Symbol:
Csk
Name:
C-terminal Src kinase
RGD ID:
1308800
Description:
Enables enzyme binding activity; proline-rich region binding activity; and protein tyrosine kinase activity. Involved in several processes, including negative regulation of bone resorption; negative regulation of metabolic process; and regulation of MAPK cascade. Located in cytoplasm. Biomarker of hepatocellular carcinoma. Orthologous to human CSK (C-terminal Src kinase); PARTICIPATES IN platelet-derived growth factor signaling pathway; chemokine mediated signaling pathway; neurotrophic factor signaling pathway; INTERACTS WITH (+)-schisandrin B; 2,3,7,8-tetrachlorodibenzodioxine; 2,4-dibromophenyl 2,4,5-tribromophenyl ether.
Type:
protein-coding
RefSeq Status:
VALIDATED
Previously known as:
C-SRC kinase; c-src tyrosine kinase; CSK, non-receptor tyrosine kinase; LOC315707; MGC112926; protein-tyrosine kinase (CSK); tyrosine-protein kinase CSK
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Species
Gene symbol and name
Data Source
Assertion derived from
less info ...
Orthologs 1
Homo sapiens (human):
CSK (C-terminal Src kinase) HGNC
EggNOG, Ensembl, HomoloGene, Inparanoid, NCBI, OMA, OrthoDB, OrthoMCL, Panther, PhylomeDB, Treefam
Mus musculus (house mouse):
Csk (c-src tyrosine kinase) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chinchilla lanigera (long-tailed chinchilla):
Csk (C-terminal Src kinase) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Pan paniscus (bonobo/pygmy chimpanzee):
CSK (C-terminal Src kinase) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Canis lupus familiaris (dog):
CSK (C-terminal Src kinase) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Ictidomys tridecemlineatus (thirteen-lined ground squirrel):
Csk (C-terminal Src kinase) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Sus scrofa (pig):
CSK (C-terminal Src kinase) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chlorocebus sabaeus (green monkey):
CSK (C-terminal Src kinase) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Heterocephalus glaber (naked mole-rat):
Csk (C-terminal Src kinase) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Other homologs 2
Homo sapiens (human):
CYP2E1 (cytochrome P450 family 2 subfamily E member 1) HGNC
OMA
Alliance orthologs 3
Homo sapiens (human):
CSK (C-terminal Src kinase)
Alliance
DIOPT (Ensembl Compara|HGNC|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Mus musculus (house mouse):
Csk (c-src tyrosine kinase)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Danio rerio (zebrafish):
csk (C-terminal Src kinase)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Drosophila melanogaster (fruit fly):
Csk
Alliance
DIOPT (Ensembl Compara|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Caenorhabditis elegans (roundworm):
csk-1
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Xenopus tropicalis (tropical clawed frog):
csk
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 8 66,925,650 - 66,944,861 (-) NCBI GRCr8 mRatBN7.2 8 58,029,748 - 58,048,742 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 8 58,029,749 - 58,048,292 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 8 63,562,597 - 63,567,220 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 8 61,840,172 - 61,844,795 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 8 59,704,719 - 59,709,342 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 8 62,405,714 - 62,424,707 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 8 62,405,715 - 62,424,303 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 8 62,183,286 - 62,208,785 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 8 61,381,336 - 61,386,013 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 8 61,400,389 - 61,405,067 (-) NCBI Celera 8 57,495,667 - 57,500,290 (-) NCBI Celera Cytogenetic Map 8 q24 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Csk Rat (+)-schisandrin B multiple interactions EXP 6480464 schizandrin B inhibits the reaction [Carbon Tetrachloride results in decreased expression of CSK mRNA] CTD PMID:31150632 Csk Rat (1->4)-beta-D-glucan multiple interactions ISO Csk (Mus musculus) 6480464 [perfluorooctane sulfonic acid co-treated with Cellulose] results in decreased expression of CSK mRNA CTD PMID:36331819 Csk Rat (R)-adrenaline multiple interactions ISO Csk (Mus musculus) 6480464 CSK protein promotes the reaction [Epinephrine results in increased abundance of Cyclic AMP] and Isoproterenol inhibits the reaction [CSK protein promotes the reaction [Epinephrine results in increased abundance of Cyclic AMP]] CTD PMID:1699227 Csk Rat 1,2-dimethylhydrazine increases expression ISO Csk (Mus musculus) 6480464 1 and 2-Dimethylhydrazine results in increased expression of CSK mRNA CTD PMID:22206623 Csk Rat 17alpha-ethynylestradiol affects expression ISO Csk (Mus musculus) 6480464 Ethinyl Estradiol affects the expression of CSK mRNA CTD PMID:17555576 Csk Rat 17alpha-ethynylestradiol increases expression ISO Csk (Mus musculus) 6480464 Ethinyl Estradiol results in increased expression of CSK mRNA CTD PMID:17942748 Csk Rat 17beta-estradiol increases expression ISO CSK (Homo sapiens) 6480464 Estradiol results in increased expression of CSK mRNA CTD PMID:31614463 Csk Rat 17beta-hydroxy-5alpha-androstan-3-one increases expression ISO CSK (Homo sapiens) 6480464 Dihydrotestosterone results in increased expression of CSK mRNA CTD PMID:29581250 Csk Rat 2,3,7,8-tetrachlorodibenzodioxine increases expression EXP 6480464 Tetrachlorodibenzodioxin results in increased expression of CSK mRNA CTD PMID:18796159 and PMID:33387578 Csk Rat 2,3,7,8-tetrachlorodibenzodioxine increases expression ISO CSK (Homo sapiens) 6480464 Tetrachlorodibenzodioxin results in increased expression of CSK mRNA CTD PMID:21802500 and PMID:23152189 Csk Rat 2,3,7,8-tetrachlorodibenzodioxine increases response to substance ISO Csk (Mus musculus) 6480464 CSK protein results in increased susceptibility to Tetrachlorodibenzodioxin CTD PMID:9664232 Csk Rat 2,3,7,8-tetrachlorodibenzodioxine multiple interactions ISO Csk (Mus musculus) 6480464 CSK protein promotes the reaction [Tetrachlorodibenzodioxin inhibits the reaction [EGF protein binds to EGFR protein]] more ... CTD PMID:9664232 Csk Rat 2,3,7,8-tetrachlorodibenzodioxine affects expression EXP 6480464 Tetrachlorodibenzodioxin affects the expression of CSK mRNA CTD PMID:22298810 and PMID:34747641 Csk Rat 2,4-dibromophenyl 2,4,5-tribromophenyl ether decreases expression EXP 6480464 2 more ... CTD PMID:19954255 Csk Rat 2,4-dinitrotoluene affects expression EXP 6480464 2 and 4-dinitrotoluene affects the expression of CSK mRNA CTD PMID:21346803 Csk Rat 2,6-dinitrotoluene affects expression EXP 6480464 2 and 6-dinitrotoluene affects the expression of CSK mRNA CTD PMID:21346803 Csk Rat 2-hydroxypropanoic acid decreases expression ISO CSK (Homo sapiens) 6480464 Lactic Acid results in decreased expression of CSK mRNA CTD PMID:30851411 Csk Rat 3',5'-cyclic AMP multiple interactions ISO Csk (Mus musculus) 6480464 CSK protein promotes the reaction [Epinephrine results in increased abundance of Cyclic AMP] more ... CTD PMID:1699227 Csk Rat 3,3',5-triiodo-L-thyronine multiple interactions ISO Csk (Mus musculus) 6480464 CSK protein promotes the reaction [Tetrachlorodibenzodioxin promotes the reaction [Triiodothyronine binds to THRA protein]] CTD PMID:9664232 Csk Rat 3-chloropropane-1,2-diol increases expression EXP 6480464 alpha-Chlorohydrin results in increased expression of CSK protein CTD PMID:34915118 Csk Rat 4,4'-sulfonyldiphenol increases methylation ISO Csk (Mus musculus) 6480464 bisphenol S results in increased methylation of CSK promoter CTD PMID:33297965 Csk Rat 4,4'-sulfonyldiphenol increases expression ISO CSK (Homo sapiens) 6480464 bisphenol S results in increased expression of CSK protein CTD PMID:34186270 Csk Rat 4,4'-sulfonyldiphenol decreases expression ISO Csk (Mus musculus) 6480464 bisphenol S results in decreased expression of CSK mRNA CTD PMID:39298647 Csk Rat 4,4'-sulfonyldiphenol affects methylation ISO Csk (Mus musculus) 6480464 bisphenol S affects the methylation of CSK exon and bisphenol S affects the methylation of CSK gene CTD PMID:31683443 and PMID:33297965 Csk Rat 6-propyl-2-thiouracil increases expression EXP 6480464 Propylthiouracil results in increased expression of CSK mRNA CTD PMID:24780913 Csk Rat aflatoxin B1 increases expression ISO CSK (Homo sapiens) 6480464 Aflatoxin B1 results in increased expression of CSK mRNA CTD PMID:22100608 Csk Rat all-trans-retinoic acid increases expression ISO CSK (Homo sapiens) 6480464 Tretinoin results in increased expression of CSK mRNA CTD PMID:33167477 Csk Rat alpha-Zearalanol increases expression EXP 6480464 Zeranol results in increased expression of CSK mRNA CTD PMID:35163327 Csk Rat ammonium chloride affects expression EXP 6480464 Ammonium Chloride affects the expression of CSK mRNA CTD PMID:16483693 Csk Rat arachidonic acid increases activity ISO CSK (Homo sapiens) 6480464 Arachidonic Acid results in increased activity of CSK protein CTD PMID:18388244 Csk Rat arachidonic acid affects localization ISO CSK (Homo sapiens) 6480464 Arachidonic Acid affects the localization of CSK protein CTD PMID:18388244 Csk Rat aristolochic acid A increases expression ISO CSK (Homo sapiens) 6480464 aristolochic acid I results in increased expression of CSK mRNA CTD PMID:33212167 Csk Rat atrazine increases expression ISO CSK (Homo sapiens) 6480464 Atrazine results in increased expression of CSK mRNA CTD PMID:22378314 Csk Rat Azoxymethane multiple interactions EXP 6480464 [[Azoxymethane co-treated with Sulindac] results in increased expression of CSK protein] which results in increased phosphorylation of and results in decreased activity of SRC protein and [Azoxymethane co-treated with Sulindac] results in increased expression of CSK protein CTD PMID:18644992 Csk Rat beauvericin decreases expression ISO CSK (Homo sapiens) 6480464 beauvericin results in decreased expression of CSK mRNA CTD PMID:29203277 Csk Rat benzo[a]pyrene decreases expression ISO Csk (Mus musculus) 6480464 Benzo(a)pyrene results in decreased expression of CSK mRNA CTD PMID:21569818 Csk Rat benzo[a]pyrene increases expression ISO CSK (Homo sapiens) 6480464 Benzo(a)pyrene results in increased expression of CSK protein CTD PMID:33278487 Csk Rat benzo[a]pyrene affects methylation ISO CSK (Homo sapiens) 6480464 Benzo(a)pyrene affects the methylation of CSK 5' UTR CTD PMID:27901495 Csk Rat benzo[a]pyrene increases expression ISO Csk (Mus musculus) 6480464 Benzo(a)pyrene results in increased expression of CSK mRNA CTD PMID:22228805 Csk Rat bisphenol A affects expression EXP 6480464 bisphenol A affects the expression of CSK mRNA CTD PMID:25181051 Csk Rat bisphenol A decreases expression ISO CSK (Homo sapiens) 6480464 bisphenol A results in decreased expression of CSK protein CTD PMID:34186270 Csk Rat bisphenol A increases expression EXP 6480464 bisphenol A results in increased expression of CSK mRNA CTD PMID:31771501 and PMID:34947998 Csk Rat bisphenol AF increases expression ISO CSK (Homo sapiens) 6480464 bisphenol AF results in increased expression of CSK protein CTD PMID:34186270 Csk Rat bosutinib decreases activity EXP 6480464 bosutinib results in decreased activity of CSK protein CTD PMID:17114238 Csk Rat butan-1-ol multiple interactions ISO CSK (Homo sapiens) 6480464 [[Gasoline co-treated with 1-Butanol] results in increased abundance of [Particulate Matter co-treated with Polycyclic Aromatic Hydrocarbons]] which results in increased expression of CSK mRNA CTD PMID:29432896 Csk Rat caffeine increases phosphorylation ISO CSK (Homo sapiens) 6480464 Caffeine results in increased phosphorylation of CSK protein CTD PMID:35688186 Csk Rat calcitriol increases phosphorylation ISO CSK (Homo sapiens) 6480464 Calcitriol results in increased phosphorylation of CSK protein CTD PMID:20371703 Csk Rat calcitriol multiple interactions ISO CSK (Homo sapiens) 6480464 Calcitriol results in increased localization of [VDR protein co-treated with CSK protein] more ... CTD PMID:20371703 Csk Rat cannabidiol multiple interactions ISO CSK (Homo sapiens) 6480464 [Cannabidiol co-treated with moringin] results in increased expression of CSK mRNA CTD PMID:30096889 Csk Rat chlorpyrifos increases expression ISO Csk (Mus musculus) 6480464 Chlorpyrifos results in increased expression of CSK mRNA CTD PMID:37019170 Csk Rat clofibrate decreases expression ISO Csk (Mus musculus) 6480464 Clofibrate results in decreased expression of CSK mRNA CTD PMID:17585979 Csk Rat cobalt dichloride decreases expression ISO CSK (Homo sapiens) 6480464 cobaltous chloride results in decreased expression of CSK mRNA CTD PMID:19320972 Csk Rat copper(II) chloride increases expression ISO CSK (Homo sapiens) 6480464 cupric chloride results in increased expression of CSK mRNA CTD PMID:38568856 Csk Rat cyclophosphamide decreases expression ISO Csk (Mus musculus) 6480464 Cyclophosphamide results in decreased expression of CSK mRNA CTD PMID:21041162 Csk Rat dexamethasone decreases expression ISO Csk (Mus musculus) 6480464 Dexamethasone results in decreased expression of CSK mRNA CTD PMID:21041162 Csk Rat Dibutyl phosphate affects expression ISO CSK (Homo sapiens) 6480464 di-n-butylphosphoric acid affects the expression of CSK mRNA CTD PMID:37042841 Csk Rat dicrotophos increases expression ISO CSK (Homo sapiens) 6480464 dicrotophos results in increased expression of CSK mRNA CTD PMID:28302478 Csk Rat diethylstilbestrol decreases expression ISO Csk (Mus musculus) 6480464 Diethylstilbestrol results in decreased expression of CSK mRNA CTD PMID:21041162 Csk Rat doxorubicin increases expression ISO Csk (Mus musculus) 6480464 Doxorubicin results in increased expression of CSK mRNA CTD PMID:22008532 Csk Rat doxorubicin decreases expression ISO CSK (Homo sapiens) 6480464 Doxorubicin results in decreased expression of CSK mRNA CTD PMID:29803840 Csk Rat elemental selenium increases expression ISO CSK (Homo sapiens) 6480464 Selenium results in increased expression of CSK mRNA CTD PMID:19244175 Csk Rat enzyme inhibitor multiple interactions ISO CSK (Homo sapiens) 6480464 [Enzyme Inhibitors results in decreased activity of OGA protein] which results in increased O-linked glycosylation of CSK protein CTD PMID:23301498 Csk Rat ethanol multiple interactions ISO CSK (Homo sapiens) 6480464 [[Gasoline co-treated with Ethanol] results in increased abundance of [Particulate Matter co-treated with Polycyclic Aromatic Hydrocarbons]] which results in increased expression of CSK mRNA CTD PMID:29432896 Csk Rat ethanol affects splicing ISO Csk (Mus musculus) 6480464 Ethanol affects the splicing of CSK mRNA CTD PMID:30319688 Csk Rat formaldehyde decreases expression ISO CSK (Homo sapiens) 6480464 Formaldehyde results in decreased expression of CSK mRNA CTD PMID:23649840 Csk Rat geldanamycin multiple interactions ISO Csk (Mus musculus) 6480464 geldanamycin inhibits the reaction [CSK protein results in increased susceptibility to Tetrachlorodibenzodioxin] and geldanamycin inhibits the reaction [Tetrachlorodibenzodioxin promotes the reaction [CSK protein binds to AHR protein]] CTD PMID:9664232 Csk Rat geldanamycin decreases activity ISO Csk (Mus musculus) 6480464 geldanamycin results in decreased activity of CSK protein CTD PMID:9664232 Csk Rat gentamycin increases expression EXP 6480464 Gentamicins results in increased expression of CSK mRNA CTD PMID:22061828 Csk Rat gentamycin decreases expression EXP 6480464 Gentamicins results in decreased expression of CSK mRNA CTD PMID:33387578 Csk Rat isobutanol multiple interactions ISO CSK (Homo sapiens) 6480464 [[Gasoline co-treated with isobutyl alcohol] results in increased abundance of [Particulate Matter co-treated with Polycyclic Aromatic Hydrocarbons]] which results in increased expression of CSK mRNA CTD PMID:29432896 Csk Rat isoprenaline multiple interactions ISO Csk (Mus musculus) 6480464 CSK protein promotes the reaction [Isoproterenol results in increased abundance of Cyclic AMP] and Isoproterenol inhibits the reaction [CSK protein promotes the reaction [Epinephrine results in increased abundance of Cyclic AMP]] CTD PMID:1699227 Csk Rat ivermectin decreases expression ISO CSK (Homo sapiens) 6480464 Ivermectin results in decreased expression of CSK protein CTD PMID:32959892 Csk Rat leflunomide increases expression EXP 6480464 leflunomide results in increased expression of CSK mRNA CTD PMID:24136188 Csk Rat manganese atom multiple interactions ISO CSK (Homo sapiens) 6480464 [manganese chloride results in increased abundance of Manganese] which results in decreased expression of CSK mRNA CTD PMID:39836092 Csk Rat manganese(0) multiple interactions ISO CSK (Homo sapiens) 6480464 [manganese chloride results in increased abundance of Manganese] which results in decreased expression of CSK mRNA CTD PMID:39836092 Csk Rat manganese(II) chloride multiple interactions ISO CSK (Homo sapiens) 6480464 [manganese chloride results in increased abundance of Manganese] which results in decreased expression of CSK mRNA CTD PMID:39836092 Csk Rat methyl methanesulfonate decreases expression ISO CSK (Homo sapiens) 6480464 Methyl Methanesulfonate results in decreased expression of CSK mRNA CTD PMID:23649840 Csk Rat N-nitrosodiethylamine multiple interactions EXP 6480464 [Diethylnitrosamine co-treated with caffeic acid phenethyl ester] results in decreased expression of CSK mRNA CTD PMID:20360939 Csk Rat nitrates multiple interactions ISO Csk (Mus musculus) 6480464 [Particulate Matter results in increased abundance of Nitrates] which results in increased expression of CSK mRNA CTD PMID:35964746 Csk Rat nitrofen decreases expression EXP 6480464 nitrofen results in decreased expression of CSK mRNA CTD PMID:33484710 Csk Rat ozone multiple interactions ISO Csk (Mus musculus) 6480464 [Air Pollutants results in increased abundance of [Ozone co-treated with Soot]] which results in decreased expression of CSK mRNA CTD PMID:34911549 Csk Rat perfluorododecanoic acid decreases expression EXP 6480464 perfluorododecanoic acid results in decreased expression of CSK mRNA and perfluorododecanoic acid results in decreased expression of CSK protein CTD PMID:19854247 Csk Rat perfluorooctane-1-sulfonic acid multiple interactions ISO Csk (Mus musculus) 6480464 [perfluorooctane sulfonic acid co-treated with Cellulose] results in decreased expression of CSK mRNA CTD PMID:36331819 Csk Rat phenethyl caffeate multiple interactions EXP 6480464 [Diethylnitrosamine co-treated with caffeic acid phenethyl ester] results in decreased expression of CSK mRNA CTD PMID:20360939 Csk Rat phosgene affects expression ISO Csk (Mus musculus) 6480464 Phosgene affects the expression of CSK mRNA CTD PMID:16300373 Csk Rat ponatinib decreases activity ISO CSK (Homo sapiens) 6480464 ponatinib results in decreased activity of CSK protein CTD PMID:19878872 Csk Rat potassium dichromate increases expression ISO CSK (Homo sapiens) 6480464 Potassium Dichromate results in increased expression of CSK mRNA CTD PMID:11678601 Csk Rat progesterone decreases expression ISO CSK (Homo sapiens) 6480464 Progesterone results in decreased expression of CSK mRNA CTD PMID:18037150 Csk Rat pyrazoles decreases activity ISO CSK (Homo sapiens) 6480464 Pyrazoles analog results in decreased activity of CSK protein CTD PMID:12534346 Csk Rat pyrimidines decreases activity ISO CSK (Homo sapiens) 6480464 Pyrimidines analog results in decreased activity of CSK protein CTD PMID:12534346 Csk Rat rac-lactic acid decreases expression ISO CSK (Homo sapiens) 6480464 Lactic Acid results in decreased expression of CSK mRNA CTD PMID:30851411 Csk Rat saracatinib multiple interactions ISO CSK (Homo sapiens) 6480464 saracatinib inhibits the reaction [CSK protein results in decreased expression of CYP7A1 mRNA] CTD PMID:20371703 Csk Rat saracatinib decreases activity ISO CSK (Homo sapiens) 6480464 saracatinib results in decreased activity of CSK protein CTD PMID:20371703 Csk Rat selenium atom increases expression ISO CSK (Homo sapiens) 6480464 Selenium results in increased expression of CSK mRNA CTD PMID:19244175 Csk Rat sodium arsenite decreases expression ISO CSK (Homo sapiens) 6480464 sodium arsenite results in decreased expression of CSK mRNA CTD PMID:38568856 Csk Rat sodium dichromate decreases expression ISO Csk (Mus musculus) 6480464 sodium bichromate results in decreased expression of CSK mRNA CTD PMID:31558096 Csk Rat Soman increases expression EXP 6480464 Soman results in increased expression of CSK mRNA CTD PMID:19281266 Csk Rat sulindac multiple interactions ISO CSK (Homo sapiens) 6480464 CSK protein affects the reaction [Sulindac results in increased expression of CDKN1A protein] CTD PMID:18644992 Csk Rat sulindac multiple interactions EXP 6480464 [[Azoxymethane co-treated with Sulindac] results in increased expression of CSK protein] which results in increased phosphorylation of and results in decreased activity of SRC protein and [Azoxymethane co-treated with Sulindac] results in increased expression of CSK protein CTD PMID:18644992 Csk Rat sunitinib increases expression ISO CSK (Homo sapiens) 6480464 Sunitinib results in increased expression of CSK mRNA CTD PMID:31533062 Csk Rat tamoxifen affects expression ISO Csk (Mus musculus) 6480464 Tamoxifen affects the expression of CSK mRNA CTD PMID:17555576 Csk Rat terbutaline multiple interactions ISO Csk (Mus musculus) 6480464 CSK protein promotes the reaction [Terbutaline results in increased abundance of Cyclic AMP] CTD PMID:1699227 Csk Rat tetrachloromethane decreases expression EXP 6480464 Carbon Tetrachloride results in decreased expression of CSK mRNA CTD PMID:31150632 Csk Rat tetrachloromethane multiple interactions EXP 6480464 schizandrin B inhibits the reaction [Carbon Tetrachloride results in decreased expression of CSK mRNA] CTD PMID:31150632 Csk Rat thioacetamide decreases expression EXP 6480464 Thioacetamide results in decreased expression of CSK mRNA CTD PMID:34492290 Csk Rat trichostatin A affects expression ISO CSK (Homo sapiens) 6480464 trichostatin A affects the expression of CSK mRNA CTD PMID:28542535 Csk Rat trimellitic anhydride increases expression ISO Csk (Mus musculus) 6480464 trimellitic anhydride results in increased expression of CSK mRNA CTD PMID:19042947 Csk Rat triphenyl phosphate affects expression ISO CSK (Homo sapiens) 6480464 triphenyl phosphate affects the expression of CSK mRNA CTD PMID:37042841 Csk Rat valproic acid increases expression ISO CSK (Homo sapiens) 6480464 Valproic Acid results in increased expression of CSK mRNA CTD PMID:23179753 Csk Rat vanadium atom decreases expression ISO CSK (Homo sapiens) 6480464 Vanadium results in decreased expression of CSK mRNA CTD PMID:19000753 Csk Rat vanadium(0) decreases expression ISO CSK (Homo sapiens) 6480464 Vanadium results in decreased expression of CSK mRNA CTD PMID:19000753 Csk Rat vinclozolin decreases expression EXP 6480464 vinclozolin results in decreased expression of CSK mRNA CTD PMID:23034163
Imported Annotations - KEGG (archival)
Imported Annotations - PID (archival)
External Pathway Database Links
(+)-schisandrin B (EXP) (1->4)-beta-D-glucan (ISO) (R)-adrenaline (ISO) 1,2-dimethylhydrazine (ISO) 17alpha-ethynylestradiol (ISO) 17beta-estradiol (ISO) 17beta-hydroxy-5alpha-androstan-3-one (ISO) 2,3,7,8-tetrachlorodibenzodioxine (EXP,ISO) 2,4-dibromophenyl 2,4,5-tribromophenyl ether (EXP) 2,4-dinitrotoluene (EXP) 2,6-dinitrotoluene (EXP) 2-hydroxypropanoic acid (ISO) 3',5'-cyclic AMP (ISO) 3,3',5-triiodo-L-thyronine (ISO) 3-chloropropane-1,2-diol (EXP) 4,4'-sulfonyldiphenol (ISO) 6-propyl-2-thiouracil (EXP) aflatoxin B1 (ISO) all-trans-retinoic acid (ISO) alpha-Zearalanol (EXP) ammonium chloride (EXP) arachidonic acid (ISO) aristolochic acid A (ISO) atrazine (ISO) Azoxymethane (EXP) beauvericin (ISO) benzo[a]pyrene (ISO) bisphenol A (EXP,ISO) bisphenol AF (ISO) bosutinib (EXP) butan-1-ol (ISO) caffeine (ISO) calcitriol (ISO) cannabidiol (ISO) chlorpyrifos (ISO) clofibrate (ISO) cobalt dichloride (ISO) copper(II) chloride (ISO) cyclophosphamide (ISO) dexamethasone (ISO) Dibutyl phosphate (ISO) dicrotophos (ISO) diethylstilbestrol (ISO) doxorubicin (ISO) elemental selenium (ISO) enzyme inhibitor (ISO) ethanol (ISO) formaldehyde (ISO) geldanamycin (ISO) gentamycin (EXP) isobutanol (ISO) isoprenaline (ISO) ivermectin (ISO) leflunomide (EXP) manganese atom (ISO) manganese(0) (ISO) manganese(II) chloride (ISO) methyl methanesulfonate (ISO) N-nitrosodiethylamine (EXP) nitrates (ISO) nitrofen (EXP) ozone (ISO) perfluorododecanoic acid (EXP) perfluorooctane-1-sulfonic acid (ISO) phenethyl caffeate (EXP) phosgene (ISO) ponatinib (ISO) potassium dichromate (ISO) progesterone (ISO) pyrazoles (ISO) pyrimidines (ISO) rac-lactic acid (ISO) saracatinib (ISO) selenium atom (ISO) sodium arsenite (ISO) sodium dichromate (ISO) Soman (EXP) sulindac (EXP,ISO) sunitinib (ISO) tamoxifen (ISO) terbutaline (ISO) tetrachloromethane (EXP) thioacetamide (EXP) trichostatin A (ISO) trimellitic anhydride (ISO) triphenyl phosphate (ISO) valproic acid (ISO) vanadium atom (ISO) vanadium(0) (ISO) vinclozolin (EXP)
External Pathway Database Links
1.
Recombinant Csk expressed in Escherichia coli is autophosphorylated on tyrosine residue(s).
Bougeret C, etal., Oncogene. 1993 May;8(5):1241-7.
2.
Fer kinase/FerT and adherens junction dynamics in the testis: an in vitro and in vivo study.
Chen YM, etal., Biol Reprod. 2003 Aug;69(2):656-72. Epub 2003 Apr 16.
3.
Association of inhibitory tyrosine protein kinase p50csk with protein tyrosine phosphatase PEP in T cells and other hemopoietic cells.
Cloutier JF and Veillette A, EMBO J. 1996 Sep 16;15(18):4909-18.
4.
Integrins direct Src family kinases to regulate distinct phases of oligodendrocyte development.
Colognato H, etal., J Cell Biol. 2004 Oct 25;167(2):365-75.
5.
CSK negatively regulates nerve growth factor induced neural differentiation and augments AKT kinase activity.
Dey N, etal., Exp Cell Res. 2005 Jul 1;307(1):1-14.
6.
Functional modification of a murine macrophage cell line, J744A.1, transfected with rat csk genes.
Dondog EA Hokkaido Igaku Zasshi. 2000 May;75(3):197-208.
7.
Phylogenetic-based propagation of functional annotations within the Gene Ontology consortium.
Gaudet P, etal., Brief Bioinform. 2011 Sep;12(5):449-62. doi: 10.1093/bib/bbr042. Epub 2011 Aug 27.
8.
Rat ISS GO annotations from GOA human gene data--August 2006
GOA data from the GO Consortium
9.
Roles of C-terminal Src kinase in the initiation and the termination of the high affinity IgE receptor-mediated signaling.
Honda Z, etal., J Biol Chem. 1997 Oct 10;272(41):25753-60.
10.
Regulation of Src family kinases in the developing rat brain: correlation with their regulator kinase, Csk.
Inomata M, etal., J Biochem. 1994 Aug;116(2):386-92.
11.
Down-regulation of the tumor suppressor gene C-terminal Src kinase: an early event during premalignant colonic epithelial hyperproliferation.
Kunte DP, etal., FEBS Lett. 2005 Jul 4;579(17):3497-502.
12.
Protein kinases and adherens junction dynamics in the seminiferous epithelium of the rat testis.
Lee NP and Cheng CY, J Cell Physiol. 2005 Feb;202(2):344-60.
13.
Adrenomedullin inhibits angiotensin II-induced oxidative stress via Csk-mediated inhibition of Src activity.
Liu J, etal., Am J Physiol Heart Circ Physiol. 2007 Apr;292(4):H1714-21. Epub 2006 Oct 27.
14.
Reduced C-terminal Src kinase (Csk) activities in hepatocellular carcinoma.
Masaki T, etal., Hepatology. 1999 Feb;29(2):379-84.
15.
Cardiomyocyte apoptosis triggered by RAFTK/pyk2 via Src kinase is antagonized by paxillin.
Melendez J, etal., J Biol Chem. 2004 Dec 17;279(51):53516-23. Epub 2004 Aug 22.
16.
Rat ISS GO annotations from MGI mouse gene data--August 2006
MGD data from the GO Consortium
17.
KEGG Annotation Import Pipeline
Pipeline to import KEGG annotations from KEGG into RGD
18.
PID Annotation Import Pipeline
Pipeline to import Pathway Interaction Database annotations from NCI into RGD
19.
GOA pipeline
RGD automated data pipeline
20.
ClinVar Automated Import and Annotation Pipeline
RGD automated import pipeline for ClinVar variants, variant-to-disease annotations and gene-to-disease annotations
21.
Data Import for Chemical-Gene Interactions
RGD automated import pipeline for gene-chemical interactions
22.
Mammalian Pragmin regulates Src family kinases via the Glu-Pro-Ile-Tyr-Ala (EPIYA) motif that is exploited by bacterial effectors.
Safari F, etal., Proc Natl Acad Sci U S A. 2011 Sep 6;108(36):14938-43. doi: 10.1073/pnas.1107740108. Epub 2011 Aug 22.
23.
A functional polymorphism of Ptpn22 is associated with type 1 diabetes in the BioBreeding rat.
Sarmiento J, etal., J Immunol. 2015 Jan 15;194(2):615-29. doi: 10.4049/jimmunol.1302689. Epub 2014 Dec 12.
24.
C-terminal Src kinase-mediated EPIYA phosphorylation of Pragmin creates a feed-forward C-terminal Src kinase activation loop that promotes cell motility.
Senda Y, etal., Cancer Sci. 2016 Jul;107(7):972-80. doi: 10.1111/cas.12962. Epub 2016 Jun 13.
25.
Suppression of arthritic bone destruction by adenovirus-mediated csk gene transfer to synoviocytes and osteoclasts.
Takayanagi H, etal., J Clin Invest. 1999 Jul;104(2):137-46.
26.
C-terminal SRC kinase controls acute inflammation and granulocyte adhesion.
Thomas RM, etal., Immunity. 2004 Feb;20(2):181-91.
27.
SH2 domain-mediated interaction of inhibitory protein tyrosine kinase Csk with protein tyrosine phosphatase-HSCF.
Wang B, etal., Mol Cell Biol. 2001 Feb;21(4):1077-88.
Csk Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 8 66,925,650 - 66,944,861 (-) NCBI GRCr8 mRatBN7.2 8 58,029,748 - 58,048,742 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 8 58,029,749 - 58,048,292 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 8 63,562,597 - 63,567,220 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 8 61,840,172 - 61,844,795 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 8 59,704,719 - 59,709,342 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 8 62,405,714 - 62,424,707 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 8 62,405,715 - 62,424,303 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 8 62,183,286 - 62,208,785 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 8 61,381,336 - 61,386,013 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 8 61,400,389 - 61,405,067 (-) NCBI Celera 8 57,495,667 - 57,500,290 (-) NCBI Celera Cytogenetic Map 8 q24 NCBI
CSK Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 15 74,782,080 - 74,803,197 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 15 74,782,080 - 74,803,197 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 15 75,074,421 - 75,095,538 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 15 72,861,768 - 72,882,558 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 15 72,861,767 - 72,882,557 NCBI Celera 15 52,024,458 - 52,045,568 (+) NCBI Celera Cytogenetic Map 15 q24.1 NCBI HuRef 15 51,872,089 - 51,892,744 (+) NCBI HuRef CHM1_1 15 75,192,927 - 75,214,023 (+) NCBI CHM1_1 T2T-CHM13v2.0 15 72,651,992 - 72,673,091 (+) NCBI T2T-CHM13v2.0
Csk Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 9 57,533,929 - 57,560,758 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 9 57,533,929 - 57,560,914 (-) Ensembl GRCm39 Ensembl GRCm38 9 57,626,646 - 57,653,631 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 9 57,626,646 - 57,653,631 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 9 57,474,453 - 57,492,987 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 9 57,424,783 - 57,443,317 (-) NCBI MGSCv36 mm8 Celera 9 54,862,569 - 54,881,336 (-) NCBI Celera Cytogenetic Map 9 B NCBI cM Map 9 31.18 NCBI
Csk Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955450 3,127,561 - 3,144,550 (-) Ensembl ChiLan1.0 ChiLan1.0 NW_004955450 3,127,561 - 3,144,550 (-) NCBI ChiLan1.0 ChiLan1.0
CSK Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 16 64,010,025 - 64,030,936 (+) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 15 68,173,681 - 68,194,308 (+) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 15 53,724,814 - 53,745,710 (+) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 15 73,342,703 - 73,363,476 (+) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 15 73,342,703 - 73,363,476 (+) Ensembl panpan1.1 panPan2
CSK Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 30 37,851,269 - 37,870,382 (+) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 30 37,852,046 - 37,870,378 (+) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 30 37,784,125 - 37,802,413 (+) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 30 38,056,541 - 38,074,206 (+) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 30 38,056,497 - 38,074,435 (+) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 30 38,009,325 - 38,027,610 (+) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 30 38,055,644 - 38,073,934 (+) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 30 38,291,119 - 38,309,429 (+) NCBI UU_Cfam_GSD_1.0
Csk Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024408640 115,909,712 - 115,929,808 (+) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936471 33,757,772 - 33,778,933 (+) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936471 33,757,778 - 33,777,871 (+) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
CSK Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 7 58,736,531 - 58,755,260 (-) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 7 58,736,473 - 58,755,034 (-) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 7 63,425,071 - 63,443,632 (-) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
CSK Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 26 8,667,657 - 8,688,850 (-) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 26 8,667,655 - 8,688,824 (-) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666048 132,942,200 - 132,963,400 (+) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Csk
.
Predicted Target Of
Count of predictions: 106 Count of miRNA genes: 94 Interacting mature miRNAs: 99 Transcripts: ENSRNOT00000026358 Prediction methods: Miranda, Rnahybrid Result types: miRGate_prediction
1298065 Scl16 Serum cholesterol level QTL 16 3.8 blood cholesterol amount (VT:0000180) plasma total cholesterol level (CMO:0000585) 8 30856404 75856404 Rat 1554321 Bmd3 Bone mineral density QTL 3 7.9 0.0001 femur mineral mass (VT:0010011) volumetric bone mineral density (CMO:0001553) 8 40952565 123900184 Rat 1578769 Uae31 Urinary albumin excretion QTL 31 3.3 0.001 urine albumin amount (VT:0002871) urine albumin excretion rate (CMO:0000757) 8 30848154 101699754 Rat 1298079 Activ2 Activity QTL 2 9.5 0.000001 voluntary movement trait (VT:0003491) rearing measurement (CMO:0001515) 8 41866876 86866876 Rat 11556286 Cm81 Cardiac mass QTL 81 0.01 heart mass (VT:0007028) heart weight to body weight ratio (CMO:0000074) 8 30848154 61290444 Rat 70161 Bp62 Blood pressure QTL 62 2.9 0.001 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 8 42692684 90165460 Rat 1578765 Klgr1 Kidney lesion grade QTL 1 3.3 0.0001 kidney morphology trait (VT:0002135) organ lesion measurement (CMO:0000677) 8 30848154 101699754 Rat 1582222 Epfw2 Epididymal fat weight QTL 2 3.2 0.0005 epididymal fat pad mass (VT:0010421) epididymal fat pad weight to body weight ratio (CMO:0000658) 8 31737729 76737729 Rat 61464 Niddm11 Non-insulin dependent diabetes mellitus QTL 11 3.1 0.001 blood insulin amount (VT:0001560) plasma insulin level (CMO:0000342) 8 35582032 80582032 Rat 4889938 Bss89 Bone structure and strength QTL 89 3.8 tibia size trait (VT:0100001) tibia cortical bone volume (CMO:0001725) 8 50095249 82460899 Rat 1578755 Pur5 Proteinuria QTL 5 3.3 0.0001 urine total protein amount (VT:0000032) urine total protein excretion rate (CMO:0000756) 8 30848154 101699754 Rat 1300146 Rf17 Renal function QTL 17 2.9 renal blood flow trait (VT:2000006) absolute change in renal blood flow rate (CMO:0001168) 8 28242912 73242912 Rat 8662823 Vetf5 Vascular elastic tissue fragility QTL 5 1.9 artery integrity trait (VT:0010639) patent ductus arteriosus score (CMO:0002566) 8 28242912 99525068 Rat 2313088 Bss75 Bone structure and strength QTL 75 3.1 0.0001 body length (VT:0001256) body length, nose to rump (CMO:0000079) 8 30848154 82460899 Rat 1358896 Bp262 Blood pressure QTL 262 2.89 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 8 27205715 99103503 Rat 731182 Uae24 Urinary albumin excretion QTL 24 6.4 urine albumin amount (VT:0002871) urine albumin excretion rate (CMO:0000757) 8 19331152 93965294 Rat 724514 Uae15 Urinary albumin excretion QTL 15 2.9 urine albumin amount (VT:0002871) urine albumin excretion rate (CMO:0000757) 8 29502665 70386295 Rat 61353 Bp35 Blood pressure QTL 35 0.001 arterial blood pressure trait (VT:2000000) diastolic blood pressure (CMO:0000005) 8 30848154 61290444 Rat 631842 Inf1 Infertility severity QTL 1 4.1 0.001 seminal gland mass (VT:0010524) seminal vesicle wet weight (CMO:0001603) 8 22662330 67662330 Rat 737824 Hcar10 Hepatocarcinoma resistance QTL 10 2.9 liver integrity trait (VT:0010547) liver tumorous lesion number (CMO:0001068) 8 40713066 82925667 Rat 1359033 Bp273 Blood pressure QTL 273 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 8 30848154 61290444 Rat 1331769 Rf39 Renal function QTL 39 3.871 urine output (VT:0003620) timed urine volume (CMO:0000260) 8 41866876 75097878 Rat 61358 Bp39 Blood pressure QTL 39 2 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 8 35551938 80551938 Rat 1358906 Bp253 Blood pressure QTL 253 4 0.0004 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 8 40713066 93965294 Rat 1358907 Cm40 Cardiac mass QTL 40 1.89 heart mass (VT:0007028) heart weight to body weight ratio (CMO:0000074) 8 27205715 99103503 Rat 1331744 Bp217 Blood pressure QTL 217 3.398 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 8 30848154 58482492 Rat 70197 BpQTLcluster8 Blood pressure QTL cluster 8 3.482 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 8 46531639 119088626 Rat 2316950 Scl66 Serum cholesterol level QTL 66 4.1 blood cholesterol amount (VT:0000180) plasma total cholesterol level (CMO:0000585) 8 30848259 105647037 Rat 1582254 Kidm31 Kidney mass QTL 31 3 kidney mass (VT:0002707) both kidneys wet weight (CMO:0000085) 8 54237644 85365202 Rat 10402857 Bp380 Blood pressure QTL 380 0.95 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 8 53968765 98968765 Rat 1358892 Kidm26 Kidney mass QTL 26 3.69 kidney mass (VT:0002707) both kidneys wet weight to body weight ratio (CMO:0000340) 8 27205715 99103503 Rat 631216 Stl9 Serum triglyceride level QTL 9 4.71 0.0001 blood triglyceride amount (VT:0002644) serum triglyceride level (CMO:0000360) 8 41867010 70386132 Rat 5684973 Bss100 Bone structure and strength QTL 100 4.7 tibia area (VT:1000281) tibia area measurement (CMO:0001382) 8 50095249 82460899 Rat 1582243 Bw66 Body weight QTL 66 3.4 0.0048 body mass (VT:0001259) body weight (CMO:0000012) 8 54237644 85365202 Rat 61373 Mcs4 Mammary carcinoma susceptibility QTL 4 1.1 mammary gland integrity trait (VT:0010552) mammary tumor number (CMO:0000343) 8 16290444 61290444 Rat 2313057 Bss76 Bone structure and strength QTL 76 3 0.0001 tibia size trait (VT:0100001) tibia midshaft cross-sectional area (CMO:0001717) 8 30848154 82460899 Rat 12879878 Bw183 Body weight QTL 183 0.001 body mass (VT:0001259) body weight (CMO:0000012) 8 43296169 98968765 Rat 1300177 Cm2 Cardiac mass QTL 2 3.65 heart mass (VT:0007028) heart weight (CMO:0000017) 8 54259986 100382532 Rat 1549908 Neudeg1 Neurodegradation QTL 1 5.5 0 nervous system integrity trait (VT:0010566) logarithm of the ratio of the lesioned side motor neuron count to contralateral side motor neuron count (CMO:0001986) 8 30188867 94457446 Rat 12879879 Cm99 Cardiac mass QTL 99 0.001 heart mass (VT:0007028) heart weight to body weight ratio (CMO:0000074) 8 43296169 98968765 Rat 2313067 Bss77 Bone structure and strength QTL 77 3.1 0.0001 tibia size trait (VT:0100001) tibia midshaft endosteal cross-sectional area (CMO:0001716) 8 30848154 82460899 Rat 12879880 Cm100 Cardiac mass QTL 100 0.001 heart left ventricle mass (VT:0007031) heart left ventricle weight to body weight ratio (CMO:0000530) 8 43296169 98968765 Rat 12879881 Cm101 Cardiac mass QTL 101 0.001 heart right ventricle mass (VT:0007033) heart right ventricle weight to body weight ratio (CMO:0000914) 8 43296169 98968765 Rat 12879882 Am8 Aortic mass QTL 8 0.001 aorta mass (VT:0002845) aorta weight to aorta length to body weight ratio (CMO:0002722) 8 43296169 98968765 Rat 12879883 Kidm65 Kidney mass QTL 65 0.001 kidney mass (VT:0002707) both kidneys wet weight to body weight ratio (CMO:0000340) 8 43296169 98968765 Rat 1358912 Bw51 Body weight QTL 51 2.95 body mass (VT:0001259) body weight (CMO:0000012) 8 51351728 107062046 Rat 2313086 Bss60 Bone structure and strength QTL 60 4.1 0.0001 tibia length (VT:0004357) tibia length (CMO:0000450) 8 50095249 82460899 Rat 1558646 Swd5 Spike wave discharge measurement QTL 5 3.45 0.00036 brain electrophysiology trait (VT:0010557) brain spike-and-wave discharge frequency (CMO:0001742) 8 14906751 59906751 Rat 2293697 Bmd39 Bone mineral density QTL 39 femur strength trait (VT:0010010) femur total energy absorbed before break (CMO:0001677) 8 54043744 98968765 Rat 1331837 Bw23 Body weight QTL 23 4.19 0.00007 body mass (VT:0001259) body weight (CMO:0000012) 8 46531722 99083736 Rat 1331838 Niddm61 Non-insulin dependent diabetes mellitus QTL 61 3.53 0.0004 blood insulin amount (VT:0001560) plasma insulin level (CMO:0000342) 8 36469535 99083736 Rat 631650 Stl6 Serum triglyceride level QTL 6 4 0.0019 blood triglyceride amount (VT:0002644) plasma triglyceride level (CMO:0000548) 8 10378157 112202585 Rat 1581557 Eae16 Experimental allergic encephalomyelitis QTL 16 3.8 nervous system integrity trait (VT:0010566) experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046) 8 8462195 110921472 Rat 631271 Lecl1 Lens clarity QTL 1 0.001 lens clarity trait (VT:0001304) age of onset/diagnosis of cataract (CMO:0001584) 8 18984168 84531599 Rat 2303564 Gluco43 Glucose level QTL 43 3 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 8 26130187 71130187 Rat 2303570 Gluco48 Glucose level QTL 48 2 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 8 49805831 94805831 Rat 2313046 Bss78 Bone structure and strength QTL 78 3.5 0.0001 tibia strength trait (VT:1000284) tibia total energy absorbed before break (CMO:0001736) 8 30848154 82460899 Rat 2303572 Insul13 Insulin level QTL 13 2 blood insulin amount (VT:0001560) blood insulin level (CMO:0000349) 8 26130187 71130187 Rat 2301402 Bp316 Blood pressure QTL 316 0.005 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 8 53968765 98968765 Rat 631664 Hcar3 Hepatocarcinoma resistance QTL 3 2.9 0.0005 liver integrity trait (VT:0010547) volume of individual liver tumorous lesion (CMO:0001078) 8 54237644 99103503 Rat
AW212630
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 8 58,029,812 - 58,029,924 (+) MAPPER mRatBN7.2 Rnor_6.0 8 62,405,779 - 62,405,890 NCBI Rnor6.0 Rnor_5.0 8 62,183,351 - 62,183,462 UniSTS Rnor5.0 RGSC_v3.4 8 61,381,401 - 61,381,512 UniSTS RGSC3.4 Celera 8 57,495,732 - 57,495,843 UniSTS Cytogenetic Map 8 q24 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
11
49
113
91
90
59
25
59
6
218
97
93
45
60
31
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000026358 ⟹ ENSRNOP00000026358
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 8 58,029,749 - 58,034,372 (-) Ensembl Rnor_6.0 Ensembl 8 62,405,715 - 62,410,338 (-) Ensembl
Ensembl Acc Id:
ENSRNOT00000091223 ⟹ ENSRNOP00000068638
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 8 58,029,754 - 58,048,292 (-) Ensembl Rnor_6.0 Ensembl 8 62,405,984 - 62,424,303 (-) Ensembl
RefSeq Acc Id:
NM_001030039 ⟹ NP_001025210
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 8 66,925,650 - 66,930,274 (-) NCBI mRatBN7.2 8 58,029,748 - 58,034,372 (-) NCBI Rnor_6.0 8 62,405,714 - 62,410,338 (-) NCBI Rnor_5.0 8 62,183,286 - 62,208,785 (-) NCBI RGSC_v3.4 8 61,381,336 - 61,386,013 (-) RGD Celera 8 57,495,667 - 57,500,290 (-) RGD
Sequence:
GTAACAGACCGGCCTTCCTGTAGCACGGGGACGCCAGATCTCAGAAGATGTCGGCTATACAGGCCTCCTGGCCATCCGGTACAGAATGTATTGCCAAGTACAACTTCCATGGCACTGCCGAGCAAGAC
hide sequence
RefSeq Acc Id:
XM_006243163 ⟹ XP_006243225
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 8 66,925,650 - 66,944,861 (-) NCBI mRatBN7.2 8 58,029,748 - 58,048,742 (-) NCBI Rnor_6.0 8 62,405,714 - 62,424,707 (-) NCBI Rnor_5.0 8 62,183,286 - 62,208,785 (-) NCBI
Sequence:
GCCGCGCTTCCTCTCACTAGGCCTGCGAGCTTCCTCCCATCGGAGCCCGGGCGAGCTGAGGTTG
hide sequence
RefSeq Acc Id:
XM_006243164 ⟹ XP_006243226
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 8 66,925,650 - 66,943,854 (-) NCBI mRatBN7.2 8 58,029,748 - 58,047,954 (-) NCBI Rnor_6.0 8 62,405,714 - 62,423,964 (-) NCBI Rnor_5.0 8 62,183,286 - 62,208,785 (-) NCBI
Sequence:
CACCCCCCAAACGGGTTCGAATTCTCCCGGGAATCACTGTCAGAACACTACTGGGAAGGAGCCACGAGGGAGATACTATCCTGCACCACAAGAGACTCGGCTTAGATCAGCTGAGTCCTACCTTCCCA
hide sequence
RefSeq Acc Id:
NP_001025210 ⟸ NM_001030039
- UniProtKB:
Q4G003 (UniProtKB/Swiss-Prot), P32577 (UniProtKB/Swiss-Prot), A6J4X1 (UniProtKB/TrEMBL), A0A8L2QZY0 (UniProtKB/TrEMBL)
- Sequence:
MSAIQASWPSGTECIAKYNFHGTAEQDLPFCKGDVLTIVAVTKDPNWYKAKNKVGREGIIPANYVQKREGVKAGTKLSLMPWFHGKITREQAERLLYPPETGLFLVRESTNYPGDYTLCVSCEGKVEH
hide sequence
RefSeq Acc Id:
XP_006243225 ⟸ XM_006243163
- Peptide Label:
isoform X1
- Sequence:
MSAIQASWPSGTECIAKYNFHGTAEQDLPFCKGDVLTIVAVTKDPNWYKAKNKVGREGIIPANYVQKREGVKAGTKLSLMPWFHGKITREQAERLLYPPETGLFLVRESTNYPGDYTLCVSCEGKVEH
hide sequence
RefSeq Acc Id:
XP_006243226 ⟸ XM_006243164
- Peptide Label:
isoform X1
- Sequence:
MSAIQASWPSGTECIAKYNFHGTAEQDLPFCKGDVLTIVAVTKDPNWYKAKNKVGREGIIPANYVQKREGVKAGTKLSLMPWFHGKITREQAERLLYPPETGLFLVRESTNYPGDYTLCVSCEGKVEH
hide sequence
Ensembl Acc Id:
ENSRNOP00000026358 ⟸ ENSRNOT00000026358
Ensembl Acc Id:
ENSRNOP00000068638 ⟸ ENSRNOT00000091223
RGD ID: 13696021 Promoter ID: EPDNEW_R6541 Type: initiation region Name: Csk_1 Description: C-terminal Src kinase SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Rat Assembly Chr Position (strand) Source Rnor_6.0 8 62,424,254 - 62,424,314 EPDNEW
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2017-05-18
Csk
C-terminal Src kinase
Csk
CSK, non-receptor tyrosine kinase
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2017-03-02
Csk
CSK, non-receptor tyrosine kinase
Csk
c-src tyrosine kinase
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2005-12-06
Csk
c-src tyrosine kinase
Csk_predicted
c-src tyrosine kinase (predicted)
Symbol and Name updated
1559027 APPROVED
2005-01-12
Csk_predicted
c-src tyrosine kinase (predicted)
Symbol and Name status set to approved
70820 APPROVED
