Igfbp1 Marker Search Result - Rat Genome Database

Advanced Search (OLGA)

General

Marker: Igfbp1

Symbol:

Igfbp1

Previously known as:

RGD ID:

7192201

Expected Size:

87 (bp)

Position

Rat Assembly	Chr	Position (strand)	Source	JBrowse
mRatBN7.2	14	82,050,373 - 82,051,888 (+)	MAPPER	mRatBN7.2
Rnor_6.0	14	87,451,675 - 87,453,189	NCBI	Rnor6.0
Rnor_5.0	14	81,086,015 - 81,087,529	UniSTS	Rnor5.0
RGSC_v3.4	14	87,953,181 - 87,954,695	UniSTS	RGSC3.4
Celera	14	81,124,646 - 81,126,166	UniSTS
Cytogenetic Map	14	q21	UniSTS

Is Marker For:

Genes: Igfbp1

#	Reference Title	Reference Citation
1.	UniSTS Pipeline	RGD automated pipelines


Forward Primer	AGAATGGATTTTATCACAGCAAAGAG
Reverse Primer	TTCCACTCCATGGGTAGACACA

The following Genes overlap with this region.

RGD ID	Symbol	Name	Chr	Start	Stop	Species
2872	Igfbp1	insulin-like growth factor binding protein 1	14	82047415	82052482	Rat


GenBank Nucleotide	BC078889.1	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	L22979.1	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	M58634.1	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	M89791.1	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
2313089	Bss81	Bone structure and strength QTL 81	3.4	0.0001	body length (VT:0001256)	body length, nose to rump (CMO:0000079)	14	37669719	82669719	Rat
9590294	Uminl4	Urine mineral level QTL 4	5.66	0.001	urine mineral amount (VT:0015086)	urine electrolyte level (CMO:0000593)	14	55624247	100624247	Rat
1582236	Gluco22	Glucose level QTL 22	3.3	0.0164	blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	14	73415323	92554092	Rat
631213	Bw60	Body weight QTL60	4.51		retroperitoneal fat pad mass (VT:0010430)	retroperitoneal fat pad weight to body weight ratio (CMO:0000635)	14	79950921	95876975	Rat
2300197	Scl59	Serum cholesterol level QTL 59			blood cholesterol amount (VT:0000180)	serum total cholesterol level (CMO:0000363)	14	55147478	100147478	Rat
70153	Bp59	Blood pressure QTL 59	3.2		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	14	68757796	83368335	Rat
631523	Pia13	Pristane induced arthritis QTL 13	3.3		joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	14	40793460	98037301	Rat
1582259	Gluco23	Glucose level QTL 23	3.1	0.0008	blood glucose amount (VT:0000188)	blood glucose level area under curve (AUC) (CMO:0000350)	14	70053989	104886043	Rat
1582197	Gluco27	Glucose level QTL 27	3.4	0.0006	blood glucose amount (VT:0000188)	blood glucose level area under curve (AUC) (CMO:0000350)	14	73415323	92554092	Rat
2313100	Bss82	Bone structure and strength QTL 82	3	0.0001	tibia size trait (VT:0100001)	tibia midshaft cross-sectional area (CMO:0001717)	14	37669719	82669719	Rat
634328	Hc5	Hypercalciuria QTL 5	2.3		urine calcium amount (VT:0002985)	urine calcium excretion rate (CMO:0000763)	14	58184885	103184885	Rat
1582250	Gluco26	Glucose level QTL 26	3.3	0.0009	blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	14	73415323	95876975	Rat
2317879	Alcrsp27	Alcohol response QTL 27	3.3	0.63	response to alcohol trait (VT:0010489)	duration of loss of righting reflex (CMO:0002289)	14	56631369	101631369	Rat
1641900	Alcrsp11	Alcohol response QTL 11			alcohol metabolism trait (VT:0015089)	blood ethanol level (CMO:0000535)	14	70053989	104886043	Rat
631839	Niddm37	Non-insulin dependent diabetes mellitus QTL 37	3.37		blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	14	11030622	95876975	Rat
1582255	Gluco29	Glucose level QTL 29	3.1	0.0025	blood glucose amount (VT:0000188)	absolute change in blood glucose level area under curve (CMO:0002034)	14	73415323	92554092	Rat
9589034	Epfw11	Epididymal fat weight QTL 11	6	0.001	epididymal fat pad mass (VT:0010421)	epididymal fat pad weight to body weight ratio (CMO:0000658)	14	55624247	100624247	Rat
1582209	Gluco20	Glucose level QTL 20	3.8	0.0005	blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	14	73415323	92554092	Rat
2313048	Bss84	Bone structure and strength QTL 84	3.1	0.0001	tibia strength trait (VT:1000284)	tibia total energy absorbed before break (CMO:0001736)	14	37669719	82669719	Rat
1300136	Rf22	Renal function QTL 22	3.9		renal blood flow trait (VT:2000006)	absolute change in renal vascular resistance (CMO:0001900)	14	42262529	95023211	Rat
1549834	Scl45	Serum cholesterol level QTL 45	5.8		blood cholesterol amount (VT:0000180)	serum total cholesterol level (CMO:0000363)	14	50023211	95023211	Rat
738037	Hcas6	Hepatocarcinoma susceptibility QTL 6	2.93		liver integrity trait (VT:0010547)	liver nonremodeling tumorous lesion volume to total liver volume ratio (CMO:0001464)	14	39057237	83368335	Rat
2313084	Bss83	Bone structure and strength QTL 83	2.9	0.0001	tibia size trait (VT:0100001)	tibia midshaft endosteal cross-sectional area (CMO:0001716)	14	37669719	82669719	Rat

Database	Acc Id	Source(s)
NCBI Gene	25685	UniSTS

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailable


InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailable


Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
		Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable

Create Name:

Description:

Send us a Message

Marker: Igfbp1