,554,570 UniSTS Rnor5.0 RGSC_v3.4 16 56,307,067 - 56,307,209 UniSTS RGSC3.4 Celera 16 50,649,092 - 50,649,234 UniSTS Cytogenetic Map 16 q12.1 UniSTS
RH127715
Rat Assembly Chr Position (strand) Source JBrowse Celera 16 50,678,418 - 50,678,630 UniSTS Celera 5 164,343,501 - 164,343,713 UniSTS Cytogenetic Map 5 q36 UniSTS Cytogenetic Map 16 q12.1 UniSTS
AA900898
Rat Assembly Chr Position (strand) Source JBrowse Celera 5 164,342,363 - 164,342,551 UniSTS Celera 16 50,677,236 - 50,677,425 UniSTS RH 3.4 Map 8 849.9 UniSTS Cytogenetic Map 1 p11 UniSTS Cytogenetic Map 16 q12.1 UniSTS Cytogenetic Map 5 q36 UniSTS
UniSTS:496680
Rat Assembly Chr Position (strand) Source JBrowse Rnor_5.0 2 176,377,830 - 176,378,105 NCBI Rnor5.0 Rnor_5.0 3 151,876,035 - 151,876,320 NCBI Rnor5.0 Rnor_5.0 16 56,527,453 - 56,527,738 NCBI Rnor5.0 RGSC_v3.4 1 32,051,429 - 32,051,703 UniSTS RGSC3.4 RGSC_v3.4 16 56,334,152 - 56,334,436 UniSTS RGSC3.4 Celera 16 50,676,178 - 50,676,462 UniSTS Cytogenetic Map 16 q12.1 UniSTS Cytogenetic Map 5 q36 UniSTS Cytogenetic Map 1 p11 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
10
43
111
91
90
59
25
59
6
211
90
91
45
60
31
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000017339 ⟹ ENSRNOP00000017339
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 16 52,717,732 - 52,799,676 (+) Ensembl Rnor_6.0 Ensembl 16 56,813,791 - 56,900,052 (-) Ensembl
RefSeq Acc Id:
NM_001191939 ⟹ NP_001178868
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 16 59,421,358 - 59,507,070 (+) NCBI mRatBN7.2 16 52,717,886 - 52,803,602 (+) NCBI Rnor_6.0 16 56,818,085 - 56,885,064 (-) NCBI Rnor_5.0 16 56,516,982 - 56,597,180 (-) NCBI Celera 16 50,621,592 - 50,686,791 (+) NCBI
Sequence:
ATGATAGAGAAACAGAGGCTCTGTCCTCCTGAACCGGAGGACGCTGACTGCTACTCAGAATCTGTGAAATTTGACGCACGTTCCATGACAGCATCCCTTCCTCACAACACTATAAATGGCTCCTCCGT
hide sequence
RefSeq Acc Id:
NM_001411777 ⟹ NP_001398706
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 16 59,421,358 - 59,468,304 (+) NCBI mRatBN7.2 16 52,717,886 - 52,764,842 (+) NCBI
RefSeq Acc Id:
XM_039094773 ⟹ XP_038950701
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 16 59,421,250 - 59,495,282 (+) NCBI mRatBN7.2 16 52,717,775 - 52,791,318 (+) NCBI
RefSeq Acc Id:
NP_001178868 ⟸ NM_001191939
- Peptide Label:
isoform 1
- UniProtKB:
D3ZDS2 (UniProtKB/TrEMBL)
- Sequence:
MIEKQRLCPPEPEDADCYSESVKFDARSMTASLPHNTINGSSVQEKLKSFKVALVALYLLVFAVLIPVVGIVTAQLVNWEMKNCLVGSANTSDTSQTLTGKENTSKAEMGFTIAMERMKALEERVQSI
hide sequence
Ensembl Acc Id:
ENSRNOP00000017339 ⟸ ENSRNOT00000017339
RefSeq Acc Id:
XP_038950701 ⟸ XM_039094773
- Peptide Label:
isoform X1
- UniProtKB:
D3ZDS2 (UniProtKB/TrEMBL)
RefSeq Acc Id:
NP_001398706 ⟸ NM_001411777
- Peptide Label:
isoform 2
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2008-03-06
Msr1
macrophage scavenger receptor 1
RGD1564316_predicted
similar to scavenger receptor type A SR-A (predicted)
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2006-03-07
RGD1564316_predicted
similar to scavenger receptor type A SR-A (predicted)
LOC498638
similar to scavenger receptor type A SR-A
Symbol and Name status set to approved
1299863 APPROVED
2006-02-09
LOC498638
similar to scavenger receptor type A SR-A
Symbol and Name status set to provisional
70820 PROVISIONAL
